WO2009002719A1 - Liposomal inhibitory nucleic acid against stat proteins - Google Patents

Liposomal inhibitory nucleic acid against stat proteins Download PDF

Info

Publication number
WO2009002719A1
WO2009002719A1 PCT/US2008/066753 US2008066753W WO2009002719A1 WO 2009002719 A1 WO2009002719 A1 WO 2009002719A1 US 2008066753 W US2008066753 W US 2008066753W WO 2009002719 A1 WO2009002719 A1 WO 2009002719A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
composition
nucleic acid
sirna
stat3
Prior art date
Application number
PCT/US2008/066753
Other languages
French (fr)
Inventor
Charles N. Landen
Aparna A. Kamat
Anil K. Sood
Gabriel Lopez-Berestein
Original Assignee
The Board Of Regents Of The University Of Texas System
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Board Of Regents Of The University Of Texas System filed Critical The Board Of Regents Of The University Of Texas System
Publication of WO2009002719A1 publication Critical patent/WO2009002719A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • the present invention relates generally to the fields of molecular biology, RNA interference, and oncology. More particularly, the invention concerns compositions comprising an inhibitory nucleic acid, wherein the inhibitory nucleic acid is targeted to a nucleic acid encoding a STAT protein.
  • the invention also generally pertains to methods of treating a disease associated with overexpression of a STAT protein in a subject, involving administering to the subject a pharmaceutically effective amount of a composition comprising an inhibitory nucleic acid and a lipid component, wherein the inhibitory nucleic acid is targeted to a nucleic acid encoding a STAT.
  • norepinephrine While circulating plasma levels of norepinephrine are only about 10-1000 pM in a normal individual, and may reach as high as 100 nM in conditions of stress (Schmidt and Kraft, 1996), catecholamine levels in the ovary are at least 100 times higher. Studies suggest that within the parenchyma of the ovary, and thus the tumor microenvironment, concentrations may reach as high as 10 ⁇ M (Lara et al, 2001; Lara et al, 2002).
  • STAT Signal Transducers and Activator of Transcription
  • the mammalian STAT family members include STATl, STAT2, STAT3, STAT4, STAT5 a and b, and STAT6.
  • STAT3 is involved in numerous processes that relate to cancer progression (CaIo et al. , 2003). Constitutive STAT3 activation has been noted in numerous cancer types, such as hematologic, head and neck, brain, breast, lung, prostate, pancreas, and ovarian cancers (Bromberg, 2002; Garcia et al, 2001; Song and Grandis, 2000; Lin et al, 2000; Huang et al, 2000; Sartor et al, 1997; Garcia et al, 1997). STAT3 has transforming properties in and of itself, and is a participant in many other processes associated with oncogenesis (Bowman et al, 2000).
  • STAT3 has been shown to be a transcriptional regulator or MMP-2 in human melanoma cells (Xie et al, 2004; Kortylewski et al, 2005; Xie et al, 2006).
  • STAT3 is required for maximal induction of MMP-I by EGFR in bladder cancer cells (Itoh et al, 2006) and by fibroblast growth factor- 1 in prostate cancer cells (Udayakumar et al, 2004).
  • STAT3 activation is strongly correlated with MMP expression in breast cancer (Hsieh et al. , 2005), and the relationship is implicated in carcinogenesis (Dechow et al., 2004).
  • Liposomes have been used previously for drug delivery ⁇ e.g., delivery of a chemotherapeutic). Cationic liposomes are described in PCT publications WO02/100435A1, WO03/015757A1, WO04029213A2, and U.S. Patents 5,962,016, 5,030,453, and 6,680,068, and U.S. Patent Application 2004/0208921, all of which are hereby incorporated by reference in their entirety without disclaimer. A process of making liposomes is also described in WO04/002453A1. Neutral lipids have also been incorporated into cationic liposomes (see, e.g., Farhood et al, 1995).
  • Cationic liposomes have been used to deliver siRNA to various cell types (see, e.g., Sioud and Sorensen, 2003; U.S. Patent Application 2004/0204377; Duxbury et al, 2004; Donze and Picard, 2002).
  • Neutral liposomes have been tested to a limited degree. Neutral liposomes were used to deliver therapeutic antisense oligonucleotides in U.S. Patent Application 2003/0012812 and siRNA in WO 2006/113679.
  • the present invention is based on the finding of an association between the presence of neuroendocrine hormones associated with stress and elevation of STAT protein expression in disease, such as cancer.
  • the inventors have found that neuroendocrine hormones that are associated with stress have the potential to activate STAT3 and induce its nuclear translocation and DNA binding.
  • the invention is also based on the finding that the activation of STAT proteins in cancer can be ameliorated by downregulation using inhibitory nucleic acids.
  • compositions that includes: (1) an inhibitory nucleic acid ⁇ e.g., siNA), wherein the nucleic acid inhibits the expression of a gene encoding a STAT or encodes a nucleic acid that inhibits the expression of a gene encoding a STAT; and (2) a lipid component that includes one or more phospholipids, wherein the lipid component has an essentially neutral charge.
  • an inhibitory nucleic acid e.g., siNA
  • the inhibitory nucleic acid may inhibit the expression of any STAT protein.
  • the STAT protein may be STATl, STAT2, STAT3, STAT4, STAT5a, STAT5b, or STAT6.
  • the STAT is STAT3.
  • Inhibitory nucleic acids or "siNA”, as used herein, is defined as a short interfering nucleic acid.
  • An inhibitory nucleic acid includes a siRNA, a nucleic acid encoding a siRNA, or shRNA (short hairpin RNA), a ribozyme, or an antisense nucleic acid molecule that specifically hybridize to a nucleic acid molecule encoding a target protein or regulating the expression of the target protein.
  • “Specific hybridization” means that the siRNA, shRNA, ribozyme or antisense nucleic acid molecule hybridizes to the targeted nucleic acid molecule and regulates its expression.
  • specific hybridization also means that no other genes or transcripts are affected.
  • siNA examples include but are not limited to RNAi, double-stranded RNA, and siRNA.
  • a siNA can inhibit the transcription or translation of a gene in a cell.
  • a siNA may be from 16 to 1000 or more nucleotides long, and in certain embodiments from 18 to 100 nucleotides long.
  • the siNA may be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 200, 300, 500, or more nucleotides long.
  • the siNA may comprise a nucleic acid and/or a nucleic acid analog.
  • a siNA will inhibit the translation of a single gene within a cell; however, in certain embodiments, a siNA will inhibit the translation of more than one gene within a cell.
  • the double stranded nucleic acid can comprise 18 to 30, 19 to 25, 20 to 23, or 21 contiguous nucleobases or nucleobase pairs.
  • the siNA component comprises a single species of siRNA or more than one species of siRNA. In other embodiments, the siNA component comprises a 2, 3, 4 or more species of siRNA that target 1, 2, 3, 4, or more genes. In some embodiments, the siNA is encapsulated in the lipid component.
  • the siNA component may inhibit the expression of a STAT protein, or a truncated form on a STAT protein.
  • STAT3-beta is a truncated form of STAT3 that contains the dimerization and DNA binding domain but lacks the transactivation domain.
  • siRNA can be obtained from commercial sources, natural sources, or can be synthesized using any of a number of techniques well-known to those of ordinary skill in the art. For example, one commercial source of predesigned siRNA is Ambion®, Austin, TX. Another is Qiagen® (Valencia, CA).
  • An inhibitory nucleic acid that can be applied in the compositions and methods of the present invention may be any nucleic acid sequence that has been found by any source to be a validated downregulator of a STAT protein.
  • the inhibitory nucleic acid is Qiagen® (Valencia, CA) validated siRNA product Catalog Number SIO2662338.
  • the lipid component may be in the form of a liposome.
  • the siNA e.g., a siRNA
  • Encapsulate refers to the lipid or liposome forming an impediment to free difussion into solution by an association with or around an agent of interest, e.g., a liposome may encapsulate an agent within a lipid layer or within an aqeous compartement inside or between lipid layers.
  • the composition is comprised in a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier may be formulated for administration to a human subject or patient.
  • the lipid component has an essentially neutral charge because it comprises a neutral phospholipid or a net neutral charge.
  • a neutral phospholipid may be a phosphatidylcholine, such as DOPC, egg phosphatidylcholine (“EPC”), dilauryloylphosphatidylcholine (“DLPC”), dimyristoylphosphatidylcholine (“DMPC”), dipalmitoylphosphatidylcholine (“DPPC”), distearoylphosphatidylcholine (“DSPC”), l-myristoyl-2-palmitoyl phosphatidylcholine (“MPPC”), l-palmitoyl-2-myristoyl phosphatidylcholine (“PMPC”), l-palmitoyl-2-stearoyl phosphatidylcholine (“PSPC”), 1- stearoyl-2-palmitoyl phosphatidylcholine (“SPPC”),
  • SPPC 1- stearoy
  • the neutral phospholipid can be a phosphatidylethanolamine, such as dioleoylphosphatidylethanolamine (“DOPE”), distearoylphophatidylethanolamine (“DSPE”), dimyristoyl phosphatidylethanolamine (“DMPE”), dipalmitoyl phosphatidylethanolamine (“DPPE”), palmitoyloeoyl phosphatidylethanolamine (“POPE”), or lysophosphatidylethanolamine.
  • DOPE dioleoylphosphatidylethanolamine
  • DSPE distearoylphophatidylethanolamine
  • DMPE dimyristoyl phosphatidylethanolamine
  • DPPE dipalmitoyl phosphatidylethanolamine
  • POPE palmitoyloeoyl phosphatidylethanolamine
  • lysophosphatidylethanolamine lysophosphatidylethanolamine.
  • a lipid component can have an essentially neutral charge because it comprises a positively charged lipid and a negatively charged lipid.
  • the lipid component may further comprise a neutrally charged lipid(s) or phospholipid(s).
  • the positively charged lipid may be a positively charged phospholipid.
  • the negatively charged lipid may be a negatively charged phospholipid.
  • the negatively charged phospholipid may be a phosphatidylserine, such as dimyristoyl phosphatidylserine ("DMPS"), dipalmitoyl phosphatidylserine (“DPPS”), or brain phosphatidylserine ("BPS").
  • DMPS dimyristoyl phosphatidylserine
  • DPPS dipalmitoyl phosphatidylserine
  • BPS brain phosphatidylserine
  • the negatively charged phospholipid may be a phosphatidylglycerol, such as dilauryloylphosphatidylglycerol (“DLPG”), dimyristoylphosphatidylglycerol (“DMPG”), dipalmitoylphosphatidylglycerol (“DPPG”), distearoylphosphatidylglycerol (“DSPG”), or dioleoylphosphatidylglycerol (“DOPG”).
  • the composition further comprises cholesterol or polyethyleneglycol (PEG).
  • a phospholipid is a naturally-occurring phospholipid.
  • a phospholipid is a synthetic phospholipid.
  • composition may further comprise a chemotherapeutic or other anti-cancer agent, which may or may not be encasulated in a lipid component or liposome of the invention.
  • chemotherapeutic agent is a taxane or taxane derivative.
  • Such agents include docetaxel, paclitaxel, abraxane, 7-epipaclitaxel, t-acetyl paclitaxel, 10-desacetyl -paclitaxel, 10-desacetyl-7-epipaclitaxel, 7-xylosylpaclitaxel, lO-desacetyl-7-glutarylpaclitaxel, 7-N,N-dimethylglycylpaclitaxel, 7-L-alanylpaclitaxel, or a mixture thereof.
  • the chemotherapeutic agent is cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP 16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, gemcitabien, navelbine, farnesyl-protein tansferase inhibitors, transplatinum, 5-fluorouracil, vincristine, vinblastin, methotrexate, or combinations thereof.
  • CDDP cisplatin
  • carboplatin carboplatin
  • procarbazine mechlorethamine
  • cyclophosphamide camptothecin
  • the chemotherapeutic agent is docetaxel.
  • the present invention also generally pertains to methods of treating a subject with a hyperproliferative disease involving administering to the subject a pharmaceutically effective amount of a composition comprising an inhibitory nucleic acid, wherein the nucleic acid inhibits the expression of a gene encoding a STAT or encodes a nucleic acid that inhibits the expression of a gene encoding a STAT; and (2) a lipid component.
  • the composition for example, can be any of the compositions discussed above.
  • the inhibitory nucleic acid may inhibit the expression of any gene encoding a STAT protein.
  • the STAT may be STATl, STAT2, STAT3, STAT4, STAT5a, STAT5b, or STAT6. In particular embodiments, the STAT is STAT3.
  • the cancer can be any type of cancer, such as breast cancer, lung cancer, prostate cancer, ovarian cancer, brain cancer, liver cancer, cervical cancer, colon cancer, renal cancer, skin cancer, head and neck cancer, bone cancer, esophageal cancer, bladder cancer, uterine cancer, lymphatic cancer, stomach cancer, pancreatic cancer, testicular cancer, lymphoma, or leukemia.
  • the cancer is ovarian cancer and the STAT is STAT3.
  • the method further includes identifying a subject in need of treatment. Such identification can be by any method known to those of ordinary skill in the art, such as based on clinical examination, based on identification of a particular stage or grade of tumor, and so forth.
  • the composition is administered in the form of a vaccine.
  • the methods of the invention further comprise administering an additional anticancer therapy to the subject.
  • the additional therapy may comprise administering a chemotherapeutic, a surgery, a radiation therapy, an immunotherapy, and/or a gene therapy.
  • the chemotherapy is docetaxel, paclitaxel, cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP 16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, gemcitabien, navelbine, farnesyl-protein tansferase inhibitors, transplatinum, 5-fluorouracil, vincristin, vinblastin, methotrexate, or combinations thereof.
  • CDDP docetaxel
  • carboplatin carboplatin
  • procarbazine mechlorethamine
  • cyclophosphamide camptothecin
  • the chemotherapy is a taxane such as docetaxal or paclitaxel.
  • the chemotherapy can be delivered before, during, after, or combinations thereof relative to a neutral lipid composition of the invention.
  • a chemotherapy can be delivered within 0, 1, 5, 10, 12, 20, 24, 30, 48, or 72 hours or more of the neutral lipid composition.
  • the neutral lipid composition, the second anti-cancer therapy, or both the neutral lipid composition and the anti-cancer therapy can be administered intratumorally, intravenously, intraperitoneally, orally or by various combinations thereof.
  • the therapeutic agents and compositions set forth herein can be administered to the patient using any technique known to those of ordinary skill in the art. For example, administration may be intravenously, intraperitoneally, intratracheally, intratumorally, intramuscularly, endoscopically, intralesionally, percutaneously, subcutaneously, regionally, or by direct injection or perfusion.
  • the invention concerns a method of treating a subject with ovarian cancer comprising administering to the subject a pharmaceutically effective amount of an siRNA, wherein the siRNA is targeted to a gene that encodes STAT3.
  • the method further involves administering a chemotherapeutic agent to the subject.
  • the chemotherapeutic agent may be administered prior to the siRNA, concurrently with the siRNA, or following administration of the siRNA.
  • the chemotherapeutic agent can be any of those agents discussed above and elsewhere in this specification.
  • the subject has a tumor and the method of treating cancer is further defined as a method to reduce the invasiveness of a tumor in the subject.
  • the tumor is ovarian cancer.
  • the present invention also generally pertains to methods of reducing stress hormone-inducted activation of STAT3 in a subject, involving administering to the subject a pharmaceutically effective amount of any of the compositions set forth above.
  • the stress hormone-induced activation is norepinephrine- or epinephrine- induced activation of STAT3.
  • the subject has a hyperproliferative disease, such as cancer.
  • the cancer is ovarian cancer.
  • the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), "including” (and any form of including, such as “includes” and “include”), or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
  • FIG. IA, IB, 1C, and ID Effect of norepinephrine and epinephrine on phospho-STAT3.
  • the ovarian cancer cell lines SKO V3 and EG were serum starved for 15 hours before addition of increasing concentrations of NE or Epi (FIG. IA). Cell lysate was collected 3 hours later, and subjected to Western blot using anti- phosphorylated STAT3 antibody.
  • pSTAT3 increases significantly with as low as 0.1 ⁇ M of both hormones.
  • FIG. 2A shows constitutive presence of cytoplasmic STAT3 without NE stimulation compared to a negative control (no anti-STAT3 antibody, FIG. 2B). With 1 ⁇ M and 10 ⁇ M NE exposure (FIG. 2C), the nuclear signal increases dramatically, an effect inhibited by pretreatment with propanolol (FIG. 2D).
  • FIG. 3 Norepinephrine induces STAT3 DNA binding.
  • FIG. 4A and 4B Blockade of protein kinase A, but not IL-6, prevents NE- induced STAT3 activation.
  • Pretreatment of SKOV3 cells with 1 ⁇ M of the protein kinase A-specif ⁇ c inhibitor KT5720 reduces the increase in pSTAT3 seen with NE, as measured by Western blot (FIG. 4A).
  • pretreatment with 50 ⁇ g/ml anti-IL-6 antibody a dose previously shown to inhibit the activating effect of IL-6 on STAT3, was not effective in reducing the NE-induced effects (FIG. 4B).
  • FIG. 5A, 5B, 5C, 5D STAT3-mediated increases in cellular invasion and MMP expression with norepinephrine.
  • SKOV3 or EG cells were exposed to 10 ⁇ M NE alone and with STAT3 -specific siRNA or control siRNA, and introduced into the MICS system to determine effects on invasion (FIG. 5B).
  • the percent of cells invading through a human-defined matrix increased by 2.6-3.1 fold with NE, and was not affected by control siRNA, but was significantly reduced to baseline levels with STAT3-siRNA therapy in the SKOV3 and EG cell lines. Similar groups were examined for MMP production.
  • NE exposure resulted in a 4.8-fold increase in MMP-9 in SKOV3, and a 3.2-fold increase in EG (FIG. 5C).
  • NE lead to a 2.6 and 1.9-fold increase in MMP-2 in SKOV3 and EG, respectively (FIG. 5D).
  • Treatment with STAT3-siRNA prevented NE-induced MMP upregulation in both lines, whereas control siRNA had no effect.
  • FIG. 6 siRNA-directed STAT3 downregulation prevents stress-induced tumor growth.
  • Mice were injected subcutaneously with SKOV3 cells, and 24 hours later treated via intraperitoneal injection with PBS or the f3AR agonist isoproterenol (10 mg/kg). With or without isoproterenol, mice were treated with vehicle, a control nonsilencing siRNA in the delivery liposome DOPC, or STAT3-targeting siRNA in DOPC. After 7 days of treatment, tumor volumes were measures and volume calculated as described in methods. Tumor volume was reduced by 46% with administration of STAT3- specific siRNA in the liposomal delivery vector DOPC, where control siRNA in DOPC did not reduce tumor volume. Isoproterenol administration led to an 8.5-fold increase in tumor volume, which was not affected by treatment with a control siRNA in DOPC, but was almost completely abrogated by S TAT3- specific siRNA in DOPC.
  • STAT proteins are a family of proteins that regulate many aspects of cell growth, survival, and differentiation. They play a dual role in signal transduction and activation of transcription. There are six distinct family members and several isoforms. Cytokine binding induces activation of the intracellular Janus kinase that phosphorylates a specific tyrosine residue in the STAT protein which promotes the dimerization of STAT monomers via their SH 2 domain. The phosphorylated dimer is then actively transported in the nucleus via importin a/b and RanGDP complex.
  • the active STAT dimer binds to cytokine inducible promoter regions of genes containing gamma activated site (GAS) motif and activate transcription of these genes.
  • GAS gamma activated site
  • the STAT protein can be dephosphorylated by nuclear phosphatasess which leads to inactivation of STAT.
  • STAT3 also known as acute phase response factor (APRF)
  • APRF acute phase response factor
  • EGF epidermal growth factor
  • STAT3 has been found to have an important role in signal transduction by interferons.
  • ERK2 induces serine phosphorylation and also associates with STAT3 (Jain et al, 1998).
  • Activation and/or overexpression of STAT3 appears to be involved in cancer.
  • Non-limiting examples of such cancer include myeloma, breast carcinomas, prostate cancer, brain tumors, head and neck carcinomas, melanoma, leukemias, and lymphomas.
  • STAT3 may also play a role in inflammatory diseases, such as rheumatoid arthritis.
  • Activated STAT3 has been found in the synovial fluid of rheumatoid arthritis patients and cells from inflamed joints (Sengupta et al, 1995; Wang et al, 1995).
  • Table 1 lists STATS, and includes GenBank Accession numbers of mRNA sequences from homo sapiens. STATl, STAT2, STAT3, STAT4, STAT5 a and b, and STAT6.
  • NM 003150 transcript SEQ ID NO:5 variant 2
  • RNAi Long double stranded RNA
  • Dicer which is an RNAaseIII family ribonuclease. This process yields siRNAs of -21 nucleotides in length.
  • siRNAs are incorporated into a multiprotein RNA-induced silencing complex (RISC) that is guided to target mRNA. RISC cleaves the target mRNA in the middle of the complementary region.
  • RISC RNA-induced silencing complex
  • miRNAs the related microRNAs (miRNAs) are found that are short RNA fragments (-22 nucleotides).
  • MiRNAs are generated after Dicer-mediated cleavage of longer (-70 nucleotide) precursors with imperfect hairpin RNA structures.
  • the miRNA is incorporated into a miRNA-protein complex (miRNP), which leads to translational repression of target mRNA.
  • miRNP miRNA-protein complex
  • Liposomes are a form of nanoparticles that are attractive carriers for delivering a variety of drugs into the diseased tissue.
  • Optimal liposome size depends on the tumor target. In tumor tissue, the vasculature is discontinuous, and pore sizes vary from 100 to 780 run (Siwak et al. , 2002). By comparison, pore size in normal vascular endothelium is ⁇ 2 nm in most tissues, and 6 nm in post-capillary venules. Most liposomes are 65-125 nm in diameter.
  • Negatively charged liposomes were believed to be more rapidly removed from circulation than neutral or positively charged liposomes; however, recent studies have indicated that the type of negatively charged lipid affects the rate of liposome uptake by the reticuloendothelial system (RES). For example, liposomes containing negatively charged lipids that are not sterically shielded (phosphatidylserine, phosphatidic acid, and phosphatidylglycerol) are cleared more rapidly than neutral liposomes.
  • RES reticuloendothelial system
  • cationic liposomes (1,2-dioleoyl- 3-trimethylammonium-propane [DOTAP]) and cationic-liposome-DNA complexes are more avidly bound and internalized by endothelial cells of angiogenic blood vessels via endocytosis than anionic, neutral, or sterically stabilized neutral liposomes (Thurston et al, 1998; Krasnici et al, 2003).
  • Cationic liposomes may not be ideal delivery vehicles for tumor cells because surface interactions with the tumor cells create an electrostatically derived binding-site barrier effect, inhibiting further association of the delivery systems with tumor spheroids (Kostarelos et al, 2004).
  • siRNA appears to be more stable than antisense molecules, serum nucleases can degrade siRNAs (Leung and Whittaker, 2005).
  • modifications such as chemically stabilized siRNAs with partial phosphorothioate backbone and 2'-0-methyl sugar modifications or boranophosphate siRNAs (Leung and Whittaker, 2005).
  • Elmen and colleagues modified siRNAs with the synthetic RNA-like high affinity nucleotide analogue, Locked Nucleic Acid (LNA), which significantly enhanced the serum half-life of siRNA and stabilized the structure without affecting the gene-silencing capability (Elmen et al, 2005).
  • LNA Locked Nucleic Acid
  • the present invention provides methods and compositions for associating an inhibitory nucleic acid that inhibits the expression of a STAT protein, such as a siNA (e.g., a siRNA) with a lipid and/or liposome.
  • a STAT protein such as a siNA (e.g., a siRNA)
  • siNA e.g., a siRNA
  • the siNA may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the polynucleotide, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid.
  • the liposome or liposome/siNA associated compositions of the present invention are not limited to any particular structure in solution. For example, they may be present in a bilayer structure, as micelles, or with a "collapsed" structure. They may also simply be interspersed in a solution, possibly forming aggregates which are not uniform in either size or shape.
  • Lipids are fatty substances which may be naturally occurring or synthetic lipids.
  • lipids include the fatty droplets that naturally occur in the cytoplasm as well as the class of compounds which are well known to those of skill in the art which contain long- chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.
  • DOPC lipid dioleoylphosphatidylcholine
  • Liposome is a generic term encompassing a variety of unilamellar, multilamellar, and multivesicular lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates.
  • Liposomes may be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium.
  • Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991).
  • the present invention also encompasses compositions that have different structures in solution than the normal vesicular structure.
  • the lipids may assume a micellar structure or merely exist as non-uniform aggregates of lipid molecules.
  • lipofectamine-nucleic acid complexes are also contemplated.
  • Liposome-mediated polynucleotide delivery and expression of foreign DNA in vitro has been very successful.
  • Wong et al (1980) demonstrated the feasibility of liposome- mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells.
  • Nicolau et al (1987) accomplished successful liposome-mediated gene transfer in rats after intravenous injection.
  • the lipid may be associated with a hemaglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989).
  • HVJ hemaglutinating virus
  • the lipid may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-I) (Kato et al, 1991).
  • HMG-I nuclear non-histone chromosomal proteins
  • the lipid may be complexed or employed in conjunction with both HVJ and HMG-I. In that such expression vectors have been successfully employed in transfer of a polynucleotide in vitro and in vivo, then they are applicable for the present invention.
  • Neutral liposomes or lipid composition or “non-charged liposomes or lipid composition,” as used herein, are defined as liposomes or lipid compositions having one or more lipids that yield an essentially-neutral, net charge (substantially non-charged).
  • essentially neutral or “essentially non-charged” it is meant that few, if any, lipids within a given population ⁇ e.g., a population of liposomes) include a charge that is not canceled by an opposite charge of another component ⁇ e.g., fewer than 10% of components include a non- canceled charge, more preferably fewer than 5%, and most preferably fewer than 1%).
  • a composition may be prepared wherein the lipid component of the composition is essentially neutral but is not in the form of liposomes.
  • neutral liposomes or lipid compositions may include mostly lipids and/or phospholipids that are themselves neutral.
  • amphipathic lipids may be incorporated into or used to generate neutral liposomes or lipid compositions.
  • a neutral liposome may be generated by combining positively and negatively charged lipids so that those charges substantially cancel one another.
  • few, if any, charged lipids are present whose charge is not canceled by an oppositely-charged lipid ⁇ e.g., fewer than 10% of charged lipids have a charge that is not canceled, more preferably fewer than 5%, and most preferably fewer than 1%).
  • the above approach may be used to generate a neutral lipid composition wherein the lipid component of the composition is not in the form of liposomes.
  • a neutral liposome may be used to deliver a siRNA.
  • the neutral liposome may contain a siRNA directed to the suppression of translation of a single gene, or the neutral liposome may contain multiple siRNA that are directed to the suppression of translation of multiple genes.
  • the neutral liposome may also contain a chemotherapeutic in addition to the siRNA; thus, in certain embodiments, chemotherapeutic and a siRNA may be delivered to a cell (e.g., a cancerous cell in a human subject) in the same or separate compositions.
  • Lipid compositions of the present invention may comprise phospholipids.
  • a single kind or type of phospholipid may be used in the creation of lipid compositions such as liposomes (e.g., DOPC used to generate neutral liposomes).
  • more than one kind or type of phospholipid may be used.
  • Phospholipids include glycerophospholipids and certain sphingolipids.
  • Phospholipids include, but are not limited to, dioleoylphosphatidylycholine ("DOPC"), egg phosphatidylcholine (“EPC”), dilauryloylphosphatidylcholine (“DLPC”), dimyristoylphosphatidylcholine (“DMPC”), dipalmitoylphosphatidylcholine (“DPPC”), distearoylphosphatidylcholine (“DSPC”), l-myristoyl-2-palmitoyl phosphatidylcholine (“MPPC”), l-palmitoyl-2-myristoyl phosphatidylcholine (“PMPC”), l-palmitoyl-2-stearoyl phosphatidylcholine (“PSPC”), 1 -stearoyl-2-palmitoyl phosphatidylcholine (“SPPC”), dil
  • Phospholipids include, for example, phosphatidylcholines, phosphatidylglycerols, and phosphatidylethanolamines; because phosphatidylethanolamines and phosphatidyl cholines are non-charged under physiological conditions (i.e., at about pH 7), these compounds may be particularly useful for generating neutral liposomes.
  • the phospholipid DOPC is used to produce non-charged liposomes or lipid compositions.
  • a lipid that is not a phospholipid e.g., a cholesterol
  • Phospholipids may be from natural or synthetic sources. However, phospholipids from natural sources, such as egg or soybean phosphatidylcholine, brain phosphatidic acid, brain or plant phosphatidylinositol, heart cardiolipin and plant or bacterial phosphatidylethanolamine are not used in certain embodiments as the primary phosphatide (i.e., constituting 50% or more of the total phosphatide composition) because this may result in instability and leakiness of the resulting liposomes.
  • natural sources such as egg or soybean phosphatidylcholine, brain phosphatidic acid, brain or plant phosphatidylinositol, heart cardiolipin and plant or bacterial phosphatidylethanolamine are not used in certain embodiments as the primary phosphatide (i.e., constituting 50% or more of the total phosphatide composition) because this may result in instability and leakiness of the resulting liposomes.
  • Liposomes and lipid compositions of the present invention can be made by different methods.
  • a nucleotide e.g., siRNA
  • a nucleotide may be encapsulated in a neutral liposome using a method involving ethanol and calcium (Bailey and Sullivan, 2000).
  • the size of the liposomes varies depending on the method of synthesis.
  • a liposome suspended in an aqueous solution is generally in the shape of a spherical vesicle, and may have one or more concentric layers of lipid bilayer molecules. Each layer consists of a parallel array of molecules represented by the formula XY, wherein X is a hydrophilic moiety and Y is a hydrophobic moiety.
  • the concentric layers are arranged such that the hydrophilic moieties tend to remain in contact with an aqueous phase and the hydrophobic regions tend to self-associate.
  • the lipid molecules may form a bilayer, known as a lamella, of the arrangement XY-YX. Aggregates of lipids may form when the hydrophilic and hydrophobic parts of more than one lipid molecule become associated with each other. The size and shape of these aggregates will depend upon many different variables, such as the nature of the solvent and the presence of other compounds in the solution.
  • Lipids suitable for use according to the present invention can be obtained from commercial sources.
  • DMPC dimyristyl phosphatidylcholine
  • DCP dicetyl phosphate
  • DMPG dimyristyl phosphatidylglycerol
  • liposomes within the scope of the present invention can be prepared in accordance with known laboratory techniques.
  • liposomes are prepared by mixing liposomal lipids, in a solvent in a container (e.g., a glass, pear-shaped flask).
  • a container e.g., a glass, pear-shaped flask.
  • the container will typically have a volume ten-times greater than the volume of the expected suspension of liposomes.
  • the solvent may be removed at approximately 4O 0 C under negative pressure.
  • the solvent may be removed within about 5 minutes to 2 hours, depending on the desired volume of the liposomes.
  • the composition can be dried further in a desiccator under vacuum.
  • Dried lipids can be hydrated at approximately 25-50 mM phospholipid in sterile, pyrogen-free water by shaking until all the lipid film is resuspended.
  • the aqueous liposomes can be then separated into aliquots, each placed in a vial, lyophilized and sealed under vacuum.
  • Liposomes can also be prepared in accordance with other known laboratory procedures: the method of Bangham et al. (1965), the contents of which are incorporated herein by reference; the method of Gregoriadis, as described in DRUG CARRIERS IN BIOLOGY AND MEDICINE (1979), the contents of which are incorporated herein by reference; the method of Deamer and Uster (1983), the contents of which are incorporated by reference; and the reverse-phase evaporation method as described by Szoka and Papahadjopoulos (1978).
  • the aforementioned methods differ in their respective abilities to entrap aqueous material and their respective aqueous space-to-lipid ratios.
  • Dried lipids or lyophilized liposomes may be dehydrated and reconstituted in a solution of inhibitory peptide and diluted to an appropriate concentration with a suitable solvent (e.g., DPBS). The mixture may then be vigorously shaken in a vortex mixer. Unencapsulated nucleic acid may be removed by centrifugation at 29,00Og and the liposomal pellets washed. The washed liposomes may be resuspended at an appropriate total phospholipid concentration (e.g., about 50-200 mM). The amount of nucleic acid encapsulated can be determined in accordance with standard methods. After determination of the amount of nucleic acid encapsulated in the liposome preparation, the liposomes may be diluted to appropriate concentrations and stored at 4°C until use.
  • a suitable solvent e.g., DPBS
  • siNA e.g., siRNA
  • siRNA and double- stranded RNA have been described in U.S. Patents 6,506,559 and 6,573,099, as well as in U.S. Patent Applications 2003/0051263, 2003/0055020, 2004/0265839, 2002/0168707, 2003/0159161, and 2004/0064842, all of which are herein incorporated by reference in their entirety.
  • a siNA may comprise a nucleotide and a nucleic acid or nucleotide analog.
  • siNA form a double-stranded structure; the double-stranded structure may result from two separate nucleic acids that are partially or completely complementary.
  • the siNA may comprise only a single nucleic acid (polynucleotide) or nucleic acid analog and form a double-stranded structure by complementing with itself (e.g., forming a hairpin loop).
  • the double-stranded structure of the siNA may comprise 16, 20, 25, 30, 35, 40, 45, 50, 60, 65, 70, 75, 80, 85, 90 to 100, 150, 200, 250, 300, 350, 400, 450, 500 or more contiguous nucleobases, including all ranges therebetween.
  • the siNA may comprise 17 to 35 contiguous nucleobases, more preferably 18 to 30 contiguous nucleobases, more preferably 19 to 25 nucleobases, more preferably 20 to 23 contiguous nucleobases, or 20 to 22 contiguous nucleobases, or 21 contiguous nucleobases that hybridize with a complementary nucleic acid (which may be another part of the same nucleic acid or a separate complementary nucleic acid) to form a double-stranded structure.
  • a complementary nucleic acid which may be another part of the same nucleic acid or a separate complementary nucleic acid
  • Agents of the present invention useful for practicing the methods of the present invention include, but are not limited to siRNAs.
  • dsRNA double-stranded RNA
  • siRNA small interfering RNA
  • RNAi RNA interference
  • RNA interference has been referred to as “cosuppression,” “post-transcriptional gene silencing,” “sense suppression,” and “quelling.”
  • RNAi is an attractive biotechnological tool because it provides a means for knocking out the activity of specific genes.
  • RNAi there are several factors that need to be considered such as the nature of the siRNA, the durability of the silencing effect, and the choice of delivery system.
  • the siRNA that is introduced into the organism will typically contain exonic sequences.
  • the RNAi process is homology dependent, so the sequences must be carefully selected so as to maximize gene specificity, while minimizing the possibility of cross-interference between homologous, but not gene-specific sequences.
  • the siRNA exhibits greater than 80, 85, 90, 95, 98,% or even 100% identity between the sequence of the siRNA and the gene to be inhibited. Sequences less than about 80% identical to the target gene are substantially less effective.
  • the greater homology between the siRNA and the STAT gene to be inhibited the less likely expression of unrelated genes will be affected.
  • the size of the siRNA is an important consideration.
  • the present invention relates to siRNA molecules that include at least about 19-25 nucleotides, and are able to modulate the STAT gene expression.
  • the siRNA is preferably less than 500, 200, 100, 50 or 25 nucleotides in length. More preferably, the siRNA is from about 19 nucleotides to about 25 nucleotides in length.
  • siRNA can be obtained from commercial sources, natural sources, or can be synthesized using any of a number of techniques well-known to those of ordinary skill in the art.
  • one commercial source of predesigned siRNA is Ambion®, Austin, TX.
  • An inhibitory nucleic acid that can be applied in the compositions and methods of the present invention may be any nucleic acid sequence that has been found by any source to be a validated downregulator of a STAT protein.
  • the inhibitory nucleic acid is Qiagen® (Valencia, CA) validated siRNA product Catalog Number SIO2662338.
  • the invention generally features an isolated siRNA molecule of at least 19 nucleotides, having at least one strand that is substantially complementary to at least ten but no more than thirty consecutive nucleotides of a nucleic acid that encodes a STAT protein, and that reduces the expression of the STAT protein.
  • the siRNA molecule has at least one strand that is substantially complementary to at least ten but no more than thirty consecutive nucleotides of the mRNA that encodes STAT3.
  • the siRNA molecule is at least 75, 80, 85, or 90% homologous, preferably 95%, 99%, or 100% homologous, to at least 10 contiguous nucleotides of any of the nucleic acid sequences encoding a full-length STAT protein, such as those in Table 1.
  • the siRNA may also comprise an alteration of one or more nucleotides.
  • Such alterations can include the addition of non-nucleotide material, such as to the end(s) of the 19 to 25 nucleotide RNA or internally (at one or more nucleotides of the RNA).
  • the RNA molecule contains a 3'-hydroxyl group.
  • Nucleotides in the RNA molecules of the present invention can also comprise non-standard nucleotides, including non-naturally occurring nucleotides or deoxyribonucleotides.
  • the double-stranded oligonucleotide may contain a modified backbone, for example, phosphorothioate, phosphorodithioate, or other modified backbones known in the art, or may contain non-natural internucleoside linkages.
  • Additional modifications of siRNAs e.g., 2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, "universal base" nucleotides, 5-C-methyl nucleotides, one or more phosphorothioate internucleotide linkages, and inverted deoxyabasic residue incorporation
  • U.S. Application Publication 20040019001 and U.S. Patent 6,673,611 each of which is incorporated by referencein its entirety.
  • RNAi is capable of decreasing the expression of a STAT protein, such as STAT3, by at least 10%, 20%, 30%, or 40%, more preferably by at least 50%, 60%, or 70%, and most preferably by at least 75%, 80%, 90%, 95% or more.
  • Certain embodiments of the present invention pertain to methods of inhibiting expression of a gene encoding a STAT protein in a cell.
  • the STAT protein is STAT3.
  • Introduction of siRNA into cells can be achieved by methods known in the art, including for example, microinjection, electroporation, or transfection of a vector comprising a nucleic acid from which the siRNA can be transcribed.
  • a siRNA can be directly introduced into a cell in a form that is capable of binding to target mRNA transcripts.
  • the siRNA may be combined or modified with liposomes, poly-L-lysine, lipids, cholesterol, lipofectine or derivatives thereof.
  • cholesterol-conjugated siRNA can be used (see, Song et al, 2003).
  • the present invention provides methods and compositions for the delivery of siNA via neutral liposomes. Because a siNA is composed of a nucleic acid, methods relating to nucleic acids (e.g., production of a nucleic acid, modification of a nucleic acid, etc.) may also be used with regard to a siNA.
  • nucleic acid is well known in the art.
  • a “nucleic acid” as used herein will generally refer to a molecule (i.e., a strand) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase.
  • a nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine "A,” a guanine "G,” a thymine “T” or a cytosine "C”) or RNA (e.g., an A, a G, an uracil "U” or a C).
  • nucleic acid encompass the terms “oligonucleotide” and “polynucleotide,” each as a subgenus of the term “nucleic acid.”
  • oligonucleotide refers to a molecule of between 3 and about 100 nucleobases in length.
  • polynucleotide refers to at least one molecule of greater than about 100 nucleobases in length.
  • a nucleic acid may encompass a double-stranded molecule that comprises one or more complementary strand(s) or "complement(s)" of a particular sequence, typically comprising a molecule.
  • a single stranded nucleic acid may be denoted by the prefix "ss” and a double stranded nucleic acid by the prefix "ds”.
  • antisense oligonucleotides targeted to nucleic acids encoding STAT3 can be found in U.S. Patent Application Pub. No. 20010029250, herein specifically incorporated by reference. Particular examples include SEQ ID NOs: 11 -90. 1. Nucleobases
  • nucleobase refers to a heterocyclic base, such as for example a naturally occurring nucleobase (i.e., an A, T, G, C or U) found in at least one naturally occurring nucleic acid (i.e., DNA and RNA), and naturally or non-naturally occurring derivative(s) and analogs of such a nucleobase.
  • a nucleobase generally can form one or more hydrogen bonds (“anneal” or “hybridize”) with at least one naturally occurring nucleobase in manner that may substitute for naturally occurring nucleobase pairing (e.g., the hydrogen bonding between A and T, G and C, and A and U).
  • Purine and/or "pyrimidine” nucleobase(s) encompass naturally occurring purine and/or pyrimidine nucleobases and also derivative(s) and analog(s) thereof, including but not limited to, those a purine or pyrimidine substituted by one or more of an alkyl, caboxyalkyl, amino, hydroxyl, halogen (i.e., fluoro, chloro, bromo, or iodo), thiol or alkylthiol moeity.
  • halogen i.e., fluoro, chloro, bromo, or iodo
  • Preferred alkyl (e.g., alkyl, caboxyalkyl, etc.) moeities comprise of from about 1, about 2, about 3, about 4, about 5, to about 6 carbon atoms.
  • a nucleobase may be comprised in a nucleside or nucleotide, using any chemical or natural synthesis method described herein or known to one of ordinary skill in the art.
  • nucleoside refers to an individual chemical unit comprising a nucleobase covalently attached to a nucleobase linker moiety.
  • nucleobase linker moiety is a sugar comprising 5-carbon atoms (i.e., a "5-carbon sugar"), including but not limited to a deoxyribose, a ribose, an arabinose, or a derivative or an analog of a 5-carbon sugar.
  • Non-limiting examples of a derivative or an analog of a 5-carbon sugar include a 2'-fluoro-2'-deoxyribose or a carbocyclic sugar where a carbon is substituted for an oxygen atom in the sugar ring.
  • a nucleoside comprising a purine (i.e., A or G) or a 7-deazapurine nucleobase typically covalently attaches the 9 position of a purine or a 7-deazapurine to the 1 '-position of a 5-carbon sugar.
  • a nucleoside comprising a pyrimidine nucleobase typically covalently attaches a 1 position of a pyrimidine to a l'-position of a 5-carbon sugar (Kornberg and Baker, 1992).
  • nucleotide refers to a nucleoside further comprising a "backbone moiety".
  • a backbone moiety generally covalently attaches a nucleotide to another molecule comprising a nucleotide, or to another nucleotide to form a nucleic acid.
  • the "backbone moiety” in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5 -carbon sugar. The attachment of the backbone moiety typically occurs at either the 3'- or 5'-position of the 5-carbon sugar.
  • other types of attachments are known in the art, particularly when a nucleotide comprises derivatives or analogs of a naturally occurring 5-carbon sugar or phosphorus moiety. 4. Nucleic Acid Analogs
  • a nucleic acid may comprise, or be composed entirely of, a derivative or analog of a nucleobase, a nucleobase linker moiety and/or backbone moiety that may be present in a naturally occurring nucleic acid.
  • a "derivative” refers to a chemically modified or altered form of a naturally occurring molecule
  • the terms “mimic” or “analog” refer to a molecule that may or may not structurally resemble a naturally occurring molecule or moiety, but possesses similar functions.
  • a “moiety” generally refers to a smaller chemical or molecular component of a larger chemical or molecular structure. Nucleobase, nucleoside and nucleotide analogs or derivatives are well known in the art, and have been described (see for example, Scheit, 1980, incorporated herein by reference).
  • nucleosides, nucleotides, or nucleic acids comprising 5-carbon sugar and/or backbone moiety derivatives or analogs include those in U.S. Patent 5,681,947 which describes oligonucleotides comprising purine derivatives that form triple helixes with and/or prevent expression of dsDNA; U.S. Patents 5,652,099 and 5,763,167 which describe nucleic acids incorporating fluorescent analogs of nucleosides found in DNA or RNA, particularly for use as flourescent nucleic acids probes; U.S. Patent 5,614,617 which describes oligonucleotide analogs with substitutions on pyrimidine rings that possess enhanced nuclease stability; U.S.
  • Patents 5,670,663, 5,872,232 and 5,859,221 which describe oligonucleotide analogs with modified 5-carbon sugars (i.e., modified T- deoxyfuranosyl moieties) used in nucleic acid detection;
  • U.S. Patent 5,446,137 which describes oligonucleotides comprising at least one 5-carbon sugar moiety substituted at the 4' position with a substituent other than hydrogen that can be used in hybridization assays;
  • U.S. Patent 5,886,165 which describes oligonucleotides with both deoxyribonucleotides with 3'-5' intemucleotide linkages and ribonucleotides with 2'-5' internucleotide linkages;
  • Patent 5,714,606 which describes a modified internucleotide linkage wherein a 3 '-position oxygen of the internucleotide linkage is replaced by a carbon to enhance the nuclease resistance of nucleic acids;
  • U.S. Patent 5,672,697 which describes oligonucleotides containing one or more 5' methylene phosphonate internucleotide linkages that enhance nuclease resistance;
  • U.S. Patents 5,466,786 and 5,792,847 which describe the linkage of a substituent moeity which may comprise a drug or label to the 2' carbon of an oligonucleotide to provide enhanced nuclease stability and ability to deliver drugs or detection moieties;
  • Patent 5,223,618 which describes oligonucleotide analogs with a 2 or 3 carbon backbone linkage attaching the 4' position and 3' position of adjacent 5-carbon sugar moiety to enhanced cellular uptake, resistance to nucleases and hybridization to target RNA;
  • Patent 5,470,967 which describes oligonucleotides comprising at least one sulfamate or sulfamide internucleotide linkage that are useful as nucleic acid hybridization probe;
  • Patents 5,378,825, 5,777,092, 5,623,070, 5,610,289 and 5,602,240 which describe oligonucleotides with three or four atom linker moeity replacing phosphodiester backbone moeity used for improved nuclease resistance, cellular uptake and regulating RNA expression
  • U.S. Patent 5,858,988 which describes hydrophobic carrier agent attached to the 2'-0 position of oligonuceotides to enhanced their membrane permeability and stability
  • U.S. Patent 5,214,136 which describes olignucleotides conjugated to anthraquinone at the 5' terminus that possess enhanced hybridization to DNA or RNA; enhanced stability to nucleases;
  • Patent 5,700,922 which describes PNA-DNA-PNA chimeras wherein the DNA comprises 2'-deoxy-erythro- pentofuranosyl nucleotides for enhanced nuclease resistance, binding affinity, and ability to activate RNase H; and U.S. Patent 5,708,154 which describes RNA linked to a DNA to form a DNA-RNA hybrid.
  • a nucleic acid comprising a derivative or analog of a nucleoside or nucleotide may be used in the methods and compositions of the invention.
  • a non-limiting example is a "polyether nucleic acid", described in U.S. Patent 5,908,845, incorporated herein by reference.
  • polyether nucleic acid one or more nucleobases are linked to chiral carbon atoms in a polyether backbone.
  • peptide nucleic acid also known as a "PNA”, “peptide-based nucleic acid analog” or "PENAM”, described in U.S. Patent 5,786,461, 5891,625, 5,773,571, 5,766,855, 5,736,336, 5,719,262, 5,714,331, 5,539,082, and WO 92/20702, each of which is incorporated herein by reference.
  • Peptide nucleic acids generally have enhanced sequence specificity, binding properties, and resistance to enzymatic degradation in comparison to molecules such as DNA and RNA (Egholm et al, 1993; PCT/EP/01219).
  • a peptide nucleic acid generally comprises one or more nucleotides or nucleosides that comprise a nucleobase moiety, a nucleobase linker moeity that is not a 5- carbon sugar, and/or a backbone moiety that is not a phosphate backbone moiety.
  • nucleobase linker moieties described for PNAs include aza nitrogen atoms, amido and/or ureido tethers (see for example, U.S. Patent 5,539,082).
  • backbone moieties described for PNAs include an aminoethylglycine, polyamide, polyethyl, polythioamide, polysulf ⁇ namide or polysulfonamide backbone moiety.
  • a nucleic acid analogue such as a peptide nucleic acid may be used to inhibit nucleic acid amplification, such as in PCRTM, to reduce false positives and discriminate between single base mutants, as described in U.S. Patent 5,891,625.
  • nucleic acid amplification such as in PCRTM
  • Other modifications and uses of nucleic acid analogs are known in the art, and it is anticipated that these techniques and types of nucleic acid analogs may be used with the present invention.
  • U.S. Patent 5,786,461 describes PNAs with amino acid side chains attached to the PNA backbone to enhance solubility of the molecule.
  • the cellular uptake property of PNAs is increased by attachment of a lipophilic group.
  • a nucleic acid may be made by any technique known to one of ordinary skill in the art, such as chemical synthesis, enzymatic production or biological production.
  • a synthetic nucleic acid ⁇ e.g., a synthetic oligonucleotide
  • Non-limiting examples of a synthetic nucleic acid include a nucleic acid made by in vitro chemically synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al, 1986 and U.S. Patent 5,705,629, each incorporated herein by reference.
  • one or more oligonucleotide may be used.
  • Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Patents 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.
  • a non-limiting example of an enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCRTM (see for example, U.S. Patent
  • a non-limiting example of a biologically produced nucleic acid includes a recombinant nucleic acid produced (i.e., replicated) in a living cell, such as a recombinant DNA vector replicated in bacteria (see for example, Sambrook et al. 2001, incorporated herein by reference).
  • a nucleic acid may be purified on polyacrylamide gels, cesium chloride centrifugation gradients, or by any other means known to one of ordinary skill in the art (see for example, Sambrook et al, 2001, incorporated herein by reference).
  • the present invention concerns a nucleic acid that is an isolated nucleic acid.
  • isolated nucleic acid refers to a nucleic acid molecule (e.g., an RNA or DNA molecule) that has been isolated free of, or is otherwise free of, the bulk of the total genomic and transcribed nucleic acids of one or more cells.
  • isolated nucleic acid refers to a nucleic acid that has been isolated free of, or is otherwise free of, bulk of cellular components or in vitro reaction components such as for example, macromolecules such as lipids or proteins, small biological molecules, and the like.
  • hybridization As used herein, “hybridization”, “hybridizes” or “capable of hybridizing” is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature.
  • hybridize as used herein is synonymous with “hybridize.”
  • hybridization encompasses the terms “stringent condition(s)” or “high stringency” and the terms “low stringency” or “low stringency condition(s).”
  • stringent condition(s) or “high stringency” are those conditions that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but precludes hybridization of random sequences. Stringent conditions tolerate little, if any, mismatch between a nucleic acid and a target strand.
  • Non-limiting applications include isolating a nucleic acid, such as a gene or a nucleic acid segment thereof, or detecting at least one specific mRNA transcript or a nucleic acid segment thereof, and the like.
  • Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50 0 C to about 70°C. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content of the target sequence(s), the charge composition of the nucleic acid(s), and to the presence or concentration of formamide, tetramethylammonium chloride or other solvent(s) in a hybridization mixture.
  • low stringency or “low stringency conditions”
  • non-limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCl at a temperature range of about 20 0 C to about 50 0 C.
  • hybridization performed at about 0.15 M to about 0.9 M NaCl at a temperature range of about 20 0 C to about 50 0 C.
  • Treatment refers to administration or application of a therapeutic agent to a subject or performance of a procedure or modality on a subject for the purpose of obtaining a therapeutic benefit of a disease or health-related condition.
  • a treatment may include administration of a pharmaceutically effective amount of a nucleic acid that inhibits the expression of a gene that encodes a STAT and a neutral lipid for the purposes of minimizing the growth or invasion of a tumor.
  • a "subject” refers to either a human or non-human, such as primates, mammals, and vertebrates. In particular embodiments, the subject is a human.
  • the term "therapeutic benefit” or “therapeutically effective” as used throughout this application refers to anything that promotes or enhances the well-being of the subject with respect to the medical treatment of this condition. This includes, but is not limited to, a reduction in the frequency or severity of the signs or symptoms of a disease.
  • treatment of cancer may involve, for example, a reduction in the size of a tumor, a reduction in the invasiveness of a tumor, reduction in the growth rate of the cancer, or prevention of metastasis.
  • a "disease” or "health-related condition” can be any pathological condition of a body part, an organ, or a system resulting from any cause, such as infection, genetic defect, and/or environmental stress. The cause may or may not be known.
  • the methods include identifying a patient in need of treatment.
  • a patient may be identified, for example, based on taking a patient history, based on findings on clinical examination, based on health screenings, or by self- referral.
  • the present invention may be used to treat any disease associated with increased expression of a STAT protein.
  • the disease may be a hyperproliferative disease, such as cancer.
  • a siRNA that binds to a nucleic acid that encodes a STAT3 protein may be administered to treat a cancer.
  • the cancer may be a solid tumor, metastatic cancer, or non-metastatic cancer.
  • the cancer may originate in the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus.
  • the cancer is human ovarian cancer.
  • the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acid
  • the cancer is ovarian cancer.
  • the ovarian cancer may be an epithelial tumor (e.g., serous, endometrioid, mucinous, and clear cell tumors), a germ cell tumor, a sex cord-stormal cell tumor, a Brenner tumor, an undifferentiated tumor, or a transitional cell tumor.
  • the term "ovarian cancer” also includes tumors that are adjacent to ovarian tissue, such as extraovarian peritoneal carcinoma (intraperitoneal carcinomatosis).
  • the ovarian tumor may be benign, malignant, or pre- malignant.
  • the disease may also be an inflammatory disease. Non-limiting examples of inflammatory diseases include infectious diseases, arthritis, and collagen-vascular diseases. In a specific embodiment, the disease is rheumatoid arthritis.
  • lipid complex As a pharmaceutical composition appropriate for the intended application, it will generally be beneficial to prepare the lipid complex as a pharmaceutical composition appropriate for the intended application. This will typically entail preparing a pharmaceutical composition that is essentially free of pyrogens, as well as any other impurities that could be harmful to humans or animals. One may also employ appropriate buffers to render the complex stable and allow for uptake by target cells.
  • pharmaceutical or pharmacologically acceptable refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as a human, as appropriate.
  • compositions that contains at least one non-charged lipid component comprising a siNA or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington: The Science and Practice of Pharmacy, 21st, 2005, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art.
  • preservatives e.g., antibacterial agents, antifungal agents
  • isotonic agents e.g., absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art.
  • a pharmaceutically acceptable carrier is preferably formulated for administration to a human, although in certain embodiments it may be desirable to use a pharmaceutically acceptable carrier that is formulated for administration to a non-human animal but which would not be acceptable (e.g., due to governmental regulations) for administration to a human. Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.
  • compositions of the present invention administered to a patient or subject can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration.
  • the practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
  • pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound.
  • the an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein.
  • a dose may also comprise from about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein.
  • a range of about 5 ⁇ g/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered.
  • a gene expression inhibitor may be administered in a dose of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 or more ⁇ g of nucleic acid per dose.
  • Each dose may be in a volume of 1, 10, 50, 100, 200, 500, 1000 or more ⁇ l or ml.
  • Solutions of therapeutic compositions can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
  • Dispersions also can be prepared in glycerol, liquid polyethylene glycols, mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • compositions of the present invention are advantageously administered in the form of injectable compositions either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. These preparations also may be emulsified.
  • a typical composition for such purpose comprises a pharmaceutically acceptable carrier.
  • the composition may contain 10 mg, 25 mg, 50 mg or up to about 100 mg of human serum albumin per milliliter of phosphate buffered saline.
  • Other pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like.
  • non-aqueous solvents examples include propylene glycol, polyethylene glycol, vegetable oil and injectable organic esters such as ethyloleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc.
  • Intravenous vehicles include fluid and nutrient replenishers.
  • Preservatives include antimicrobial agents, anti-oxidants, chelating agents and inert gases.
  • the pH and exact concentration of the various components the pharmaceutical composition are adjusted according to well known parameters.
  • Oral formulations include such typical excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like.
  • the compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders.
  • the therapeutic compositions of the present invention may include classic pharmaceutical preparations. Administration of therapeutic compositions according to the present invention will be via any common route so long as the target tissue is available via that route. This includes oral, nasal, buccal, rectal, vaginal or topical. Topical administration may be particularly advantageous for the treatment of skin cancers, to prevent chemotherapy- induced alopecia or other dermal hyperproliferative disorder. Alternatively, administration may be by orthotopic, intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection. Such compositions would normally be administered as pharmaceutically acceptable compositions that include physiologically acceptable carriers, buffers or other excipients. For treatment of conditions of the lungs, or respiratory tract, aerosol delivery can be used.
  • volume of the aerosol is between about 0.01 ml and 0.5 ml.
  • An effective amount of the therapeutic composition is determined based on the intended goal.
  • the term "unit dose” or “dosage” refers to physically discrete units suitable for use in a subject, each unit containing a predetermined-quantity of the therapeutic composition calculated to produce the desired responses discussed above in association with its administration, i.e., the appropriate route and treatment regimen.
  • Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting the dose include the physical and clinical state of the patient, the route of administration, the intended goal of treatment (e.g., alleviation of symptoms versus cure) and the potency, stability and toxicity of the particular therapeutic substance.
  • compositions and methods of the present invention involve an inhibitor of expression of a STAT protein, or construct capable of expressing an inhibitor of STAT expression, in combination with a second or additional therapy.
  • Such therapy can be applied in the treatment of any disease that is associated with increased expression or activity of a STAT protein.
  • the disease may be an inflammatory disease or a hyperproliferative disease, such as cancer.
  • Non-limiting examples of inflammatory diseases contemplated by the present invention include rheumatoid arthritis and infectious disease.
  • compositions including combination therapies enhance the therapeutic or protective effect, and/or increase the therapeutic effect of another anti-cancer or anti-hyperproliferative therapy.
  • Therapeutic and prophylactic methods and compositions can be provided in a combined amount effective to achieve the desired effect, such as the killing of a cancer cell and/or the inhibition of cellular hyperproliferation. This process may involve contacting the cells with both an inhibitor of gene expression and a second therapy.
  • a tissue, tumor, or cell can be contacted with one or more compositions or pharmacological formulation(s) including one or more of the agents (i.e., inhibitor of gene expression or an anti-cancer agent), or by contacting the tissue, tumor, and/or cell with two or more distinct compositions or formulations, wherein one composition provides 1) an inhibitor of gene expression; 2) an anti-cancer agent, or 3) both an inhibitor of gene expression and an anti- cancer agent.
  • a combination therapy can be used in conjunction with a chemotherapy, radiotherapy, surgical therapy, or immunotherapy.
  • An inhibitor of gene expression may be administered before, during, after or in various combinations relative to an anti-cancer treatment.
  • the administrations may be in intervals ranging from concurrently to minutes to days to weeks.
  • the inhibitor of gene expression is provided to a patient separately from an anti-cancer agent, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the two compounds would still be able to exert an advantageously combined effect on the patient.
  • a course of treatment will last 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 days or more.
  • one agent may be given on day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, any combination thereof, and another agent is given on day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,
  • the patient may be given one or multiple administrations of the agent(s). Moreover, after a course of treatment, it is contemplated that there is a period of time at which no anti-cancer treatment is administered. This time period may last 1, 2, 3, 4, 5, 6, 7 days, and/or 1, 2, 3, 4, 5 weeks, and/or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months or more, depending on the condition of the patient, such as their prognosis, strength, health, etc. [000133] Various combinations may be employed. For the example below an inhibitor of gene expression therapy is "A" and an anti-cancer therapy is "B":
  • Administration of any compound or therapy of the present invention to a patient will follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the agents. Therefore, in some embodiments there is a step of monitoring toxicity that is attributable to combination therapy. It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, as well as surgical intervention, may be applied in combination with the described therapy.
  • a standard therapy will include chemotherapy, radiotherapy, immunotherapy, surgical therapy or gene therapy and may be employed in combination with the inhibitor of gene expression therapy, anticancer therapy, or both the inhibitor of gene expression therapy and the anti-cancer therapy, as described herein. 1.
  • chemotherapeutic agents may be used in accordance with the present invention.
  • the term "chemotherapy” refers to the use of drugs to treat cancer.
  • chemotherapeutic agent is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis. Most chemotherapeutic agents fall into the following categories: alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and nitrosoureas.
  • the chemotherapeutic agent is a taxane, a taxane derivative, a taxane metabolite, or a taxane prodrug.
  • taxanes include docetaxel, paclitaxel, abraxane, 7-epipaclitaxel, t-acetyl paclitaxel, 10-desacetyl-paclitaxel, 10- desacetyl-7-epipaclitaxel, 7-xylosylpaclitaxel, lO-desacetyl-7-glutarylpaclitaxel, 7-N 5 N- dimethylglycylpaclitaxel, 7-L-alanylpaclitaxel, or a mixture thereof.
  • chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC- 1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; du
  • anti-hormonal agents that act to regulate or inhibit hormone action on tumors
  • SERMs selective estrogen receptor modulators
  • aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, megestrol acetate, exemestane, formestanie, fadrozole, vorozole, letrozole, and anastrozole
  • anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; as well as troxacitabine
  • DNA damaging factors include what are commonly known as ⁇ -rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells.
  • Other forms of DNA damaging factors are also contemplated such as microwaves, proton beam irradiation (U.S. Patents 5,760,395 and 4,870,287) and UV- irradiation. It is most likely that all of these factors affect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes.
  • Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens.
  • Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.
  • the terms "contacted" and "exposed,” when applied to a cell, are used herein to describe the process by which a therapeutic construct and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell. To achieve cell killing, for example, both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing.
  • immunotherapeutics In the context of cancer treatment, immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells.
  • Trastuzumab (HerceptinTM) is such an example.
  • the immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell.
  • the antibody alone may serve as an effector of therapy or it may recruit other cells to actually affect cell killing.
  • the antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent.
  • the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target.
  • Various effector cells include cytotoxic T cells and NK cells. The combination of therapeutic modalities, i.e., direct cytotoxic activity and inhibition or reduction of ErbB2 would provide therapeutic benefit in the treatment of ErbB2 overexpressing cancers.
  • Another immunotherapy could also be used as part of a combined therapy with gen silencing therapy discussed above.
  • the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells.
  • tumor markers exist and any of these may be suitable for targeting in the context of the present invention.
  • Common tumor markers include carcinoembryonic antigen, prostate specific antigen, urinary tumor associated antigen, fetal antigen, tyrosinase ( ⁇ 97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin receptor, erb B and pi 55.
  • An alternative aspect of immunotherapy is to combine anticancer effects with immune stimulatory effects.
  • Immune stimulating molecules also exist including: cytokines such as IL-2, IL-4, IL- 12, GM-CSF, gamma-IFN, chemokines such as MIP-I,
  • immune stimulating molecules either as proteins or using gene delivery in combination with a tumor suppressor has been shown to enhance anti-tumor effects (Ju et al. , 2000). Moreover, antibodies against any of these compounds can be used to target the anti-cancer agents discussed herein.
  • immunotherapies currently under investigation or in use are immune adjuvants e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene and aromatic compounds (U.S.
  • Patents 5,830,880 and 5,846,945) and monoclonal antibodies e.g., anti-ganglioside GM2, anti-HER- 2, anti-pl85 (Pietras et al, 1998; Hanibuchi et al, 1998; U.S. Patent 5,824,311). It is contemplated that one or more anti-cancer therapies may be employed with the gene silencing therapies described herein.
  • an antigenic peptide, polypeptide or protein, or an autologous or allogenic tumor cell composition or "vaccine” is administered, generally with a distinct bacterial adjuvant (Ravindranath and Morton, 1991; Morton et al, 1992; Mitchell et al, 1990; Mitchell et al, 1993).
  • adoptive immunotherapy the patient's circulating lymphocytes, or tumor infiltrated lymphocytes, are isolated in vitro, activated by lymphokines such as IL-2 or transduced with genes for tumor necrosis, and readministered (Rosenberg et al, 1988; 1989).
  • Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatment of the present invention, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and/or alternative therapies.
  • Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed.
  • Tumor resection refers to physical removal of at least part of a tumor.
  • treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs' surgery). It is further contemplated that the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue.
  • a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well.
  • agents may be used in combination with the present invention to improve the therapeutic efficacy of treatment.
  • additional agents include immunomodulatory agents, agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers, or other biological agents.
  • Immunomodulatory agents include tumor necrosis factor; interferon alpha, beta, and gamma; IL-2 and other cytokines; F42K and other cytokine analogs; or MIP-I, MIP-I beta, MCP-I, RANTES, and other chemokines.
  • cytostatic or differentiation agents can be used in combination with the present invention to improve the anti-hyerproliferative efficacy of the treatments.
  • Inhibitors of cell adhesion are contemplated to improve the efficacy of the present invention.
  • Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody c225, could be used in combination with the present invention to improve the treatment efficacy.
  • FAKs focal adhesion kinase
  • Lovastatin agents that increase the sensitivity of a hyperproliferative cell to apoptosis
  • the antibody c225 could be used in combination with the present invention to improve the treatment efficacy.
  • hyperthermia is a procedure in which a patient's tissue is exposed to high temperatures (up to 106°F).
  • External or internal heating devices may be involved in the application of local, regional, or whole-body hyperthermia.
  • Local hyperthermia involves the application of heat to a small area, such as a tumor. Heat may be generated externally with high-frequency waves targeting a tumor from a device outside the body. Internal heat may involve a sterile probe , including thin, heated wires or hollow tubes filled with warm water, implanted microwave antennae, or radiofrequency electrodes.
  • a patient's organ or a limb is heated for regional therapy, which is accomplished using devices that produce high energy, such as magnets.
  • some of the patient's blood may be removed and heated before being perfused into an area that will be internally heated.
  • Whole-body heating may also be implemented in cases where cancer has spread throughout the body. Warm-water blankets, hot wax, inductive coils, and thermal chambers may be used for this purpose.
  • Hormonal therapy may also be used in conjunction with the present invention or in combination with any other cancer therapy previously described.
  • the use of hormones may be employed in the treatment of certain cancers such as breast, prostate, ovarian, or cervical cancer to lower the level or block the effects of certain hormones such as testosterone or estrogen. This treatment is often used in combination with at least one other cancer therapy as a treatment option or to reduce the risk of metastases.
  • H. Kits and Diagnostics
  • kits are envisioned containing therapeutic agents and/or other therapeutic and delivery agents.
  • the present invention contemplates a kit for preparing and/or administering a therapy of the invention.
  • the kit may comprise one or more sealed vials containing any of the pharmaceutical compositions of the present invention.
  • the lipid is in one vial, and the nucleic acid component is in a separate vial.
  • the kit may include may include at least one inhibitor of STAT expression, one or more lipid component, as well as reagents to prepare, formulate, and/or administer the components of the invention or perform one or more steps of the inventive methods.
  • the kit may also comprise a suitable container means, which is a container that will not react with components of the kit, such as an eppendorf tube, an assay plate, a syringe, a bottle, or a tube.
  • the container may be made from sterilizable materials such as plastic or glass.
  • the kit may further include an instruction sheet that outlines the procedural steps of the methods, and will follow substantially the same procedures as described herein or are known to those of ordinary skill.
  • the instruction information may be in a computer readable media containing machine-readable instructions that, when executed using a computer, cause the display of a real or virtual procedure of delivering a pharmaceutically effective amount of a composition of the present invention to a subject in need.
  • the SKOV3 cell line (Buick et al, 1985) was obtained from American Type Tissue Culture and maintained in Minimal Essential Media
  • EG cells (Stalling et al, 1996) were maintained in RPMI-1640 with 15% FBS and 0.1% MITO Plus reagent (BD Biosciences,
  • Norepinephrine, epinephrine, and propanolol were purchased from Sigma (St. Louis, MO) and reconstituted and stored in 5N
  • KT5720 (Calbiochem, San Diego, CA) were stored at -20 0 C.
  • Anti-IL-6 antibody was from (Biosource, Camarillo, CA). When used, these inhibitory substances were exposed to cells for 1 hour prior to exposure to norepinephrine or epinephrine.
  • Western Blot Cell lysate was prepared by washing cells with PBS and incubated for 10 min at 4 0 C in modified RIPA lysis buffer (5OmM Tris, 15OmM NaCI, 1% triton, 0.5% deoxycholate plus the protease inhibitors leupeptin, aprotinin, EDTA, and sodium vanadate (Sigma).
  • DNA-binding activity of STAT3 was assessed by electrophoretic mobility shift assay (EMSA) of nuclear extracts from 10 7 cultured cells, serum starved for 15 hours and either untreated or treated with NE for 5, 15, 30, and 60 minutes.
  • ESA electrophoretic mobility shift assay
  • Nuclear extracts were obtained by differential lysis at 4°C (Read, 1996), and 1/25 (2 ⁇ l) of the resulting extract was incubated at room temperature for 15 min with 1.75 pmol of 32 P-labeled STAT3 consensus oligonucleotide (Promega, Madison, WI) in a 10 aqueous binding reaction containing 2 ⁇ l of 5x gel shift binding buffer (20% glycerol, 5mM MgC12, 2.5mM EDTA, 2.5mM DTT, 25OmM NaCI, 5OmM Tris-HCI, pH 7.5, and. 25 mg/ml poly(dl-dC); Promega).
  • 5x gel shift binding buffer 20% glycerol, 5mM MgC12, 2.5mM EDTA, 2.5mM DTT, 25OmM NaCI, 5OmM Tris-HCI, pH 7.5, and. 25 mg/ml poly(dl-dC); Promega).
  • Bound oligonucleotides were resolved on a 6% polyacrylamide gel (run for 90 min at 250V following a 15 min pre-run) and quantified on a Storm 860 phosphoimager using ImageQuant software (Molecular Dynamics, Sunnyvale, CA). All binding reactions were oligonucleotide-specific as demonstrated by competitive inhibition when protein extracts were preincubated with 100-fold excess of unlabeled target oligonucleotide, but not when extracts were preincubated with similar concentrations of an unlabeled control oligonucleotide. Equivalent loading of nuclear protein into each binding reaction was verified by Bradford assay (Bio-Rad).
  • siRNA Small interfering RNA.
  • STAT3 -specific siRNA was purchased from Qiagen (Valencia, CA),
  • RNAiFect transfection agent (1 ⁇ g siRNA to 6 ⁇ g RNAiFect) and exposed to cells at 70-80% confluence for 24 hours prior to use in the MICS invasion system or collection of supernatant for assessment of MMP production.
  • siRNA was encapsulated into the neutral liposome, 1 ,2-Dioleoyl-sn-Glycero-3 -Phosphatidylcholine (DOPC) as previously described (Landen et al, 2005). For each treatment, 3.5 ⁇ g of siRNA was reconstituted in the neutral liposome, 1 ,2-Dioleoyl-sn-Glycero-3 -Phosphatidylcholine (DOPC) as previously described (Landen et al, 2005). For each treatment, 3.5 ⁇ g of siRNA was reconstituted in
  • the Membrane Invasion Culture System (MICS) chamber was used to measure the in vitro invasiveness of all cell lines used in this study (Chambers, 2000; Sood et al, 2001; Sood et al, 2004). SiRNA was exposed to cells 24 hours prior to cell harvest, and 10 ⁇ M of NE was exposed for 3 hours prior to harvest and testing for invasion.
  • MICS assay a polycarbonate membrane with 10 ⁇ iM pores (Osmonics; Livermore, CA) was uniformly coated with a defined basement membrane matrix consisting of human laminin/type IV collagen/gelatin and used as the intervening barrier to invasion.
  • the defined matrix was prepared (stored at 4°C) in a 10 mL stock solution as follows: laminin (50 ⁇ g/mL) ImL + type IV collagen (50 ⁇ g/mL) 0.2 mL + gelatin (2 mg/mL) 4mL + 4.8 mL PBS. Using a disposable pipet, 1 mL of the matrix solution was dispensed across a long side of the membrane. An 8 mm glass rod was used to spread the matrix across the membrane, and allowed to dry for 30 minutes. The matrix coated filter was placed coated side up on the lower plate followed by carefully attaching the upper plate. Both upper and lower wells of the chamber were filled with serum-free RPMI containing IX MITO+(Collaborative Biomedical; Bedford, MA).
  • Single cell tumor suspensions were seeded into the upper wells at a concentration of 1 X 10 cells per well. Following a 24 hour incubation in a humidified incubator at 37°C with 5% CO 2 , cells that had invaded through the basement membrane were collected through the sideport by replacing the media in the lower chamber with 2mM EDTA/PBS, pH 7.4, for 20 minutes at 37°C. The cells recovered from the bottom of the filter were then loaded onto a dot blot manifold containing 3 ⁇ m pore polycarbonate filters, fixed, stained, and counted by light microscopy (Sood et al, 2001; Sood et al, 2004). Invasiveness was calculated as the percentage of cells that had successfully invaded through the matrix-coated membrane to the lower wells relative to the total number of cells seeded into the upper wells. The invasion assays were performed in triplicate and repeated once.
  • MMP matrix metalloproteinase
  • the protein concentration of total MMP-2 (pro-and active MMP-2), and total MMP-9 (92kDa pro- and 82kDa active forms) were determined using Quantikine immunoassays (R&D Systems; Minneapolis, MN) as per the manufacturer's protocols.
  • the concentrations of active MMP-2 and MMP-9 were determined using the Biotrak Activity Assay System (Amersham Biosciences, Piscataway, NJ) as per the manufacturer's protocols.
  • the MMP experiments were performed in triplicate and repeated once. [000165] In vivo tumor model. Female nude mice were purchased from the National Cancer Institute - Frederick Cancer Research Facility (Frederick, MD).
  • mice were housed and maintained under specific pathogen-free conditions in facilities approved by the American Association for Accreditation of Laboratory Animal Care in accordance with current regulations and standards of the United States Department of Agriculture, United States Department of Health and Human Services, and the National Institutes of Health. The mice were used according to institutional guidelines when they were 8-12 weeks of age.
  • SKOV3ipl tumor cells were harvested from subconfluent cultures by a brief exposure to 0.25% trypsin and 0.02% EDTA. Trypsinization was stopped with medium containing 10% FBS. The cells were then washed once in serum-free medium and resuspended in Hank's Balanced salt solution (serum free).
  • mice were treated with daily injections of PBS (200 ⁇ l, intraperitoneal (IP)), isoproterenol (10 mg/kg daily IP), or isoproterenol (10 mg/kg) in combination with siRNA (control or STAT3 -specific, 3.5 ⁇ g in DOPC every 3 days, IP) for 7 days (Landen et ah, 2006).
  • PBS 200 ⁇ l, intraperitoneal (IP)
  • isoproterenol 10 mg/kg daily IP
  • siRNA control or STAT3 -specific, 3.5 ⁇ g in DOPC every 3 days, IP
  • mice All treatments were administered in a total volume of 200 ⁇ l.
  • Norepinephrine induces translocation of STAT3 to the nucleus. Studies were then conducted to confirm that once STAT3 was activated, it was directed to the nucleus. Staining of SKOV3 cells in culture chambers after norepinephrine exposure showed that compared to untreated cells (FIG. 2A), increased levels of activated STAT3 were seen in as little as 15 minutes (FIG. 2C). This expression induction was predominantly in the nucleus. Pretreatment with propanolol again prevented the norepinephrine-induced effects on STAT3 (FIG. 2D), suggesting that STAT3 activation is mediated via ⁇ -adrenergic receptors.
  • Neuroendocrine hormones bind adrenergic receptors and activate the G-protein adenylyl cyclase, which activates the second messenger molecule cyclic AMP.
  • Multiple pathways are activated by cyclic AMP, including that mediated by protein kinase A.
  • cells were preincubated with the protein kinase A inhibitor KT5720 for one hour prior to norepinephrine exposure.
  • the MICS chamber system was used to quantify cell invasion with NE with or without STAT3 downregulation (FIG. 5B).
  • the STAT3-siRNA completely blocked the norepinephrine-mediated increase in invasion, whereas the control siRNA had no effect.
  • studies were conducted to investigate whether the invasion rates could be affected by changes in proliferation.
  • the effects of norepinephrine and epinephrine on ovarian cancer cell proliferation was studied using the MTT assay. Neither of these two catecholamines affected cell proliferation despite testing multiple doses and time periods.
  • STAT3 siRNA-DOPC reduced tumor growth by 47.1 (p ⁇ 0.01) under basal conditions.
  • STAT3 siRNA-DOPC completely blocked isoproterenolstimulated tumor growth, reducing tumor volume by 85% and infiltration.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Preparation (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to the fields of molecular biology and drug delivery. Disclosed are compositions that include a nucleic acid targeted to a STAT gene and a neutral lipid. Also disclosed are methods of treating a human subject with a disease associated with increased expression of a STAT involving administering to the subject a pharmaceutically effective amount of a composition that includes a nucleic acid targeted to a STAT gene and a neutral lipid. Specific embodiments pertain to a method of treating cancer comprising administering to a subject a pharmaceutically effective amount of a composition that includes an siRNA targeted to STAT3 and a neutral lipid.

Description

DESCRIPTION
LIPOSOMAL INHIBITORY NUCLEIC ACID AGAINST STAT PROTEINS
BACKGROUND OF THE INVENTION
[0001] The present application claims priority to U.S. Provisional Patent Application Serial No. 60/945,832, filed June 22, 2007, the entire contents of which is herein specifically incorporated by reference in its entirety.
IL FIELD OF THE INVENTION [0002]The present invention relates generally to the fields of molecular biology, RNA interference, and oncology. More particularly, the invention concerns compositions comprising an inhibitory nucleic acid, wherein the inhibitory nucleic acid is targeted to a nucleic acid encoding a STAT protein. The invention also generally pertains to methods of treating a disease associated with overexpression of a STAT protein in a subject, involving administering to the subject a pharmaceutically effective amount of a composition comprising an inhibitory nucleic acid and a lipid component, wherein the inhibitory nucleic acid is targeted to a nucleic acid encoding a STAT.
III. DESCRIPTION OF RELATED ART
[0003] Stress and other behavioral conditions are believed to be associated with cancer pathogenesis and progression (see, e.g., Thaker et al, 2006; Spiegel, 2002; Andersen et al, 1996; Spiegel and Kato, 1996). However, the mechanism of stress-related cancer progression is poorly understood. It is believed that the same hormones that coordinate the stress response are believed to be involved in mediating cancer progression (see, e.g., Thaker et al, 2006; Glaser et al, 1999; Strange et al, 2000). Several behavioral interventions designed to reduce the stress response have successfully improved relevant parameters of the immune response as well as total mortality(Spiegel, 2002; House et al, 1988; Andersen et al, 2004), with as long as ten years of follow-up data (Fawzy et al. , 2003). However, there is a paucity of data delineating the biologic mechanisms involved.
[0004] Stress is associated with an increase in the neuroendocrine hormones norepinephrine and epinephrine, which are released from sympathetic nervous system neurons and the adrenal medulla. Stress can also activate the release of Cortisol by the adrenal gland. Catecholamines have been shown to increase the growth of malignant ovarian cancer cells via beta-adrenergic receptors (Thaker et al, 2006; Lutgendorf et al, 2003). Moreover, there is evidence that chronic stress results in a more infiltrative pattern of tumor growth (Thaker et al, 2006) and the increase in invasive potential is related to increased levels of matrix metalloproteinases (MMPs) (Sood et al. , 2006).
[0005] Higher levels of social support are associated with lower levels of these hormones (Kemp and Hatmaker, 1989; Seeman, 1994), and interventions that decrease stress correspondingly decrease stress hormones (Antoni et al, 2000). Patients with increased stress have higher circulating VEGF levels, and that neuroendocrine hormones can induce VEGF production by ovarian cancer cells (Lutgendorf et al, 2002). VEGF has long been recognized as an important mediator of angiogenesis and cancer progression (Folkman, 1995; Ellis and Fidler, 1996). VEGF expression has recently been associated with STAT3 activation at a tissue level (Ye et al., 2004; Chen et al, 2004).
[0006] While circulating plasma levels of norepinephrine are only about 10-1000 pM in a normal individual, and may reach as high as 100 nM in conditions of stress (Schmidt and Kraft, 1996), catecholamine levels in the ovary are at least 100 times higher. Studies suggest that within the parenchyma of the ovary, and thus the tumor microenvironment, concentrations may reach as high as 10 μM (Lara et al, 2001; Lara et al, 2002).
[0007]Signal Transducers and Activator of Transcription (STAT) protein regulates many aspects of cell growth, survival and differentiation. The mammalian STAT family members include STATl, STAT2, STAT3, STAT4, STAT5 a and b, and STAT6.
[0008] STAT3 is involved in numerous processes that relate to cancer progression (CaIo et al. , 2003). Constitutive STAT3 activation has been noted in numerous cancer types, such as hematologic, head and neck, brain, breast, lung, prostate, pancreas, and ovarian cancers (Bromberg, 2002; Garcia et al, 2001; Song and Grandis, 2000; Lin et al, 2000; Huang et al, 2000; Sartor et al, 1997; Garcia et al, 1997). STAT3 has transforming properties in and of itself, and is a participant in many other processes associated with oncogenesis (Bowman et al, 2000). There is evidence that STAT3 directly participates in inhibition of apoptosis (Niu et al, 2001; Burke et al, 2001), cell cycle dysregulation (Sinibaldi et al, 2000), induction of angiogenesis (Schaefer et al, 2000; Niu et al, 2002), and evasion of the immune system (Gamero et al, 2004; Wang et al, 2004). [0009] There have been prior reports suggesting a relationship between STAT3 and MMP production in cancer. STAT3 has been shown to be a transcriptional regulator or MMP-2 in human melanoma cells (Xie et al, 2004; Kortylewski et al, 2005; Xie et al, 2006). STAT3 is required for maximal induction of MMP-I by EGFR in bladder cancer cells (Itoh et al, 2006) and by fibroblast growth factor- 1 in prostate cancer cells (Udayakumar et al, 2004). STAT3 activation is strongly correlated with MMP expression in breast cancer (Hsieh et al. , 2005), and the relationship is implicated in carcinogenesis (Dechow et al., 2004).
[00010] Liposomes have been used previously for drug delivery {e.g., delivery of a chemotherapeutic). Cationic liposomes are described in PCT publications WO02/100435A1, WO03/015757A1, WO04029213A2, and U.S. Patents 5,962,016, 5,030,453, and 6,680,068, and U.S. Patent Application 2004/0208921, all of which are hereby incorporated by reference in their entirety without disclaimer. A process of making liposomes is also described in WO04/002453A1. Neutral lipids have also been incorporated into cationic liposomes (see, e.g., Farhood et al, 1995). [00011] Cationic liposomes have been used to deliver siRNA to various cell types (see, e.g., Sioud and Sorensen, 2003; U.S. Patent Application 2004/0204377; Duxbury et al, 2004; Donze and Picard, 2002). Neutral liposomes have been tested to a limited degree. Neutral liposomes were used to deliver therapeutic antisense oligonucleotides in U.S. Patent Application 2003/0012812 and siRNA in WO 2006/113679.
SUMMARY OF THE INVENTION
[00012] The present invention is based on the finding of an association between the presence of neuroendocrine hormones associated with stress and elevation of STAT protein expression in disease, such as cancer. For example, the inventors have found that neuroendocrine hormones that are associated with stress have the potential to activate STAT3 and induce its nuclear translocation and DNA binding. The direct activation of STAT3 by norepinephrine and epinephrine, proceeding through the βl/β2 adrenergic receptors, results in increased MMP production and cell invasion, as well as tumor growth. The invention is also based on the finding that the activation of STAT proteins in cancer can be ameliorated by downregulation using inhibitory nucleic acids. [00013] The present invention generally concerns compositions that includes: (1) an inhibitory nucleic acid {e.g., siNA), wherein the nucleic acid inhibits the expression of a gene encoding a STAT or encodes a nucleic acid that inhibits the expression of a gene encoding a STAT; and (2) a lipid component that includes one or more phospholipids, wherein the lipid component has an essentially neutral charge.
[00014] The inhibitory nucleic acid may inhibit the expression of any STAT protein. For example, the STAT protein may be STATl, STAT2, STAT3, STAT4, STAT5a, STAT5b, or STAT6. In particular embodiments, the STAT is STAT3.
[00015] Inhibitory nucleic acids or "siNA", as used herein, is defined as a short interfering nucleic acid. An inhibitory nucleic acid includes a siRNA, a nucleic acid encoding a siRNA, or shRNA (short hairpin RNA), a ribozyme, or an antisense nucleic acid molecule that specifically hybridize to a nucleic acid molecule encoding a target protein or regulating the expression of the target protein. "Specific hybridization" means that the siRNA, shRNA, ribozyme or antisense nucleic acid molecule hybridizes to the targeted nucleic acid molecule and regulates its expression. Preferably, "specific hybridization" also means that no other genes or transcripts are affected.
[00016] Examples of siNA include but are not limited to RNAi, double-stranded RNA, and siRNA. A siNA can inhibit the transcription or translation of a gene in a cell. A siNA may be from 16 to 1000 or more nucleotides long, and in certain embodiments from 18 to 100 nucleotides long. In certain embodiments, the siNA may be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 200, 300, 500, or more nucleotides long. The siNA may comprise a nucleic acid and/or a nucleic acid analog. Typically, a siNA will inhibit the translation of a single gene within a cell; however, in certain embodiments, a siNA will inhibit the translation of more than one gene within a cell. In particular aspects, the double stranded nucleic acid can comprise 18 to 30, 19 to 25, 20 to 23, or 21 contiguous nucleobases or nucleobase pairs.
[00017] The siNA component comprises a single species of siRNA or more than one species of siRNA. In other embodiments, the siNA component comprises a 2, 3, 4 or more species of siRNA that target 1, 2, 3, 4, or more genes. In some embodiments, the siNA is encapsulated in the lipid component.
[00018] The siNA component may inhibit the expression of a STAT protein, or a truncated form on a STAT protein. For example, STAT3-beta is a truncated form of STAT3 that contains the dimerization and DNA binding domain but lacks the transactivation domain. [00019] siRNA can be obtained from commercial sources, natural sources, or can be synthesized using any of a number of techniques well-known to those of ordinary skill in the art. For example, one commercial source of predesigned siRNA is Ambion®, Austin, TX. Another is Qiagen® (Valencia, CA). An inhibitory nucleic acid that can be applied in the compositions and methods of the present invention may be any nucleic acid sequence that has been found by any source to be a validated downregulator of a STAT protein. For example, in a particular embodiment, the inhibitory nucleic acid is Qiagen® (Valencia, CA) validated siRNA product Catalog Number SIO2662338.
[00020] In some aspects the lipid component may be in the form of a liposome. The siNA (e.g., a siRNA) may be encapsulated in the liposome or lipid component, but need not be.
Encapsulate refers to the lipid or liposome forming an impediment to free difussion into solution by an association with or around an agent of interest, e.g., a liposome may encapsulate an agent within a lipid layer or within an aqeous compartement inside or between lipid layers. In certain embodiments, the composition is comprised in a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may be formulated for administration to a human subject or patient.
[00021] In certain embodiments, the lipid component has an essentially neutral charge because it comprises a neutral phospholipid or a net neutral charge. In certain aspects a neutral phospholipid may be a phosphatidylcholine, such as DOPC, egg phosphatidylcholine ("EPC"), dilauryloylphosphatidylcholine ("DLPC"), dimyristoylphosphatidylcholine ("DMPC"), dipalmitoylphosphatidylcholine ("DPPC"), distearoylphosphatidylcholine ("DSPC"), l-myristoyl-2-palmitoyl phosphatidylcholine ("MPPC"), l-palmitoyl-2-myristoyl phosphatidylcholine ("PMPC"), l-palmitoyl-2-stearoyl phosphatidylcholine ("PSPC"), 1- stearoyl-2-palmitoyl phosphatidylcholine ("SPPC"), dimyristyl phosphatidylcholine ("DMPC"), l,2-distearoyl-sn-glycero-3-phosphocholine ("DAPC"), 1 ,2-diarachidoyl-sn- glycero-3-phosphocholine ("DBPC"), 1 ,2-dieicosenoyl-sn-glycero-3-phosphocholine ("DEPC"), palmitoyloeoyl phosphatidylcholine ("POPC"), lysophosphatidylcholine, or dilinoleoylphosphatidylcholine. In other aspects the neutral phospholipid can be a phosphatidylethanolamine, such as dioleoylphosphatidylethanolamine ("DOPE"), distearoylphophatidylethanolamine ("DSPE"), dimyristoyl phosphatidylethanolamine ("DMPE"), dipalmitoyl phosphatidylethanolamine ("DPPE"), palmitoyloeoyl phosphatidylethanolamine ("POPE"), or lysophosphatidylethanolamine. In certain embodiments, the phospholipid component can comprise 1, 2, 3, 4, 5, 6, 7, 8, or more kinds or types of neutral phospholipid. In other embodiments, a phospholipid component can comprise 2, 3, 4, 5, 6 or more kinds or type of neutral phospholipids.
[00022] In certain embodiments, a lipid component can have an essentially neutral charge because it comprises a positively charged lipid and a negatively charged lipid. The lipid component may further comprise a neutrally charged lipid(s) or phospholipid(s). The positively charged lipid may be a positively charged phospholipid. The negatively charged lipid may be a negatively charged phospholipid. The negatively charged phospholipid may be a phosphatidylserine, such as dimyristoyl phosphatidylserine ("DMPS"), dipalmitoyl phosphatidylserine ("DPPS"), or brain phosphatidylserine ("BPS"). The negatively charged phospholipid may be a phosphatidylglycerol, such as dilauryloylphosphatidylglycerol ("DLPG"), dimyristoylphosphatidylglycerol ("DMPG"), dipalmitoylphosphatidylglycerol ("DPPG"), distearoylphosphatidylglycerol ("DSPG"), or dioleoylphosphatidylglycerol ("DOPG"). In certain embodiments, the composition further comprises cholesterol or polyethyleneglycol (PEG). In certain embodiments, a phospholipid is a naturally-occurring phospholipid. In other embodiments, a phospholipid is a synthetic phospholipid.
[00023] The composition may further comprise a chemotherapeutic or other anti-cancer agent, which may or may not be encasulated in a lipid component or liposome of the invention. In specific embodiments, the chemotherapeutic agent is a taxane or taxane derivative. Examples of such agents include docetaxel, paclitaxel, abraxane, 7-epipaclitaxel, t-acetyl paclitaxel, 10-desacetyl -paclitaxel, 10-desacetyl-7-epipaclitaxel, 7-xylosylpaclitaxel, lO-desacetyl-7-glutarylpaclitaxel, 7-N,N-dimethylglycylpaclitaxel, 7-L-alanylpaclitaxel, or a mixture thereof.
[00024] In further embodiments, the chemotherapeutic agent is cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP 16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, gemcitabien, navelbine, farnesyl-protein tansferase inhibitors, transplatinum, 5-fluorouracil, vincristine, vinblastin, methotrexate, or combinations thereof. In particular embodiments, the chemotherapeutic agent is docetaxel. [00025] The present invention also generally pertains to methods of treating a subject with a hyperproliferative disease involving administering to the subject a pharmaceutically effective amount of a composition comprising an inhibitory nucleic acid, wherein the nucleic acid inhibits the expression of a gene encoding a STAT or encodes a nucleic acid that inhibits the expression of a gene encoding a STAT; and (2) a lipid component. The composition, for example, can be any of the compositions discussed above. The inhibitory nucleic acid may inhibit the expression of any gene encoding a STAT protein. The STAT may be STATl, STAT2, STAT3, STAT4, STAT5a, STAT5b, or STAT6. In particular embodiments, the STAT is STAT3.
[00026] The cancer can be any type of cancer, such as breast cancer, lung cancer, prostate cancer, ovarian cancer, brain cancer, liver cancer, cervical cancer, colon cancer, renal cancer, skin cancer, head and neck cancer, bone cancer, esophageal cancer, bladder cancer, uterine cancer, lymphatic cancer, stomach cancer, pancreatic cancer, testicular cancer, lymphoma, or leukemia. In a specific embodiment, the cancer is ovarian cancer and the STAT is STAT3.
[00027] In some embodiments, the method further includes identifying a subject in need of treatment. Such identification can be by any method known to those of ordinary skill in the art, such as based on clinical examination, based on identification of a particular stage or grade of tumor, and so forth. In some embodiments, the composition is administered in the form of a vaccine.
[00028] In certain embodiments, the methods of the invention further comprise administering an additional anticancer therapy to the subject. The additional therapy may comprise administering a chemotherapeutic, a surgery, a radiation therapy, an immunotherapy, and/or a gene therapy. In certain aspects the chemotherapy is docetaxel, paclitaxel, cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP 16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, gemcitabien, navelbine, farnesyl-protein tansferase inhibitors, transplatinum, 5-fluorouracil, vincristin, vinblastin, methotrexate, or combinations thereof. In certain embodiments the chemotherapy is a taxane such as docetaxal or paclitaxel. The chemotherapy can be delivered before, during, after, or combinations thereof relative to a neutral lipid composition of the invention. A chemotherapy can be delivered within 0, 1, 5, 10, 12, 20, 24, 30, 48, or 72 hours or more of the neutral lipid composition. The neutral lipid composition, the second anti-cancer therapy, or both the neutral lipid composition and the anti-cancer therapy can be administered intratumorally, intravenously, intraperitoneally, orally or by various combinations thereof. [00029] The therapeutic agents and compositions set forth herein can be administered to the patient using any technique known to those of ordinary skill in the art. For example, administration may be intravenously, intraperitoneally, intratracheally, intratumorally, intramuscularly, endoscopically, intralesionally, percutaneously, subcutaneously, regionally, or by direct injection or perfusion.
[00030] In certain aspects, the invention concerns a method of treating a subject with ovarian cancer comprising administering to the subject a pharmaceutically effective amount of an siRNA, wherein the siRNA is targeted to a gene that encodes STAT3. In more particular embodiments, the method further involves administering a chemotherapeutic agent to the subject. The chemotherapeutic agent may be administered prior to the siRNA, concurrently with the siRNA, or following administration of the siRNA. The chemotherapeutic agent can be any of those agents discussed above and elsewhere in this specification.
[00031] In some embodiments, the subject has a tumor and the method of treating cancer is further defined as a method to reduce the invasiveness of a tumor in the subject. In particular embodiments, the tumor is ovarian cancer.
[00032] The present invention also generally pertains to methods of reducing stress hormone-inducted activation of STAT3 in a subject, involving administering to the subject a pharmaceutically effective amount of any of the compositions set forth above. In particular embodiments, the stress hormone-induced activation is norepinephrine- or epinephrine- induced activation of STAT3. In certain embodiments, the subject has a hyperproliferative disease, such as cancer. In a specific embodiments, the cancer is ovarian cancer.
[00033] The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." As used herein "another" may mean at least a second or more.
[00034] It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the invention, and vice versa. Furthermore, compositions of the invention can be used to achieve the methods of the invention. [00035] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects. [00036] The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive.
[00037] As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
[00038] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[00039] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. [00040] FIG. IA, IB, 1C, and ID. Effect of norepinephrine and epinephrine on phospho-STAT3. The ovarian cancer cell lines SKO V3 and EG were serum starved for 15 hours before addition of increasing concentrations of NE or Epi (FIG. IA). Cell lysate was collected 3 hours later, and subjected to Western blot using anti- phosphorylated STAT3 antibody. pSTAT3 increases significantly with as low as 0.1 μM of both hormones. Total STAT3 levels were not affected. Probing for β-actin confirms equal loading in all lanes. Treatment with propanolol, a βl/β2-adrenergic receptor blocker, for 1 hour prior to exposure to 10 μM NE prevented an increase in pSTAT3 (FIG. 1C). Cells pretreated with prazosin (an ai blocker), yohimbine (an a2 blocker), or the combination of both did not prevent NE-induced increases in pSTAT3 (FIG. ID). [00041] FIG. 2A, 2B, 2C, and 2D. Norepinephrine increases nuclear STAT3. SKOV3 cells incubated on chambered slides were serum-starved for 15 hours, and exposed to increasing concentrations of NE with or without a 1-hour pretreatment of propanolol (10 μM). After 3 hours, cells were fixed in acetone and total STAT3 was detected with immunohistochemistry. FIG. 2A shows constitutive presence of cytoplasmic STAT3 without NE stimulation compared to a negative control (no anti-STAT3 antibody, FIG. 2B). With 1 μM and 10 μM NE exposure (FIG. 2C), the nuclear signal increases dramatically, an effect inhibited by pretreatment with propanolol (FIG. 2D). [00042] FIG. 3. Norepinephrine induces STAT3 DNA binding. The electrophoretic mobility shift assay was performed on nuclear extracts from SKOV3 cells treated with 10 μM NE at the indicated timepoints. An increase in STAT3 binding to its promoter was seen after just 5 minutes of NE exposure, the earliest point examined. The effect seen persisted at the 60 minute timepoint, the latest point examined. [00043] FIG. 4A and 4B. Blockade of protein kinase A, but not IL-6, prevents NE- induced STAT3 activation. Pretreatment of SKOV3 cells with 1 μM of the protein kinase A-specifϊc inhibitor KT5720 reduces the increase in pSTAT3 seen with NE, as measured by Western blot (FIG. 4A). However, pretreatment with 50μg/ml anti-IL-6 antibody, a dose previously shown to inhibit the activating effect of IL-6 on STAT3, was not effective in reducing the NE-induced effects (FIG. 4B).
[00044] FIG. 5A, 5B, 5C, 5D. STAT3-mediated increases in cellular invasion and MMP expression with norepinephrine. After confirmation that an siRNA construct could reduce STAT3 expression by >80% (FIG. 5A), SKOV3 or EG cells were exposed to 10 μM NE alone and with STAT3 -specific siRNA or control siRNA, and introduced into the MICS system to determine effects on invasion (FIG. 5B). The percent of cells invading through a human-defined matrix increased by 2.6-3.1 fold with NE, and was not affected by control siRNA, but was significantly reduced to baseline levels with STAT3-siRNA therapy in the SKOV3 and EG cell lines. Similar groups were examined for MMP production. NE exposure resulted in a 4.8-fold increase in MMP-9 in SKOV3, and a 3.2-fold increase in EG (FIG. 5C). NE lead to a 2.6 and 1.9-fold increase in MMP-2 in SKOV3 and EG, respectively (FIG. 5D). Treatment with STAT3-siRNA prevented NE-induced MMP upregulation in both lines, whereas control siRNA had no effect.
[00045] FIG. 6. siRNA-directed STAT3 downregulation prevents stress-induced tumor growth. Mice were injected subcutaneously with SKOV3 cells, and 24 hours later treated via intraperitoneal injection with PBS or the f3AR agonist isoproterenol (10 mg/kg). With or without isoproterenol, mice were treated with vehicle, a control nonsilencing siRNA in the delivery liposome DOPC, or STAT3-targeting siRNA in DOPC. After 7 days of treatment, tumor volumes were measures and volume calculated as described in methods. Tumor volume was reduced by 46% with administration of STAT3- specific siRNA in the liposomal delivery vector DOPC, where control siRNA in DOPC did not reduce tumor volume. Isoproterenol administration led to an 8.5-fold increase in tumor volume, which was not affected by treatment with a control siRNA in DOPC, but was almost completely abrogated by S TAT3- specific siRNA in DOPC.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[00046] Stress has been associated with cancer initiation and progression, but the mechanisms underlying this association are incompletely understood. The inventors have found that stress hormones increase STAT3 phosphorylation and translocation into the nucleus. Further, they have found that stress hormones increase invasion of ovarian cancer cell lines and growth of cancer, such as ovarian cancer. Further, they have found that these effects are completely ameliorated with treatment with siRNA against STAT3.
A. STAT Proteins
[00047] STAT (signal transducers and activators of transcription) proteins are a family of proteins that regulate many aspects of cell growth, survival, and differentiation. They play a dual role in signal transduction and activation of transcription. There are six distinct family members and several isoforms. Cytokine binding induces activation of the intracellular Janus kinase that phosphorylates a specific tyrosine residue in the STAT protein which promotes the dimerization of STAT monomers via their SH2 domain. The phosphorylated dimer is then actively transported in the nucleus via importin a/b and RanGDP complex. Once inside the nucleus the active STAT dimer binds to cytokine inducible promoter regions of genes containing gamma activated site (GAS) motif and activate transcription of these genes. The STAT protein can be dephosphorylated by nuclear phosphatasess which leads to inactivation of STAT.
[00048] STAT3 (also known as acute phase response factor (APRF)), has been found to be responsive to interleukin-6 as well as epidermal growth factor (EGF). In addition, STAT3 has been found to have an important role in signal transduction by interferons. There is evidence that suggests that STAT3 may be regulated by the MAPK pathway. ERK2 induces serine phosphorylation and also associates with STAT3 (Jain et al, 1998).
[00049] Activation and/or overexpression of STAT3 appears to be involved in cancer. Non- limiting examples of such cancer include myeloma, breast carcinomas, prostate cancer, brain tumors, head and neck carcinomas, melanoma, leukemias, and lymphomas.
[00050] STAT3 may also play a role in inflammatory diseases, such as rheumatoid arthritis. Activated STAT3 has been found in the synovial fluid of rheumatoid arthritis patients and cells from inflamed joints (Sengupta et al, 1995; Wang et al, 1995).
[00051]. Table 1 lists STATS, and includes GenBank Accession numbers of mRNA sequences from homo sapiens. STATl, STAT2, STAT3, STAT4, STAT5 a and b, and STAT6.
Table 1
STAT GenBank Accession No. Sequence Identifier
STATl NM 139266 (transcript variant SEQ ID NO: 1 beta);
NM 007315 (transcript variant SEQ ID NO:2 alpha)
STAT2 NM 005419 SEQ ID NO:3
STAT3 NM 213662 (transcript variant SEQ ID NO:4
3), NM 003150 (transcript SEQ ID NO:5 variant 2); NM 139276 SEQ ID NO:6
(transcript variant 1)
STAT4 NM 003151 SEQ ID NO:7
STAT5a NM 003152 SEQ ID NO: 8
STAT5b NM 012448 SEQ ID NO: 9
STAT6 NM 003153 SEQ ID NO: 10 B. Therapeutic Gene Silencing
[00052] Since the discovery of RNAi by Fire and colleagues in 1981, the biochemical mechanisms have been rapidly characterized. Long double stranded RNA (dsRNA) is cleaved by Dicer, which is an RNAaseIII family ribonuclease. This process yields siRNAs of -21 nucleotides in length. These siRNAs are incorporated into a multiprotein RNA-induced silencing complex (RISC) that is guided to target mRNA. RISC cleaves the target mRNA in the middle of the complementary region. In mammalian cells, the related microRNAs (miRNAs) are found that are short RNA fragments (-22 nucleotides). MiRNAs are generated after Dicer-mediated cleavage of longer (-70 nucleotide) precursors with imperfect hairpin RNA structures. The miRNA is incorporated into a miRNA-protein complex (miRNP), which leads to translational repression of target mRNA.
[00053] To improve the effectiveness of siRNA-mediated gene silencing, guidelines for selection of target sites on mRNA have been developed for optimal design of siRNA (Soutschek et al, 2004; Wadhwa et al, 2004). These strategies may allow for rational approaches for selecting siRNA sequences to achieve maximal gene knockdown. To facilitate the entry of siRNA into cells and tissues, a variety of vectors including plasmids and viral vectors such as adenovirus, lentivirus, and retrovirus have been used (Wadhwa et al, 2004). While many of these approaches are successful for in vitro studies, in vivo delivery poses additional challenges based on the complexity of the tumor microenvironment.
[00054] Liposomes are a form of nanoparticles that are attractive carriers for delivering a variety of drugs into the diseased tissue. Optimal liposome size depends on the tumor target. In tumor tissue, the vasculature is discontinuous, and pore sizes vary from 100 to 780 run (Siwak et al. , 2002). By comparison, pore size in normal vascular endothelium is <2 nm in most tissues, and 6 nm in post-capillary venules. Most liposomes are 65-125 nm in diameter. Negatively charged liposomes were believed to be more rapidly removed from circulation than neutral or positively charged liposomes; however, recent studies have indicated that the type of negatively charged lipid affects the rate of liposome uptake by the reticuloendothelial system (RES). For example, liposomes containing negatively charged lipids that are not sterically shielded (phosphatidylserine, phosphatidic acid, and phosphatidylglycerol) are cleared more rapidly than neutral liposomes. Interestingly, cationic liposomes (1,2-dioleoyl- 3-trimethylammonium-propane [DOTAP]) and cationic-liposome-DNA complexes are more avidly bound and internalized by endothelial cells of angiogenic blood vessels via endocytosis than anionic, neutral, or sterically stabilized neutral liposomes (Thurston et al, 1998; Krasnici et al, 2003). Cationic liposomes may not be ideal delivery vehicles for tumor cells because surface interactions with the tumor cells create an electrostatically derived binding-site barrier effect, inhibiting further association of the delivery systems with tumor spheroids (Kostarelos et al, 2004). However, neutral liposomes appear to have better intratumoral penetration. Toxicity with specific liposomal preparations has also been a concern. Cationic liposomes elicit dose-dependent toxicity and pulmonary inflammation by promoting release of reactive oxygen intermediates, and this effect is more pronounced with multivalent cationic liposomes than monovalent cationic liposomes such as DOTAP (Dokka et al, 2000). Neutral and negative liposomes do not appear to exhibit lung toxicity (Guitierrez-Puente et al, 1999). Cationic liposomes, while efficiently taking up nucleic acids, have had limited success for in vivo gene downregulation, perhaps because of their stable intracellular nature and resultant failure to release siRNA contents. [00055] In vivo siRNA delivery using neutral liposomes in an orthotopic model of advanced ovarian cancer has been described (Landen et al, 2005, which is incorporated herein by reference in its entirety). For example, intravenous injection of the DOPC-siRNA complex allowed a significantly greater degree of siRNA deposition into the tumor parenchyma than either delivery with cationic (positively charged) liposomes (DOTAP) or unpackaged "naked" siRNA. While the DOPC formulation delivered siRNA to over 30% of cells in the tumor parenchyma, naked siRNA was delivered only to about 3% of cells, and DOTAP delivered siRNA only to tumor cells immediately adjacent to the vasculature.
[00056] Although siRNA appears to be more stable than antisense molecules, serum nucleases can degrade siRNAs (Leung and Whittaker, 2005). Thus, several research groups have developed modifications such as chemically stabilized siRNAs with partial phosphorothioate backbone and 2'-0-methyl sugar modifications or boranophosphate siRNAs (Leung and Whittaker, 2005). Elmen and colleagues modified siRNAs with the synthetic RNA-like high affinity nucleotide analogue, Locked Nucleic Acid (LNA), which significantly enhanced the serum half-life of siRNA and stabilized the structure without affecting the gene-silencing capability (Elmen et al, 2005). Alternative approaches including chemical modification (conjugation of cholesterol to the 3' end of the sense strand of siRNA by means of a pyrrolidine linker) may also allow systemic delivery without affecting function (Soutschek et al, 2004). Apsects of the present invention can use each of these modification strategies in combination with the compositions and methods described.
B. LIPID PREPARATIONS
[00057] The present invention provides methods and compositions for associating an inhibitory nucleic acid that inhibits the expression of a STAT protein, such as a siNA (e.g., a siRNA) with a lipid and/or liposome. The siNA may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the polynucleotide, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid. The liposome or liposome/siNA associated compositions of the present invention are not limited to any particular structure in solution. For example, they may be present in a bilayer structure, as micelles, or with a "collapsed" structure. They may also simply be interspersed in a solution, possibly forming aggregates which are not uniform in either size or shape.
[00058] Lipids are fatty substances which may be naturally occurring or synthetic lipids. For example, lipids include the fatty droplets that naturally occur in the cytoplasm as well as the class of compounds which are well known to those of skill in the art which contain long- chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes. An example is the lipid dioleoylphosphatidylcholine (DOPC).
[00059] "Liposome" is a generic term encompassing a variety of unilamellar, multilamellar, and multivesicular lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes may be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). However, the present invention also encompasses compositions that have different structures in solution than the normal vesicular structure. For example, the lipids may assume a micellar structure or merely exist as non-uniform aggregates of lipid molecules. Also contemplated are lipofectamine-nucleic acid complexes.
[00060] Liposome-mediated polynucleotide delivery and expression of foreign DNA in vitro has been very successful. Wong et al (1980) demonstrated the feasibility of liposome- mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells. Nicolau et al (1987) accomplished successful liposome-mediated gene transfer in rats after intravenous injection.
[00061] In certain embodiments of the invention, the lipid may be associated with a hemaglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989). In other embodiments, the lipid may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-I) (Kato et al, 1991). In yet further embodiments, the lipid may be complexed or employed in conjunction with both HVJ and HMG-I. In that such expression vectors have been successfully employed in transfer of a polynucleotide in vitro and in vivo, then they are applicable for the present invention.
1. Neutral Liposomes
[00062] "Neutral liposomes or lipid composition" or "non-charged liposomes or lipid composition," as used herein, are defined as liposomes or lipid compositions having one or more lipids that yield an essentially-neutral, net charge (substantially non-charged). By "essentially neutral" or "essentially non-charged", it is meant that few, if any, lipids within a given population {e.g., a population of liposomes) include a charge that is not canceled by an opposite charge of another component {e.g., fewer than 10% of components include a non- canceled charge, more preferably fewer than 5%, and most preferably fewer than 1%). In certain embodiments of the present invention, a composition may be prepared wherein the lipid component of the composition is essentially neutral but is not in the form of liposomes.
[00063] In certain embodiments, neutral liposomes or lipid compositions may include mostly lipids and/or phospholipids that are themselves neutral. In certain embodiments, amphipathic lipids may be incorporated into or used to generate neutral liposomes or lipid compositions. For example, a neutral liposome may be generated by combining positively and negatively charged lipids so that those charges substantially cancel one another. For such a liposome, few, if any, charged lipids are present whose charge is not canceled by an oppositely-charged lipid {e.g., fewer than 10% of charged lipids have a charge that is not canceled, more preferably fewer than 5%, and most preferably fewer than 1%). It is also recognized that the above approach may be used to generate a neutral lipid composition wherein the lipid component of the composition is not in the form of liposomes.
[00064] In certain embodiments, a neutral liposome may be used to deliver a siRNA. The neutral liposome may contain a siRNA directed to the suppression of translation of a single gene, or the neutral liposome may contain multiple siRNA that are directed to the suppression of translation of multiple genes. Further, the neutral liposome may also contain a chemotherapeutic in addition to the siRNA; thus, in certain embodiments, chemotherapeutic and a siRNA may be delivered to a cell (e.g., a cancerous cell in a human subject) in the same or separate compositions. An advantage to using neutral liposomes is that, in contrast to the toxicity that has been observed in response to cationic liposomes, little to no toxicity has yet been observed as a result of neutral liposomes.
2. Phospholipids
[00065] Lipid compositions of the present invention may comprise phospholipids. In certain embodiments, a single kind or type of phospholipid may be used in the creation of lipid compositions such as liposomes (e.g., DOPC used to generate neutral liposomes). In other embodiments, more than one kind or type of phospholipid may be used.
[00066] Phospholipids include glycerophospholipids and certain sphingolipids. Phospholipids include, but are not limited to, dioleoylphosphatidylycholine ("DOPC"), egg phosphatidylcholine ("EPC"), dilauryloylphosphatidylcholine ("DLPC"), dimyristoylphosphatidylcholine ("DMPC"), dipalmitoylphosphatidylcholine ("DPPC"), distearoylphosphatidylcholine ("DSPC"), l-myristoyl-2-palmitoyl phosphatidylcholine ("MPPC"), l-palmitoyl-2-myristoyl phosphatidylcholine ("PMPC"), l-palmitoyl-2-stearoyl phosphatidylcholine ("PSPC"), 1 -stearoyl-2-palmitoyl phosphatidylcholine ("SPPC"), dilauryloylphosphatidylglycerol ("DLPG"), dimyristoylphosphatidylglycerol ("DMPG"), dipalmitoylphosphatidylglycerol ("DPPG"), distearoylphosphatidylglycerol ("DSPG"), distearoyl sphingomyelin ("DSSP"), distearoylphophatidylethanolamine ("DSPE"), dioleoylphosphatidylglycerol ("DOPG"), dimyristoyl phosphatidic acid ("DMPA"), dipalmitoyl phosphatidic acid ("DPPA"), dimyristoyl phosphatidylethanolamine ("DMPE"), dipalmitoyl phosphatidylethanolamine ("DPPE"), dimyristoyl phosphatidylserine ("DMPS"), dipalmitoyl phosphatidylserine ("DPPS"), brain phosphatidylserine ("BPS"), brain sphingomyelin ("BSP"), dipalmitoyl sphingomyelin ("DPSP"), dimyristyl phosphatidylcholine ("DMPC"), l^-distearoyl-sn-glycero-S-phosphocholine ("DAPC"), 1,2- diarachidoyl-sn-glycero-3-phosphocholine ("DBPC"), 1 ,2-dieicosenoyl-sn-glycero-3- phosphocholine ("DEPC"), dioleoylphosphatidylethanolamine ("DOPE"), palmitoyloeoyl phosphatidylcholine ("POPC"), palmitoyloeoyl phosphatidylethanolamine ("POPE"), lysophosphatidylcholine, lysophosphatidylethanolamine, and dilinoleoylphosphatidylcholine.
[00067] Phospholipids include, for example, phosphatidylcholines, phosphatidylglycerols, and phosphatidylethanolamines; because phosphatidylethanolamines and phosphatidyl cholines are non-charged under physiological conditions (i.e., at about pH 7), these compounds may be particularly useful for generating neutral liposomes. In certain embodiments, the phospholipid DOPC is used to produce non-charged liposomes or lipid compositions. In certain embodiments, a lipid that is not a phospholipid (e.g., a cholesterol) can also be used
[00068] Phospholipids may be from natural or synthetic sources. However, phospholipids from natural sources, such as egg or soybean phosphatidylcholine, brain phosphatidic acid, brain or plant phosphatidylinositol, heart cardiolipin and plant or bacterial phosphatidylethanolamine are not used in certain embodiments as the primary phosphatide (i.e., constituting 50% or more of the total phosphatide composition) because this may result in instability and leakiness of the resulting liposomes.
3. Production of Liposomes [00069] Liposomes and lipid compositions of the present invention can be made by different methods. For example, a nucleotide (e.g., siRNA) may be encapsulated in a neutral liposome using a method involving ethanol and calcium (Bailey and Sullivan, 2000). The size of the liposomes varies depending on the method of synthesis. A liposome suspended in an aqueous solution is generally in the shape of a spherical vesicle, and may have one or more concentric layers of lipid bilayer molecules. Each layer consists of a parallel array of molecules represented by the formula XY, wherein X is a hydrophilic moiety and Y is a hydrophobic moiety. In aqueous suspension, the concentric layers are arranged such that the hydrophilic moieties tend to remain in contact with an aqueous phase and the hydrophobic regions tend to self-associate. For example, when aqueous phases are present both within and without the liposome, the lipid molecules may form a bilayer, known as a lamella, of the arrangement XY-YX. Aggregates of lipids may form when the hydrophilic and hydrophobic parts of more than one lipid molecule become associated with each other. The size and shape of these aggregates will depend upon many different variables, such as the nature of the solvent and the presence of other compounds in the solution.
[00070] Lipids suitable for use according to the present invention can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine ("DMPC") can be obtained from Sigma Chemical Co., dicetyl phosphate ("DCP") can be obtained from K & K
Laboratories (Plainview, N. Y.); cholesterol ("Choi") can be obtained from Calbiochem-
Behring; dimyristyl phosphatidylglycerol ("DMPG") and other lipids may be obtained from
Avanti Polar Lipids, Inc. (Birmingham, Ala.). Stock solutions of lipids in chloroform or chloroforrn/methanol can be stored at about -20°C. Chloroform may be used as the only solvent since it is more readily evaporated than methanol.
[00071] Liposomes within the scope of the present invention can be prepared in accordance with known laboratory techniques. In certain embodiments, liposomes are prepared by mixing liposomal lipids, in a solvent in a container (e.g., a glass, pear-shaped flask). The container will typically have a volume ten-times greater than the volume of the expected suspension of liposomes. Using a rotary evaporator, the solvent may be removed at approximately 4O0C under negative pressure. The solvent may be removed within about 5 minutes to 2 hours, depending on the desired volume of the liposomes. The composition can be dried further in a desiccator under vacuum. Dried lipids can be hydrated at approximately 25-50 mM phospholipid in sterile, pyrogen-free water by shaking until all the lipid film is resuspended. The aqueous liposomes can be then separated into aliquots, each placed in a vial, lyophilized and sealed under vacuum.
[00072] Liposomes can also be prepared in accordance with other known laboratory procedures: the method of Bangham et al. (1965), the contents of which are incorporated herein by reference; the method of Gregoriadis, as described in DRUG CARRIERS IN BIOLOGY AND MEDICINE (1979), the contents of which are incorporated herein by reference; the method of Deamer and Uster (1983), the contents of which are incorporated by reference; and the reverse-phase evaporation method as described by Szoka and Papahadjopoulos (1978). The aforementioned methods differ in their respective abilities to entrap aqueous material and their respective aqueous space-to-lipid ratios. [00073] Dried lipids or lyophilized liposomes may be dehydrated and reconstituted in a solution of inhibitory peptide and diluted to an appropriate concentration with a suitable solvent (e.g., DPBS). The mixture may then be vigorously shaken in a vortex mixer. Unencapsulated nucleic acid may be removed by centrifugation at 29,00Og and the liposomal pellets washed. The washed liposomes may be resuspended at an appropriate total phospholipid concentration (e.g., about 50-200 mM). The amount of nucleic acid encapsulated can be determined in accordance with standard methods. After determination of the amount of nucleic acid encapsulated in the liposome preparation, the liposomes may be diluted to appropriate concentrations and stored at 4°C until use.
C. Inhibition of Gene Expression
[00074] siNA (e.g., siRNA) are well known in the art. For example, siRNA and double- stranded RNA have been described in U.S. Patents 6,506,559 and 6,573,099, as well as in U.S. Patent Applications 2003/0051263, 2003/0055020, 2004/0265839, 2002/0168707, 2003/0159161, and 2004/0064842, all of which are herein incorporated by reference in their entirety.
[00075] Within a siNA, the components of a nucleic acid need not be of the same type or homogenous throughout (e.g., a siNA may comprise a nucleotide and a nucleic acid or nucleotide analog). Typically, siNA form a double-stranded structure; the double-stranded structure may result from two separate nucleic acids that are partially or completely complementary. In certain embodiments of the present invention, the siNA may comprise only a single nucleic acid (polynucleotide) or nucleic acid analog and form a double-stranded structure by complementing with itself (e.g., forming a hairpin loop). The double-stranded structure of the siNA may comprise 16, 20, 25, 30, 35, 40, 45, 50, 60, 65, 70, 75, 80, 85, 90 to 100, 150, 200, 250, 300, 350, 400, 450, 500 or more contiguous nucleobases, including all ranges therebetween. The siNA may comprise 17 to 35 contiguous nucleobases, more preferably 18 to 30 contiguous nucleobases, more preferably 19 to 25 nucleobases, more preferably 20 to 23 contiguous nucleobases, or 20 to 22 contiguous nucleobases, or 21 contiguous nucleobases that hybridize with a complementary nucleic acid (which may be another part of the same nucleic acid or a separate complementary nucleic acid) to form a double-stranded structure.
[00076] Agents of the present invention useful for practicing the methods of the present invention include, but are not limited to siRNAs. Typically, introduction of double-stranded RNA (dsRNA), which may alternatively be referred to herein as small interfering RNA (siRNA), induces potent and specific gene silencing, a phenomena called RNA interference or RNAi. This phenomenon has been extensively documented in the nematode C. elegans (Fire et al, 1998), but is widespread in other organisms, ranging from trypanosomes to mouse. Depending on the organism being discussed, RNA interference has been referred to as "cosuppression," "post-transcriptional gene silencing," "sense suppression," and "quelling." RNAi is an attractive biotechnological tool because it provides a means for knocking out the activity of specific genes.
[00077] In designing RNAi there are several factors that need to be considered such as the nature of the siRNA, the durability of the silencing effect, and the choice of delivery system. To produce an RNAi effect, the siRNA that is introduced into the organism will typically contain exonic sequences. Furthermore, the RNAi process is homology dependent, so the sequences must be carefully selected so as to maximize gene specificity, while minimizing the possibility of cross-interference between homologous, but not gene-specific sequences. Preferably the siRNA exhibits greater than 80, 85, 90, 95, 98,% or even 100% identity between the sequence of the siRNA and the gene to be inhibited. Sequences less than about 80% identical to the target gene are substantially less effective. Thus, the greater homology between the siRNA and the STAT gene to be inhibited, the less likely expression of unrelated genes will be affected.
[00078] In addition, the size of the siRNA is an important consideration. In some embodiments, the present invention relates to siRNA molecules that include at least about 19-25 nucleotides, and are able to modulate the STAT gene expression. In the context of the present invention, the siRNA is preferably less than 500, 200, 100, 50 or 25 nucleotides in length. More preferably, the siRNA is from about 19 nucleotides to about 25 nucleotides in length.
[00079] siRNA can be obtained from commercial sources, natural sources, or can be synthesized using any of a number of techniques well-known to those of ordinary skill in the art. For example, one commercial source of predesigned siRNA is Ambion®, Austin, TX. Another is Qiagen® (Valencia, CA). An inhibitory nucleic acid that can be applied in the compositions and methods of the present invention may be any nucleic acid sequence that has been found by any source to be a validated downregulator of a STAT protein. For example, in a particular embodiment, the inhibitory nucleic acid is Qiagen® (Valencia, CA) validated siRNA product Catalog Number SIO2662338.
[00080] In one aspect, the invention generally features an isolated siRNA molecule of at least 19 nucleotides, having at least one strand that is substantially complementary to at least ten but no more than thirty consecutive nucleotides of a nucleic acid that encodes a STAT protein, and that reduces the expression of the STAT protein. In a particular embodiment of the present invention, the siRNA molecule has at least one strand that is substantially complementary to at least ten but no more than thirty consecutive nucleotides of the mRNA that encodes STAT3.
[00081] In another particular embodiment, the siRNA molecule is at least 75, 80, 85, or 90% homologous, preferably 95%, 99%, or 100% homologous, to at least 10 contiguous nucleotides of any of the nucleic acid sequences encoding a full-length STAT protein, such as those in Table 1. Without undue experimentation and using the disclosure of this invention, it is understood that additional siRNAs can be designed and used to practice the methods of the invention.
[00082] The siRNA may also comprise an alteration of one or more nucleotides. Such alterations can include the addition of non-nucleotide material, such as to the end(s) of the 19 to 25 nucleotide RNA or internally (at one or more nucleotides of the RNA). In certain aspects, the RNA molecule contains a 3'-hydroxyl group. Nucleotides in the RNA molecules of the present invention can also comprise non-standard nucleotides, including non-naturally occurring nucleotides or deoxyribonucleotides. The double-stranded oligonucleotide may contain a modified backbone, for example, phosphorothioate, phosphorodithioate, or other modified backbones known in the art, or may contain non-natural internucleoside linkages. Additional modifications of siRNAs (e.g., 2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, "universal base" nucleotides, 5-C-methyl nucleotides, one or more phosphorothioate internucleotide linkages, and inverted deoxyabasic residue incorporation) can be found in U.S. Application Publication 20040019001 and U.S. Patent 6,673,611 (each of which is incorporated by referencein its entirety). Collectively, all such altered nucleic acids or RNAs described above are referred to as modified siRNAs.
[00083] Preferably, RNAi is capable of decreasing the expression of a STAT protein, such as STAT3, by at least 10%, 20%, 30%, or 40%, more preferably by at least 50%, 60%, or 70%, and most preferably by at least 75%, 80%, 90%, 95% or more.
[00084] Certain embodiments of the present invention pertain to methods of inhibiting expression of a gene encoding a STAT protein in a cell. In a specific embodient, the STAT protein is STAT3. Introduction of siRNA into cells can be achieved by methods known in the art, including for example, microinjection, electroporation, or transfection of a vector comprising a nucleic acid from which the siRNA can be transcribed. Alternatively, a siRNA can be directly introduced into a cell in a form that is capable of binding to target mRNA transcripts. To increase durability and membrane-permeability the siRNA may be combined or modified with liposomes, poly-L-lysine, lipids, cholesterol, lipofectine or derivatives thereof. In certain aspects cholesterol-conjugated siRNA can be used (see, Song et al, 2003).
D. Nucleic Acids
[00085] The present invention provides methods and compositions for the delivery of siNA via neutral liposomes. Because a siNA is composed of a nucleic acid, methods relating to nucleic acids (e.g., production of a nucleic acid, modification of a nucleic acid, etc.) may also be used with regard to a siNA.
[00086] The term "nucleic acid" is well known in the art. A "nucleic acid" as used herein will generally refer to a molecule (i.e., a strand) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine "A," a guanine "G," a thymine "T" or a cytosine "C") or RNA (e.g., an A, a G, an uracil "U" or a C). The term "nucleic acid" encompass the terms "oligonucleotide" and "polynucleotide," each as a subgenus of the term "nucleic acid." The term "oligonucleotide" refers to a molecule of between 3 and about 100 nucleobases in length. The term "polynucleotide" refers to at least one molecule of greater than about 100 nucleobases in length. [00087] These definitions refer to a single-stranded or double-stranded nucleic acid molecule. Double stranded nucleic acids are formed by fully complementary binding, although in some embodiments a double stranded nucleic acid may formed by partial or substantial complementary binding. Thus, a nucleic acid may encompass a double-stranded molecule that comprises one or more complementary strand(s) or "complement(s)" of a particular sequence, typically comprising a molecule. As used herein, a single stranded nucleic acid may be denoted by the prefix "ss" and a double stranded nucleic acid by the prefix "ds".
[00088] Examples of antisense oligonucleotides targeted to nucleic acids encoding STAT3 can be found in U.S. Patent Application Pub. No. 20010029250, herein specifically incorporated by reference. Particular examples include SEQ ID NOs: 11 -90. 1. Nucleobases
[00089] As used herein a "nucleobase" refers to a heterocyclic base, such as for example a naturally occurring nucleobase (i.e., an A, T, G, C or U) found in at least one naturally occurring nucleic acid (i.e., DNA and RNA), and naturally or non-naturally occurring derivative(s) and analogs of such a nucleobase. A nucleobase generally can form one or more hydrogen bonds ("anneal" or "hybridize") with at least one naturally occurring nucleobase in manner that may substitute for naturally occurring nucleobase pairing (e.g., the hydrogen bonding between A and T, G and C, and A and U).
[00090] "Purine" and/or "pyrimidine" nucleobase(s) encompass naturally occurring purine and/or pyrimidine nucleobases and also derivative(s) and analog(s) thereof, including but not limited to, those a purine or pyrimidine substituted by one or more of an alkyl, caboxyalkyl, amino, hydroxyl, halogen (i.e., fluoro, chloro, bromo, or iodo), thiol or alkylthiol moeity.
Preferred alkyl (e.g., alkyl, caboxyalkyl, etc.) moeities comprise of from about 1, about 2, about 3, about 4, about 5, to about 6 carbon atoms. A nucleobase may be comprised in a nucleside or nucleotide, using any chemical or natural synthesis method described herein or known to one of ordinary skill in the art.
2. Nucleosides
[0009I]As used herein, a "nucleoside" refers to an individual chemical unit comprising a nucleobase covalently attached to a nucleobase linker moiety. A non-limiting example of a "nucleobase linker moiety" is a sugar comprising 5-carbon atoms (i.e., a "5-carbon sugar"), including but not limited to a deoxyribose, a ribose, an arabinose, or a derivative or an analog of a 5-carbon sugar. Non-limiting examples of a derivative or an analog of a 5-carbon sugar include a 2'-fluoro-2'-deoxyribose or a carbocyclic sugar where a carbon is substituted for an oxygen atom in the sugar ring. [00092]Different types of covalent attachment(s) of a nucleobase to a nucleobase linker moiety are known in the art. By way of non-limiting example, a nucleoside comprising a purine (i.e., A or G) or a 7-deazapurine nucleobase typically covalently attaches the 9 position of a purine or a 7-deazapurine to the 1 '-position of a 5-carbon sugar. In another non- limiting example, a nucleoside comprising a pyrimidine nucleobase (i.e., C, T or U) typically covalently attaches a 1 position of a pyrimidine to a l'-position of a 5-carbon sugar (Kornberg and Baker, 1992). 3. Nucleotides
[00093] As used herein, a "nucleotide" refers to a nucleoside further comprising a "backbone moiety". A backbone moiety generally covalently attaches a nucleotide to another molecule comprising a nucleotide, or to another nucleotide to form a nucleic acid. The "backbone moiety" in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5 -carbon sugar. The attachment of the backbone moiety typically occurs at either the 3'- or 5'-position of the 5-carbon sugar. However, other types of attachments are known in the art, particularly when a nucleotide comprises derivatives or analogs of a naturally occurring 5-carbon sugar or phosphorus moiety. 4. Nucleic Acid Analogs
[00094] A nucleic acid may comprise, or be composed entirely of, a derivative or analog of a nucleobase, a nucleobase linker moiety and/or backbone moiety that may be present in a naturally occurring nucleic acid. As used herein a "derivative" refers to a chemically modified or altered form of a naturally occurring molecule, while the terms "mimic" or "analog" refer to a molecule that may or may not structurally resemble a naturally occurring molecule or moiety, but possesses similar functions. As used herein, a "moiety" generally refers to a smaller chemical or molecular component of a larger chemical or molecular structure. Nucleobase, nucleoside and nucleotide analogs or derivatives are well known in the art, and have been described (see for example, Scheit, 1980, incorporated herein by reference).
[00095] Additional non-limiting examples of nucleosides, nucleotides, or nucleic acids comprising 5-carbon sugar and/or backbone moiety derivatives or analogs, include those in U.S. Patent 5,681,947 which describes oligonucleotides comprising purine derivatives that form triple helixes with and/or prevent expression of dsDNA; U.S. Patents 5,652,099 and 5,763,167 which describe nucleic acids incorporating fluorescent analogs of nucleosides found in DNA or RNA, particularly for use as flourescent nucleic acids probes; U.S. Patent 5,614,617 which describes oligonucleotide analogs with substitutions on pyrimidine rings that possess enhanced nuclease stability; U.S. Patents 5,670,663, 5,872,232 and 5,859,221 which describe oligonucleotide analogs with modified 5-carbon sugars (i.e., modified T- deoxyfuranosyl moieties) used in nucleic acid detection; U.S. Patent 5,446,137 which describes oligonucleotides comprising at least one 5-carbon sugar moiety substituted at the 4' position with a substituent other than hydrogen that can be used in hybridization assays; U.S. Patent 5,886,165 which describes oligonucleotides with both deoxyribonucleotides with 3'-5' intemucleotide linkages and ribonucleotides with 2'-5' internucleotide linkages; U.S. Patent 5,714,606 which describes a modified internucleotide linkage wherein a 3 '-position oxygen of the internucleotide linkage is replaced by a carbon to enhance the nuclease resistance of nucleic acids; U.S. Patent 5,672,697 which describes oligonucleotides containing one or more 5' methylene phosphonate internucleotide linkages that enhance nuclease resistance; U.S. Patents 5,466,786 and 5,792,847 which describe the linkage of a substituent moeity which may comprise a drug or label to the 2' carbon of an oligonucleotide to provide enhanced nuclease stability and ability to deliver drugs or detection moieties; U.S. Patent 5,223,618 which describes oligonucleotide analogs with a 2 or 3 carbon backbone linkage attaching the 4' position and 3' position of adjacent 5-carbon sugar moiety to enhanced cellular uptake, resistance to nucleases and hybridization to target RNA; U.S. Patent 5,470,967 which describes oligonucleotides comprising at least one sulfamate or sulfamide internucleotide linkage that are useful as nucleic acid hybridization probe; U.S. Patents 5,378,825, 5,777,092, 5,623,070, 5,610,289 and 5,602,240 which describe oligonucleotides with three or four atom linker moeity replacing phosphodiester backbone moeity used for improved nuclease resistance, cellular uptake and regulating RNA expression; U.S. Patent 5,858,988 which describes hydrophobic carrier agent attached to the 2'-0 position of oligonuceotides to enhanced their membrane permeability and stability; U.S. Patent 5,214,136 which describes olignucleotides conjugated to anthraquinone at the 5' terminus that possess enhanced hybridization to DNA or RNA; enhanced stability to nucleases; U.S. Patent 5,700,922 which describes PNA-DNA-PNA chimeras wherein the DNA comprises 2'-deoxy-erythro- pentofuranosyl nucleotides for enhanced nuclease resistance, binding affinity, and ability to activate RNase H; and U.S. Patent 5,708,154 which describes RNA linked to a DNA to form a DNA-RNA hybrid.
5. Polyether and Peptide Nucleic Acids
[00096] In certain embodiments, it is contemplated that a nucleic acid comprising a derivative or analog of a nucleoside or nucleotide may be used in the methods and compositions of the invention. A non-limiting example is a "polyether nucleic acid", described in U.S. Patent 5,908,845, incorporated herein by reference. In a polyether nucleic acid, one or more nucleobases are linked to chiral carbon atoms in a polyether backbone.
[00097] Another non-limiting example is a "peptide nucleic acid", also known as a "PNA", "peptide-based nucleic acid analog" or "PENAM", described in U.S. Patent 5,786,461, 5891,625, 5,773,571, 5,766,855, 5,736,336, 5,719,262, 5,714,331, 5,539,082, and WO 92/20702, each of which is incorporated herein by reference. Peptide nucleic acids generally have enhanced sequence specificity, binding properties, and resistance to enzymatic degradation in comparison to molecules such as DNA and RNA (Egholm et al, 1993; PCT/EP/01219). A peptide nucleic acid generally comprises one or more nucleotides or nucleosides that comprise a nucleobase moiety, a nucleobase linker moeity that is not a 5- carbon sugar, and/or a backbone moiety that is not a phosphate backbone moiety. Examples of nucleobase linker moieties described for PNAs include aza nitrogen atoms, amido and/or ureido tethers (see for example, U.S. Patent 5,539,082). Examples of backbone moieties described for PNAs include an aminoethylglycine, polyamide, polyethyl, polythioamide, polysulfϊnamide or polysulfonamide backbone moiety.
[00098] In certain embodiments, a nucleic acid analogue such as a peptide nucleic acid may be used to inhibit nucleic acid amplification, such as in PCR™, to reduce false positives and discriminate between single base mutants, as described in U.S. Patent 5,891,625. Other modifications and uses of nucleic acid analogs are known in the art, and it is anticipated that these techniques and types of nucleic acid analogs may be used with the present invention. In a non-limiting example, U.S. Patent 5,786,461 describes PNAs with amino acid side chains attached to the PNA backbone to enhance solubility of the molecule. In another example, the cellular uptake property of PNAs is increased by attachment of a lipophilic group. U.S. Application Ser. No. 117,363 describes several alkylamino moeities used to enhance cellular uptake of a PNA. Another example is described in U.S. Patents 5,766,855, 5,719,262, 5,714,331 and 5,736,336, which describe PNAs comprising naturally and non-naturally occurring nucleobases and alkylamine side chains that provide improvements in sequence specificity, solubility and/or binding affinity relative to a naturally occurring nucleic acid. 6. Preparation of Nucleic Acids
[00099] A nucleic acid may be made by any technique known to one of ordinary skill in the art, such as chemical synthesis, enzymatic production or biological production. Non-limiting examples of a synthetic nucleic acid {e.g., a synthetic oligonucleotide), include a nucleic acid made by in vitro chemically synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al, 1986 and U.S. Patent 5,705,629, each incorporated herein by reference. In the methods of the present invention, one or more oligonucleotide may be used. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Patents 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.
[000100] A non-limiting example of an enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCR™ (see for example, U.S. Patent
4,683,202 and U.S. Patent 4,682,195, each incorporated herein by reference), or the synthesis of an oligonucleotide described in U.S. Patent 5,645,897, incorporated herein by reference.
A non-limiting example of a biologically produced nucleic acid includes a recombinant nucleic acid produced (i.e., replicated) in a living cell, such as a recombinant DNA vector replicated in bacteria (see for example, Sambrook et al. 2001, incorporated herein by reference).
7. Purification of Nucleic Acids
[000101] A nucleic acid may be purified on polyacrylamide gels, cesium chloride centrifugation gradients, or by any other means known to one of ordinary skill in the art (see for example, Sambrook et al, 2001, incorporated herein by reference).
[000102] In certain embodiments, the present invention concerns a nucleic acid that is an isolated nucleic acid. As used herein, the term "isolated nucleic acid" refers to a nucleic acid molecule (e.g., an RNA or DNA molecule) that has been isolated free of, or is otherwise free of, the bulk of the total genomic and transcribed nucleic acids of one or more cells. In certain embodiments, "isolated nucleic acid" refers to a nucleic acid that has been isolated free of, or is otherwise free of, bulk of cellular components or in vitro reaction components such as for example, macromolecules such as lipids or proteins, small biological molecules, and the like.
8. Hybridization
[000103] As used herein, "hybridization", "hybridizes" or "capable of hybridizing" is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature. The term "anneal" as used herein is synonymous with "hybridize." The term "hybridization", "hybridize(s)" or "capable of hybridizing" encompasses the terms "stringent condition(s)" or "high stringency" and the terms "low stringency" or "low stringency condition(s)." [000104] As used herein "stringent condition(s)" or "high stringency" are those conditions that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but precludes hybridization of random sequences. Stringent conditions tolerate little, if any, mismatch between a nucleic acid and a target strand. Such conditions are well known to those of ordinary skill in the art, and are preferred for applications requiring high selectivity. Non-limiting applications include isolating a nucleic acid, such as a gene or a nucleic acid segment thereof, or detecting at least one specific mRNA transcript or a nucleic acid segment thereof, and the like.
[000105] Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 500C to about 70°C. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content of the target sequence(s), the charge composition of the nucleic acid(s), and to the presence or concentration of formamide, tetramethylammonium chloride or other solvent(s) in a hybridization mixture.
[000106] It is also understood that these ranges, compositions and conditions for hybridization are mentioned by way of non-limiting examples only, and that the desired stringency for a particular hybridization reaction is often determined empirically by comparison to one or more positive or negative controls. Depending on the application envisioned it is preferred to employ varying conditions of hybridization to achieve varying degrees of selectivity of a nucleic acid towards a target sequence. In a non-limiting example, identification or isolation of a related target nucleic acid that does not hybridize to a nucleic acid under stringent conditions may be achieved by hybridization at low temperature and/or high ionic strength. Such conditions are termed "low stringency" or "low stringency conditions", and non-limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCl at a temperature range of about 200C to about 500C. Of course, it is within the skill of one in the art to further modify the low or high stringency conditions to suite a particular application.
E. Treatment of Disease
1. Definitions
[000107] "Treatment" and "treating" refer to administration or application of a therapeutic agent to a subject or performance of a procedure or modality on a subject for the purpose of obtaining a therapeutic benefit of a disease or health-related condition. For example, a treatment may include administration of a pharmaceutically effective amount of a nucleic acid that inhibits the expression of a gene that encodes a STAT and a neutral lipid for the purposes of minimizing the growth or invasion of a tumor.
[000108] A "subject" refers to either a human or non-human, such as primates, mammals, and vertebrates. In particular embodiments, the subject is a human. [000109] The term "therapeutic benefit" or "therapeutically effective" as used throughout this application refers to anything that promotes or enhances the well-being of the subject with respect to the medical treatment of this condition. This includes, but is not limited to, a reduction in the frequency or severity of the signs or symptoms of a disease. For example, treatment of cancer may involve, for example, a reduction in the size of a tumor, a reduction in the invasiveness of a tumor, reduction in the growth rate of the cancer, or prevention of metastasis.
[000110] A "disease" or "health-related condition" can be any pathological condition of a body part, an organ, or a system resulting from any cause, such as infection, genetic defect, and/or environmental stress. The cause may or may not be known. . [000111] In some embodiments of the invention, the methods include identifying a patient in need of treatment. A patient may be identified, for example, based on taking a patient history, based on findings on clinical examination, based on health screenings, or by self- referral.
2. Diseases [000112] The present invention may be used to treat any disease associated with increased expression of a STAT protein. For example, the disease may be a hyperproliferative disease, such as cancer.
[000113] For example, a siRNA that binds to a nucleic acid that encodes a STAT3 protein may be administered to treat a cancer. The cancer may be a solid tumor, metastatic cancer, or non-metastatic cancer. In certain embodiments, the cancer may originate in the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. In certain embodiments, the cancer is human ovarian cancer. In addition, the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; paget's disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; androblastoma, malignant; Sertoli cell carcinoma; leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangio sarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; kaposi's sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; hodgkin's disease; hodgkin's; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia. Nonetheless, it is also recognized that the present invention may also be used to treat a non-cancerous disease (e.g., a fungal infection, a bacterial infection, a viral infection, and/or a neurodegenerative disease).
[000114] In a specific embodiment, the cancer is ovarian cancer. For xample, the ovarian cancer may be an epithelial tumor (e.g., serous, endometrioid, mucinous, and clear cell tumors), a germ cell tumor, a sex cord-stormal cell tumor, a Brenner tumor, an undifferentiated tumor, or a transitional cell tumor. The term "ovarian cancer" also includes tumors that are adjacent to ovarian tissue, such as extraovarian peritoneal carcinoma (intraperitoneal carcinomatosis). The ovarian tumor may be benign, malignant, or pre- malignant. [000115] The disease may also be an inflammatory disease. Non-limiting examples of inflammatory diseases include infectious diseases, arthritis, and collagen-vascular diseases. In a specific embodiment, the disease is rheumatoid arthritis.
F. Pharmaceutical Preparations
[000116] Where clinical application of a lipid composition containing a siNA is undertaken, it will generally be beneficial to prepare the lipid complex as a pharmaceutical composition appropriate for the intended application. This will typically entail preparing a pharmaceutical composition that is essentially free of pyrogens, as well as any other impurities that could be harmful to humans or animals. One may also employ appropriate buffers to render the complex stable and allow for uptake by target cells. [000117] The phrases "pharmaceutical or pharmacologically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as a human, as appropriate. The preparation of a pharmaceutical composition that contains at least one non-charged lipid component comprising a siNA or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington: The Science and Practice of Pharmacy, 21st, 2005, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.
[000118] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art. A pharmaceutically acceptable carrier is preferably formulated for administration to a human, although in certain embodiments it may be desirable to use a pharmaceutically acceptable carrier that is formulated for administration to a non-human animal but which would not be acceptable (e.g., due to governmental regulations) for administration to a human. Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.
[000119] The actual dosage amount of a composition of the present invention administered to a patient or subject can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject. [000120] In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound. In other embodiments, the an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. In other non-limiting examples, a dose may also comprise from about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 μg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered.
[000121] A gene expression inhibitor may be administered in a dose of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 or more μg of nucleic acid per dose. Each dose may be in a volume of 1, 10, 50, 100, 200, 500, 1000 or more μl or ml.
[000122] Solutions of therapeutic compositions can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions also can be prepared in glycerol, liquid polyethylene glycols, mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
[000123] The therapeutic compositions of the present invention are advantageously administered in the form of injectable compositions either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. These preparations also may be emulsified. A typical composition for such purpose comprises a pharmaceutically acceptable carrier. For instance, the composition may contain 10 mg, 25 mg, 50 mg or up to about 100 mg of human serum albumin per milliliter of phosphate buffered saline. Other pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like.
[000124] Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oil and injectable organic esters such as ethyloleate. Aqueous carriers include water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc. Intravenous vehicles include fluid and nutrient replenishers.
Preservatives include antimicrobial agents, anti-oxidants, chelating agents and inert gases.
The pH and exact concentration of the various components the pharmaceutical composition are adjusted according to well known parameters.
[000125] Additional formulations are suitable for oral administration. Oral formulations include such typical excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. The compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders.
[000126] The therapeutic compositions of the present invention may include classic pharmaceutical preparations. Administration of therapeutic compositions according to the present invention will be via any common route so long as the target tissue is available via that route. This includes oral, nasal, buccal, rectal, vaginal or topical. Topical administration may be particularly advantageous for the treatment of skin cancers, to prevent chemotherapy- induced alopecia or other dermal hyperproliferative disorder. Alternatively, administration may be by orthotopic, intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection. Such compositions would normally be administered as pharmaceutically acceptable compositions that include physiologically acceptable carriers, buffers or other excipients. For treatment of conditions of the lungs, or respiratory tract, aerosol delivery can be used. Volume of the aerosol is between about 0.01 ml and 0.5 ml. [000127] An effective amount of the therapeutic composition is determined based on the intended goal. The term "unit dose" or "dosage" refers to physically discrete units suitable for use in a subject, each unit containing a predetermined-quantity of the therapeutic composition calculated to produce the desired responses discussed above in association with its administration, i.e., the appropriate route and treatment regimen. The quantity to be administered, both according to number of treatments and unit dose, depends on the protection or effect desired.
[000128] Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting the dose include the physical and clinical state of the patient, the route of administration, the intended goal of treatment (e.g., alleviation of symptoms versus cure) and the potency, stability and toxicity of the particular therapeutic substance.
G. Combination Treatments
[000129] In certain embodiments, the compositions and methods of the present invention involve an inhibitor of expression of a STAT protein, or construct capable of expressing an inhibitor of STAT expression, in combination with a second or additional therapy. Such therapy can be applied in the treatment of any disease that is associated with increased expression or activity of a STAT protein. For example, the disease may be an inflammatory disease or a hyperproliferative disease, such as cancer. Non-limiting examples of inflammatory diseases contemplated by the present invention include rheumatoid arthritis and infectious disease.
[000130] The methods and compositions including combination therapies enhance the therapeutic or protective effect, and/or increase the therapeutic effect of another anti-cancer or anti-hyperproliferative therapy. Therapeutic and prophylactic methods and compositions can be provided in a combined amount effective to achieve the desired effect, such as the killing of a cancer cell and/or the inhibition of cellular hyperproliferation. This process may involve contacting the cells with both an inhibitor of gene expression and a second therapy. A tissue, tumor, or cell can be contacted with one or more compositions or pharmacological formulation(s) including one or more of the agents (i.e., inhibitor of gene expression or an anti-cancer agent), or by contacting the tissue, tumor, and/or cell with two or more distinct compositions or formulations, wherein one composition provides 1) an inhibitor of gene expression; 2) an anti-cancer agent, or 3) both an inhibitor of gene expression and an anti- cancer agent. Also, it is contemplated that such a combination therapy can be used in conjunction with a chemotherapy, radiotherapy, surgical therapy, or immunotherapy.
[000131] An inhibitor of gene expression may be administered before, during, after or in various combinations relative to an anti-cancer treatment. The administrations may be in intervals ranging from concurrently to minutes to days to weeks. In embodiments where the inhibitor of gene expression is provided to a patient separately from an anti-cancer agent, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the two compounds would still be able to exert an advantageously combined effect on the patient. In such instances, it is contemplated that one may provide a patient with the inhibitor of gene expression therapy and the anti-cancer therapy within about 12 to 24 or 72 h of each other and, more preferably, within about 6-12 h of each other. In some situations it may be desirable to extend the time period for treatment significantly where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between respective administrations.
[000132] In certain embodiments, a course of treatment will last 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 days or more. It is contemplated that one agent may be given on day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, any combination thereof, and another agent is given on day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, or any combination thereof. Within a single day (24-hour period), the patient may be given one or multiple administrations of the agent(s). Moreover, after a course of treatment, it is contemplated that there is a period of time at which no anti-cancer treatment is administered. This time period may last 1, 2, 3, 4, 5, 6, 7 days, and/or 1, 2, 3, 4, 5 weeks, and/or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months or more, depending on the condition of the patient, such as their prognosis, strength, health, etc. [000133] Various combinations may be employed. For the example below an inhibitor of gene expression therapy is "A" and an anti-cancer therapy is "B":
A/B/A B/A/B B/B/A A/ AfB A/B/B B/A/A A/B/B/B B/A/B/B B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B A/A/A/B BIAJAIA A/B/A/A AJAfBIA [000134] Administration of any compound or therapy of the present invention to a patient will follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the agents. Therefore, in some embodiments there is a step of monitoring toxicity that is attributable to combination therapy. It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, as well as surgical intervention, may be applied in combination with the described therapy.
[000135] In specific aspects, it is contemplated that a standard therapy will include chemotherapy, radiotherapy, immunotherapy, surgical therapy or gene therapy and may be employed in combination with the inhibitor of gene expression therapy, anticancer therapy, or both the inhibitor of gene expression therapy and the anti-cancer therapy, as described herein. 1. Chemotherapy
[000136] A wide variety of chemotherapeutic agents may be used in accordance with the present invention. The term "chemotherapy" refers to the use of drugs to treat cancer. A
"chemotherapeutic agent" is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis. Most chemotherapeutic agents fall into the following categories: alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and nitrosoureas.
[000137] In specific embodiments, the chemotherapeutic agent is a taxane, a taxane derivative, a taxane metabolite, or a taxane prodrug. Examples of taxanes include docetaxel, paclitaxel, abraxane, 7-epipaclitaxel, t-acetyl paclitaxel, 10-desacetyl-paclitaxel, 10- desacetyl-7-epipaclitaxel, 7-xylosylpaclitaxel, lO-desacetyl-7-glutarylpaclitaxel, 7-N5N- dimethylglycylpaclitaxel, 7-L-alanylpaclitaxel, or a mixture thereof. Additional information regarding taxanes, taxane derivatives, taxane metabolites, and taxane prodrugs can be found in U.S. Patent Application Pub. Nos. 20070105944, 20070073069, 20070027207, 20060189679, 20060122258, 20050192445, 20050182098, 20050148657, 20050143447, 20050143446, 20050026996, 20050020635, 20040138267, 20040127551, 20040097579, 20030203961, each of which is herein specifically incorporated by reference, and U.S. Patent Nos. 6,906,101, 6,861,537, 6,861,446, 6,638,973, 6,630,609, 6,541,508, 6,531,611, 6,433,189, 6,362,217, 6,268,381, 6,191,290, and 6,147,234, each of which is herein specifically incorporated by reference.
[000138] Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC- 1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CBl-TMl); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammall and calicheamicin omegall; dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores, aclacinomysins, actinomycin, authrarnycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L- norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalarnycin, olivomycins, peplomycin, potfϊromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6- mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK polysaccharide complex); razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxoids, e.g., paclitaxel and doxetaxel; chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum coordination complexes such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP- 16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-I l); topoisomerase inhibitor RFS 2000; difluorometlhylornithine (DMFO); retinoids such as retinoic acid; capecitabine; cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP 16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, paclitaxel, docetaxel, gemcitabien, navelbine, farnesyl-protein tansferase inhibitors, transplatinum, 5-fluorouracil, vincristin, vinblastin and methotrexate and pharmaceutically acceptable salts, acids or derivatives of any of the above.
[000139] Also included in this definition are anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen, raloxifene, droloxifene, A- hydroxytamoxifen, trioxifene, keoxifene, LYl 17018, onapristone, and toremifene; aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, megestrol acetate, exemestane, formestanie, fadrozole, vorozole, letrozole, and anastrozole; and anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; as well as troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); antisense oligonucleotides, particularly those which inhibit expression of genes in signaling pathways implicated in abherant cell proliferation, such as, for example, PKC-alpha, RaIf and H-Ras; ribozymes such as a VEGF expression inhibitor and a HER2 expression inhibitor; vaccines such as gene therapy vaccines and pharmaceutically acceptable salts, acids or derivatives of any of the above.
2. Radiotherapy
[000140] Other factors that cause DNA damage and have been used extensively include what are commonly known as γ-rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves, proton beam irradiation (U.S. Patents 5,760,395 and 4,870,287) and UV- irradiation. It is most likely that all of these factors affect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells. [000141] The terms "contacted" and "exposed," when applied to a cell, are used herein to describe the process by which a therapeutic construct and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell. To achieve cell killing, for example, both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing.
3. Immunotherapy
[000142] In the context of cancer treatment, immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells. Trastuzumab (Herceptin™) is such an example. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually affect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells. The combination of therapeutic modalities, i.e., direct cytotoxic activity and inhibition or reduction of ErbB2 would provide therapeutic benefit in the treatment of ErbB2 overexpressing cancers.
[000143] Another immunotherapy could also be used as part of a combined therapy with gen silencing therapy discussed above. In one aspect of immunotherapy, the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells.
Many tumor markers exist and any of these may be suitable for targeting in the context of the present invention. Common tumor markers include carcinoembryonic antigen, prostate specific antigen, urinary tumor associated antigen, fetal antigen, tyrosinase (ρ97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin receptor, erb B and pi 55. An alternative aspect of immunotherapy is to combine anticancer effects with immune stimulatory effects. Immune stimulating molecules also exist including: cytokines such as IL-2, IL-4, IL- 12, GM-CSF, gamma-IFN, chemokines such as MIP-I,
MCP-I, IL-8 and growth factors such as FLT3 ligand. Combining immune stimulating molecules, either as proteins or using gene delivery in combination with a tumor suppressor has been shown to enhance anti-tumor effects (Ju et al. , 2000). Moreover, antibodies against any of these compounds can be used to target the anti-cancer agents discussed herein. [000144] Examples of immunotherapies currently under investigation or in use are immune adjuvants e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene and aromatic compounds (U.S. Patents 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al, 1998), cytokine therapy, e.g., interferons α, β and γ; IL-I, GM-CSF and TNF (Bukowski et al , 1998; Davidson et al , 1998; Hellstrand et al , 1998) gene therapy, e.g., TNF, IL-I, IL-2, p53 (Qin et al, 1998; Austin- Ward and Villaseca, 1998; U.S. Patents 5,830,880 and 5,846,945) and monoclonal antibodies, e.g., anti-ganglioside GM2, anti-HER- 2, anti-pl85 (Pietras et al, 1998; Hanibuchi et al, 1998; U.S. Patent 5,824,311). It is contemplated that one or more anti-cancer therapies may be employed with the gene silencing therapies described herein.
[000145] In active immunotherapy, an antigenic peptide, polypeptide or protein, or an autologous or allogenic tumor cell composition or "vaccine" is administered, generally with a distinct bacterial adjuvant (Ravindranath and Morton, 1991; Morton et al, 1992; Mitchell et al, 1990; Mitchell et al, 1993). [000146] In adoptive immunotherapy, the patient's circulating lymphocytes, or tumor infiltrated lymphocytes, are isolated in vitro, activated by lymphokines such as IL-2 or transduced with genes for tumor necrosis, and readministered (Rosenberg et al, 1988; 1989).
4. Surgery
[000147] Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative, and palliative surgery. Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatment of the present invention, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and/or alternative therapies.
[000148] Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs' surgery). It is further contemplated that the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue. [000149] Upon excision of part or all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well.
5. Other Agents [000150] It is contemplated that other agents may be used in combination with the present invention to improve the therapeutic efficacy of treatment. These additional agents include immunomodulatory agents, agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers, or other biological agents. Immunomodulatory agents include tumor necrosis factor; interferon alpha, beta, and gamma; IL-2 and other cytokines; F42K and other cytokine analogs; or MIP-I, MIP-I beta, MCP-I, RANTES, and other chemokines. It is further contemplated that the upregulation of cell surface receptors or their ligands such as Fas / Fas ligand, DR4 or DR5 / TRAIL (Apo-2 ligand) would potentiate the apoptotic inducing abilities of the present invention by establishment of an autocrine or paracrine effect on hyperproliferative cells. Increases intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperproliferative cell population. In other embodiments, cytostatic or differentiation agents can be used in combination with the present invention to improve the anti-hyerproliferative efficacy of the treatments. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present invention. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody c225, could be used in combination with the present invention to improve the treatment efficacy. [000151] There have been many advances in the therapy of cancer following the introduction of cytotoxic chemotherapeutic drugs. However, one of the consequences of chemotherapy is the development/acquisition of drug-resistant phenotypes and the development of multiple drug resistance. The development of drug resistance remains a major obstacle in the treatment of such tumors and therefore, there is an obvious need for alternative approaches such as gene therapy.
[000152] Another form of therapy for use in conjunction with chemotherapy, radiation therapy or biological therapy includes hyperthermia, which is a procedure in which a patient's tissue is exposed to high temperatures (up to 106°F). External or internal heating devices may be involved in the application of local, regional, or whole-body hyperthermia. Local hyperthermia involves the application of heat to a small area, such as a tumor. Heat may be generated externally with high-frequency waves targeting a tumor from a device outside the body. Internal heat may involve a sterile probe , including thin, heated wires or hollow tubes filled with warm water, implanted microwave antennae, or radiofrequency electrodes.
[000153] A patient's organ or a limb is heated for regional therapy, which is accomplished using devices that produce high energy, such as magnets. Alternatively, some of the patient's blood may be removed and heated before being perfused into an area that will be internally heated. Whole-body heating may also be implemented in cases where cancer has spread throughout the body. Warm-water blankets, hot wax, inductive coils, and thermal chambers may be used for this purpose.
[000154] Hormonal therapy may also be used in conjunction with the present invention or in combination with any other cancer therapy previously described. The use of hormones may be employed in the treatment of certain cancers such as breast, prostate, ovarian, or cervical cancer to lower the level or block the effects of certain hormones such as testosterone or estrogen. This treatment is often used in combination with at least one other cancer therapy as a treatment option or to reduce the risk of metastases. H. Kits and Diagnostics
[000155] In various aspects of the invention, a kit is envisioned containing therapeutic agents and/or other therapeutic and delivery agents. In some embodiments, the present invention contemplates a kit for preparing and/or administering a therapy of the invention. The kit may comprise one or more sealed vials containing any of the pharmaceutical compositions of the present invention. In some embodiments, the lipid is in one vial, and the nucleic acid component is in a separate vial. The kit may include may include at least one inhibitor of STAT expression, one or more lipid component, as well as reagents to prepare, formulate, and/or administer the components of the invention or perform one or more steps of the inventive methods. In some embodiments, the kit may also comprise a suitable container means, which is a container that will not react with components of the kit, such as an eppendorf tube, an assay plate, a syringe, a bottle, or a tube. The container may be made from sterilizable materials such as plastic or glass. [000156] The kit may further include an instruction sheet that outlines the procedural steps of the methods, and will follow substantially the same procedures as described herein or are known to those of ordinary skill. The instruction information may be in a computer readable media containing machine-readable instructions that, when executed using a computer, cause the display of a real or virtual procedure of delivering a pharmaceutically effective amount of a composition of the present invention to a subject in need.
I. Examples
[000157] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
EXAMPLE 1
Neuroendocrine Modulation of STAT 3 in Ovarian Cancer Materials and Methods
[000158] Reagents and Cell Lines. The SKOV3 cell line (Buick et al, 1985) was obtained from American Type Tissue Culture and maintained in Minimal Essential Media
(MEM, SRB core) with 10% fetal bovine serum (FBS). EG cells (Stalling et al, 1996) were maintained in RPMI-1640 with 15% FBS and 0.1% MITO Plus reagent (BD Biosciences,
San Jose, CA). For all experiments, 80% confluent cells were incubated for 15 hours in serum-free media prior to administration of drug. Norepinephrine, epinephrine, and propanolol were purchased from Sigma (St. Louis, MO) and reconstituted and stored in 5N
H2SO4 at -200C. Prior to each experiment, stock hormones were diluted at least 1 :1000 in appropriate serum-free media and exposed to cells within 5 minutes of preparation, to minimize spontaneous degradation. Prazosin and yohimbine (Tocris, Ellisville, MO); and
KT5720 (Calbiochem, San Diego, CA) were stored at -200C. Anti-IL-6 antibody was from (Biosource, Camarillo, CA). When used, these inhibitory substances were exposed to cells for 1 hour prior to exposure to norepinephrine or epinephrine. [000159] Western Blot. Cell lysate was prepared by washing cells with PBS and incubated for 10 min at 40C in modified RIPA lysis buffer (5OmM Tris, 15OmM NaCI, 1% triton, 0.5% deoxycholate plus the protease inhibitors leupeptin, aprotinin, EDTA, and sodium vanadate (Sigma). Cells were scraped from plates, centrifuged at 13,000 rpm for 20 min at 4°C and the supernatant stored at -80°C. Protein concentrations were determined using a BCA Protein Assay Reagent kit (Pierce, Rockford, IL), and 50 pg of whole cell lysate were subjected to 10% SDS-PAGE separation. Samples were transferred to a nitrocellulose membrane by semi-dry electrophoresis (Bio-Rad Laboratories, Hercules, CA), blocked with 5% non-fat milk for 2 hours at room temperature, and incubated with 2μg/ml α- phosphoSTAT3 or α-STAT3 antibody (Upstate, Lake Placid, NY) overnight at 40C. Primary antibody was detected with anti-mouse IgG (Amersham, Piscataway, NJ), and developed with enhance chemiluminescence detection kit (ECL, Pierce). Membranes were probed for actin (0.114/ml anti-β-actin antibody, Sigma) to confirm equal loading.
[000160] Immunolocalization. SKO V3 at 80% confluency in a 16 well glass chamber slide (Nunc Technologies, city, NY) were serum-starved overnight, and then treated for fifteen minutes with norepinephrine at final concentrations of 0.1 μM, 1 μM, and 10 μM. For blocking experiments, the cells were pretreated with 10 μM propanolol for one hour before addition of the norepinephrine. Following treatment, the slide was fixed immediately with cold acetone for ten minutes and stored in PBS at 40C prior for further processing. Endogenous peroxidase was blocked with 3% H2O2 for ten minutes, followed by a fifteen minute incubation in a biotin blocking system (DAKO Ltd. CSA Ancillary Kit, UK). The cells were then exposed for 2 hrs to polyclonal rabbit anti STAT3 (total) antibody (Upstate) diluted to 20 μg/ml, followed by a three-step staining procedure using biotinylated secondary antibody, streptavidin peroxidase reagents (DAKO Ltd. LSAB+ kit, UK) and DAB, then counterstained with hematoxylin (Vector Laboratories, CA).
[000161] Transcription factor DNA-binding activity. DNA-binding activity of STAT3 was assessed by electrophoretic mobility shift assay (EMSA) of nuclear extracts from 107 cultured cells, serum starved for 15 hours and either untreated or treated with NE for 5, 15, 30, and 60 minutes. Nuclear extracts were obtained by differential lysis at 4°C (Read, 1996), and 1/25 (2 μl) of the resulting extract was incubated at room temperature for 15 min with 1.75 pmol of 32P-labeled STAT3 consensus oligonucleotide (Promega, Madison, WI) in a 10 aqueous binding reaction containing 2μl of 5x gel shift binding buffer (20% glycerol, 5mM MgC12, 2.5mM EDTA, 2.5mM DTT, 25OmM NaCI, 5OmM Tris-HCI, pH 7.5, and. 25 mg/ml poly(dl-dC); Promega). Bound oligonucleotides were resolved on a 6% polyacrylamide gel (run for 90 min at 250V following a 15 min pre-run) and quantified on a Storm 860 phosphoimager using ImageQuant software (Molecular Dynamics, Sunnyvale, CA). All binding reactions were oligonucleotide-specific as demonstrated by competitive inhibition when protein extracts were preincubated with 100-fold excess of unlabeled target oligonucleotide, but not when extracts were preincubated with similar concentrations of an unlabeled control oligonucleotide. Equivalent loading of nuclear protein into each binding reaction was verified by Bradford assay (Bio-Rad).
[000162] Small interfering RNA. For downregulation of STAT3 in vitro and in vivo, siRNA was employed. STAT3 -specific siRNA was purchased from Qiagen (Valencia, CA),
HP validated anti-STAT3 siRNA, Catalog # SIO2662338. Control siRNA used was also from Qiagen, Catalog # 1027020, sequence AATTCTCCGAACGTGTCACGT (SEQ ID
NO:91). For in vitro studies, STAT3 -specific or control siRNA was incorporated into Qiagen
RNAiFect transfection agent (1 μg siRNA to 6 μg RNAiFect) and exposed to cells at 70-80% confluence for 24 hours prior to use in the MICS invasion system or collection of supernatant for assessment of MMP production. For in vivo studies, siRNA was encapsulated into the neutral liposome, 1 ,2-Dioleoyl-sn-Glycero-3 -Phosphatidylcholine (DOPC) as previously described (Landen et al, 2005). For each treatment, 3.5 μg of siRNA was reconstituted in
200 μL PBS, and administered by intravenous injection. The dosing schedule is as described below.
[000163] Invasion Assay. The Membrane Invasion Culture System (MICS) chamber was used to measure the in vitro invasiveness of all cell lines used in this study (Chambers, 2000; Sood et al, 2001; Sood et al, 2004). SiRNA was exposed to cells 24 hours prior to cell harvest, and 10 μM of NE was exposed for 3 hours prior to harvest and testing for invasion. For the MICS assay, a polycarbonate membrane with 10 μiM pores (Osmonics; Livermore, CA) was uniformly coated with a defined basement membrane matrix consisting of human laminin/type IV collagen/gelatin and used as the intervening barrier to invasion. The defined matrix was prepared (stored at 4°C) in a 10 mL stock solution as follows: laminin (50 μg/mL) ImL + type IV collagen (50μg/mL) 0.2 mL + gelatin (2 mg/mL) 4mL + 4.8 mL PBS. Using a disposable pipet, 1 mL of the matrix solution was dispensed across a long side of the membrane. An 8 mm glass rod was used to spread the matrix across the membrane, and allowed to dry for 30 minutes. The matrix coated filter was placed coated side up on the lower plate followed by carefully attaching the upper plate. Both upper and lower wells of the chamber were filled with serum-free RPMI containing IX MITO+(Collaborative Biomedical; Bedford, MA). Single cell tumor suspensions were seeded into the upper wells at a concentration of 1 X 10 cells per well. Following a 24 hour incubation in a humidified incubator at 37°C with 5% CO2, cells that had invaded through the basement membrane were collected through the sideport by replacing the media in the lower chamber with 2mM EDTA/PBS, pH 7.4, for 20 minutes at 37°C. The cells recovered from the bottom of the filter were then loaded onto a dot blot manifold containing 3 μm pore polycarbonate filters, fixed, stained, and counted by light microscopy (Sood et al, 2001; Sood et al, 2004). Invasiveness was calculated as the percentage of cells that had successfully invaded through the matrix-coated membrane to the lower wells relative to the total number of cells seeded into the upper wells. The invasion assays were performed in triplicate and repeated once.
[000164] Determination of matrix metalloproteinase (MMP) concentration. Serum- free conditioned media from cultures of ovarian cancer cells was collected 3 hours following exposure to 10 μM norepinephrine, with or without exposure to siRNA 24 hours prior. The supernatants were microfuged to remove debris and then stored at -80°C. The samples were thawed only one time for determining the MMP concentration. An identical number of cells were plated without the three-dimensional matrix for comparison. The protein concentration of total MMP-2 (pro-and active MMP-2), and total MMP-9 (92kDa pro- and 82kDa active forms) were determined using Quantikine immunoassays (R&D Systems; Minneapolis, MN) as per the manufacturer's protocols. The concentrations of active MMP-2 and MMP-9 were determined using the Biotrak Activity Assay System (Amersham Biosciences, Piscataway, NJ) as per the manufacturer's protocols. The MMP experiments were performed in triplicate and repeated once. [000165] In vivo tumor model. Female nude mice were purchased from the National Cancer Institute - Frederick Cancer Research Facility (Frederick, MD). The mice were housed and maintained under specific pathogen-free conditions in facilities approved by the American Association for Accreditation of Laboratory Animal Care in accordance with current regulations and standards of the United States Department of Agriculture, United States Department of Health and Human Services, and the National Institutes of Health. The mice were used according to institutional guidelines when they were 8-12 weeks of age. SKOV3ipl tumor cells were harvested from subconfluent cultures by a brief exposure to 0.25% trypsin and 0.02% EDTA. Trypsinization was stopped with medium containing 10% FBS. The cells were then washed once in serum-free medium and resuspended in Hank's Balanced salt solution (serum free). Only single-cell suspensions with greater than 95% viability, as determined by Trypan blue exclusion, were used for the injections. To produce tumors, IxIO6 SKOV3ipl cells (in O.lmL) were injected subcutaneously into the right flank of the nude mice. A total of 5 mice per group were used. Starting 4 days after tumor cell injection, mice were treated with daily injections of PBS (200 μl, intraperitoneal (IP)), isoproterenol (10 mg/kg daily IP), or isoproterenol (10 mg/kg) in combination with siRNA (control or STAT3 -specific, 3.5μg in DOPC every 3 days, IP) for 7 days (Landen et ah, 2006). All treatments were administered in a total volume of 200 μl. Eight days after tumor cell injection, mice were euthanized by cervical dislocation. Tumors were measured in two dimensions, dissected and fixed in formalin. Tumor volume was calculated as (length/2) x (width2). Tumor samples were analyzed using H & E staining. Representative images were taken from each tumor using a light microscope at 4Ox and 100x magnification.
[000166] Statistical Analysis. The x test was used to determine differences between cell counts of the MICS invasion assay using SPSS (SPSS Inc., Chicago, IL). For MMP concentrations, student's t-test was used for comparisons among two groups, and repeated measures ANOVA for dose-response and time effects. Differences in tumor volume were tested with student's t-test. A p value of <0.05 was considered statistically significant.
Results [000167] Stress hormone mediated activation of STAT3. On ligand stimulation, STAT3 is phosphorylated at Tyr705, dimerizes, and translocates to the nucleus to transactivate target genes. Studies were conducted to examine the effects of norepinephrine and epinephrine on levels of phosphorylated STAT3. After 15 hours in serum-starved media, cells were exposed to increasing concentrations of norepinephrine and epinephrine (0.1 μM, 1 μM, and 10 μM). Phosphorylated STAT3 levels increased markedly when exposed to just 0.1 μM norepinephrine in both cell lines (FIG. IA), to 0.1 μM epinephrine in EG, and to 1 μM epinephrine in SKOV3 (FIG. IB). There was no effect on total STAT3 levels. When cells were pretreated for 1 hour with propanolol, a βl/β2-adrenergic receptor blocker, exposure to even 10 μM of norepinephrine was not able to induce phospo-STAT3 expression (FIG. C). Propanolol also prevented phospho-STAT3 induction by epinephrine. Because norepinephrine and epinephrine interact with both beta- and alpha-adrenergic (αAR) receptors, blockade of alpha receptors was also examined. Inhibition of αl and α2 blockers either individually or in combination could not prevent phospho-STAT3 induction (FIG. ID), suggesting that catecholamine effects on activation of STAT3 were transmitted through βARs.
[000168] Norepinephrine induces translocation of STAT3 to the nucleus. Studies were then conducted to confirm that once STAT3 was activated, it was directed to the nucleus. Staining of SKOV3 cells in culture chambers after norepinephrine exposure showed that compared to untreated cells (FIG. 2A), increased levels of activated STAT3 were seen in as little as 15 minutes (FIG. 2C). This expression induction was predominantly in the nucleus. Pretreatment with propanolol again prevented the norepinephrine-induced effects on STAT3 (FIG. 2D), suggesting that STAT3 activation is mediated via β-adrenergic receptors. Next, to confirm induction of DNA-binding activity of STAT3, nuclear extracts from norepinephrine-treated and untreated cells were subjected to EMSA with an oligonucleotide bearing a consensus STAT3 response element. Within 5 minutes after exposure, a marked shift was seen (FIG. 3). This timeframe suggests a direct effect on activation and translocation of STAT3 by NE. Activation persisted for at least 60 minutes after exposure (the latest timepoint collected).
[000169] Norepinephrine signals to STAT3 through protein kinase A and is independent of IL-6. Studies were conducted to examine the pathway connecting norepinephrine to STAT3. Neuroendocrine hormones bind adrenergic receptors and activate the G-protein adenylyl cyclase, which activates the second messenger molecule cyclic AMP. Multiple pathways are activated by cyclic AMP, including that mediated by protein kinase A. To test if this pathway was involved in STAT3 activation, cells were preincubated with the protein kinase A inhibitor KT5720 for one hour prior to norepinephrine exposure. A concentration of 10 μM KT5720 was able to prevent STAT3 activation by 10 μM norepinephrine (FIG. 4). A less specific protein kinase inhibitor, H89, achieved similar inhibition. Because norepinephrine is also capable of activating IL-6 (Landen et al. , 2006), one of the most potent and recognized activators of STAT3, studies were conducted to examine if the NE stimulation was simply through activation of the IL-6 pathway. Cells were preincubated with anti-IL-6 antibody at 50 μg/ml, a concentration previously shown to adequately inhibit IL-6 signaling (Takanaga et al, 2004). STAT3 activation was not inhibited after treatment with the antibody (FIG. 4), suggesting that catecholamine mediated STAT3 activation occurs independent of IL-6. [000170] Effect of STAT3 blockade on the invasiveness of ovarian cancer cells and production of MMPs-2 and -9. The inventors have previously demonstrated that catecholamines promote invasion of ovarian cancer cells and stimulate production of MMP-2 and -9 levels (Sood et al, 2006). Based on growing information regarding the role of STAT3 in production of MMPs and cancer cell invasion (Dechow et al , 2004; Xie et al , 2004), studies were performed to investigate whether such a mechanism could be operative in stress- hormone mediated invasion of ovarian cancer cells. After confirming that STAT3 could be downregulated by >80% with siRNA (FIG. 5A), the MICS chamber system was used to quantify cell invasion with NE with or without STAT3 downregulation (FIG. 5B). NE treatment stimulated invasion of SKOV3 cells by 3.1 fold (p<0.01). Similar increases in invasion were observed with the EG cells (fold increase of 2.6, p=<0.01). The STAT3-siRNA completely blocked the norepinephrine-mediated increase in invasion, whereas the control siRNA had no effect. Because some studies have shown effects of STAT3 activation on cell proliferation (CaIo et al, 2003), studies were conducted to investigate whether the invasion rates could be affected by changes in proliferation. The effects of norepinephrine and epinephrine on ovarian cancer cell proliferation was studied using the MTT assay. Neither of these two catecholamines affected cell proliferation despite testing multiple doses and time periods. These data suggest that the effects on invasion are independent of proliferation.
[000171] To determine the contribution of STAT3 activation for stimulation of MMPs-9 and -2, we also used STAT3-siRNA. Consistent with our previous results (Sood et al, 2006), norepinephrine induced a 3.2-4.8-fold increase in MMP-9 (FIG. 5C) levels, and a 1.9- 2.6- fold increase in MMP-2 (FIG. 5D) levels in the SKOV3 and EG cell lines. STAT3 silencing with siRNA resulted in blockade of catecholamine-mediated increases in both MMP-2 and MMP-9 levels (FIG. 5C, FIG. 5D). [000172] Effect of STAT3 silencing on stress hormone-stimulated tumor growth and infiltration in vivo. It has been previously demonstrated that a non-specific β-agonist, isoproterenol, stimulated in vivo growth and infiltration of ovarian cancer cells (Sood et al , 2006). Using a method of in vivo siRNA delivery using a neutral liposome (DOPC) (Landen et al, 2005), the role of STAT3 in tumor growth infiltration in vivo was evaluated. Female nude mice were injected s.c. with SKOV3ipl cells and treated according to the following groups (n=5 per group): 1) PBS control; 2) control siRNA-DOPC; 3) STAT3 siRNA-DOPC; 4) daily isoproterenol; 5) daily isoproterenol + control siRNA-DOPC; and 6) daily isoproterenol + STAT3 siRNA-DOPC for 7 days. The tumor volume in the daily isoproterenol was significantly larger (by 846%, p<0.001) and deeply infiltrating compared to the PBS controls (FIG. 6). Control siRNA-DOPC had no effect on basal or isoproterenol- stimulated tumor growth and infiltration. However, STAT3 siRNA-DOPC reduced tumor growth by 47.1 (p<0.01) under basal conditions. Remarkably, STAT3 siRNA-DOPC completely blocked isoproterenolstimulated tumor growth, reducing tumor volume by 85% and infiltration.
[000173] The key findings in this study are that norepinephrine and epinephrine, key mediators of acute and chronic stress, are capable of activating STAT3, with subsequent translocation to the nucleus and DNA binding. The pathway proceeds through βARs and protein kinase A in a rapid fashion, suggesting a direct effect, independent of IL-6.
[000174] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claim.
REFERENCES
The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
U.S. Patent 117,363
U.S. Patent 4,659,774
U.S. Patent 4,682,195 U.S. Patent 4,683,202
U.S. Patent 4,816,571
U.S. Patent 4,870,287
U.S. Patent 4,959,463
U.S. Patent 5,030,453 U.S. Patent 5,141,813
U.S. Patent 5,214,136
U.S. Patent 5,223,618
U.S. Patent 5,264,566
U.S. Patent 5,378,825 U.S. Patent 5,428,148
U.S. Patent 5,446,137
U.S. Patent 5,466,786
U.S. Patent 5,470,967
U.S. Patent 5,539,082 U.S. Patent 5,554,744
U.S. Patent 5,574,146
U.S. Patent 5,602,240
U.S. Patent 5,602,244
U.S. Patent 5,610,289 U.S. Patent 5,614,617
U.S. Patent 5,623,070
U.S. Patent 5,645,897
U.S. Patent 5,652,099
U.S. Patent 5,670,663 U.S. Patent 5,672,697
U.S. Patent 5,681,947
U.S. Patent 5,700,922
U.S. Patent 5,705,629 U.S. Patent 5,708,154
U.S. Patent 5,714,331
U.S. Patent 5,714,331
U.S. Patent 5,714,606
U.S. Patent 5,719,262 U.S. Patent 5,719,262
U.S. Patent 5,736,336
U.S. Patent 5,736,336
U.S. Patent 5,739,169
U.S. Patent 5,760,395 U.S. Patent 5,763,167
U.S. Patent 5,766,855
U.S. Patent 5,766,855
U.S. Patent 5,773,571
U.S. Patent 5,777,092 U.S. Patent 5,786,461
U.S. Patent 5,786,461
U.S. Patent 5,792,847
U.S. Patent 5,801,005
U.S. Patent 5,824,311 U.S. Patent 5,830,880
U.S. Patent 5,846,945
U.S. Patent 5,858,988
U.S. Patent 5,859,221
U.S. Patent 5,872,232 U.S. Patent 5,886,165
U.S. Patent 5,891,625
U.S. Patent 5,908,845
U.S. Patent 5,962,016
U.S. Patent 5891,625 U.S. Patent 6,506,559
U.S. Patent 6,573,099
U.S. Patent 6,673,611
U.S. Patent 6,680,068 U.S. Patent Publn. 2001/0029250
U.S. Patent Publn. 2002/0168707
U.S. Patent Publn. 2003/0012812
U.S. Patent Publn. 2003/0051263
U.S. Patent Publn. 2003/0055020 U.S. Patent Publn. 2003/0159161
U.S. Patent Publn. 2004/0064842,
U.S. Patent Publn. 2004/0204377
U.S. Patent Publn. 2004/0208921
U.S. Patent Publn. 2004/0265839 U.S. Patent Publn. 2004/0019001
Andersen et al, J. Natl. Cancer Inst. Monogr., 21 :65-70, 1996.
Andersen et al, J. Clin. Oncol, 22: 3570-3580, 2004.
Antoni et al, J. Consul. Clinical Psych., 68:31-45, 2000. Austin- Ward and Villaseca, Revista Medica de Chile, 126(7):838-845, 1998.
Bailey and Sullivan, Biochimica. Biophys. Acts., 239-252, 2000.
Bowman et al, Oncogene, 19:2474-2488, 2000.
Bromberg, J Clin. Invest., 109:1139-1142, 2002.
Buick et al, Cancer Res., 45: 3668-3676, 1985. Bukowski et al, Clinical Cancer Res., 4(10):2337-2347, 1998.
Burke et al, Oncogene, 20:7925-7934, 2001.
CaIo et al , J. Cell Physiol. , 197: 157- 168, 2003.
CaIo et al, J. Cell Physiol, 197: 157-168, 2003.
Chambers, In: Ovarian Cancer Methods and Protocols, Bartlett (Ed.), 39:179-185, Humana Press, NJ, 2000.
Chen et al, Gynecol. Oncol, 94:630-635, 2004.
Christodoulides et al, Microbiology, 144(Pt l l):3027-3037, 1998.
Davidson et al, J. Immunother :, 21(5):389-398, 1998. Deamer and Uster, In: Liposome Preparation: Methods and Mechanisms, Ostro (Ed.), Liposomes, 1983.
Dechow et al., Proc. Natl. Acad. ScL USA, 101:10602-10607, 2004.
Dokka et al., Pharm. Res., 17: 521-25, 2000. Donze and Picard, Nucleic Acids Res, 30(10):e46, 2002.
Duxbury et al., Oncogene, 23:1448-1456, 2004.
Egholm et al, Nature, 365(6446):566-568, 1993.
Ellis and Fidler, Eur. J. Cancer, 32A:2451-2460, 1996.
Elmen et al, Nucleic Acids Res., 33(l):439-447, 2005. European Appln. 01219
European Appln. 266,032
Farhood et al, Biochim. Biophys. Act, 289-295, 1995.
Fawzy et al, Arch. Gen. Psychiatry, 60:100-103, 2003.
Fire et al, Nature, 391(6669):806-811, 1998. Folkman, Nat. Med., 1 :27-31, 1995.
Froehler et al, Nucleic Acids Res., 14(13):5399-5407, 1986.
Gamero et al, Cancer Cell, 5:111-112, 2004.
Garcia et al, Cell Growth Differ., 8:1267-1276, 1997.
Garcia et al, Oncogene, 20:2499-2513, 2001. Ghosh and Bachhawat, In: Liver Diseases, Targeted Diagnosis and Therapy Using Specific Receptors and Ligands, Wu et al. (Eds.), Marcel Dekker, NY, 87-104, 1991.
Glaseτ et al., Arch. Gen. Psych., 56:450-456, 1999.
Gregoriadis, In: Drug Carriers in Biology and Medicine, Gregoriadis (Ed.), 287-341, 1979.
Gutierrez-Puente et al, J. Pharmacol. Exp. Ther., 291 :865-869, 1999. Hanibuchi et al, Int. J. Cancer, 78(4):480-485, 1998.
Hellstrand et al, Acta Oncologica, 37(4):347-353, 1998.
House et al, Science, 241 :540-545, 1988.
Hsieh et al, Biochem. Biophys. Res. Commun., 335:292-299, 2005.
Huang et al, Gynecol. Oncol, 79:67-73, 2000. Hui and Hashimoto, Infection Immun., 66(11):5329-5336, 1998.
Itoh et al, Oncogene, 25: 1195-1204, 2006.
Jain et al, Oncogene, 17(24):3157-3167, 1998.
Ju et al, Gene Ther., 7(19):1672-1679, 2000.
Kaneda et al, Science, 243:375-378, 1989. Kato et al, J. Biol. Chem., 266:3361-3364, 1991.
Kemp and Hatmaker, Res. Nurs. Health, 12:331-336, 1989.
Kornberg and Baker, DNA Replication, 2nd Ed., Freeman, San Francisco, 1992.
Kortylewski et al, Cancer Metastasis Rev., 24:315-327, 2005. Kostarelos et al, Int. J. Cancer, 112: 713-21, 2004.
Krasnici et al, Int. J. Cancer, 105(4):561-567, 2003.
Landen et al, Cancer Biol. Ther., 5, 2006.
Landen et al, Cancer Res., 65:69106918, 2005.
Landen, Cancer Res., 65: 6910-18, 2005. Lara et al, Endocrine J., 15:187-192, 2001.
Leung and Whittaker, Pharmacol. Ther., 107(2):222-239, 2005.
Lutgendorf et al, Cancer, 95:808-815, 2002.
Lutgendorf et al, Clinical Cancer Res., 9:4514-4521, 2003.
Mitchell et al, Ann. NY Acad. ScL, 690:153-166, 1993. Mitchell et al , J. Clin. Oncol. , 8(5):856-869, 1990.
Morton et al, Arch. Surg., 127:392-399, 1992.
Nicolau et al, Methods Enzymol, 149:157-176, 1987.
Niu et al, Cancer Res., 61 :3276-3280, 2001.
Niu et al, Oncogene, 21 -.2000-2008, 2002. PCT Appln. WO 02/100435 Al
PCT Appln. WO 03/015757A1
PCT Appln. WO 04/002453A1
PCT Appln. WO 04029213 A2,
PCT Appln. WO 2006/113679 PCT Appln. WO 92/20702
Pietras et al, Oncogene, 17(17):2235-2249, 1998.
Qin et al, Proc. Natl. Acad. ScL USA, 95(24):1441 1-14416, 1998.
Ravindranath and Morton, Intern. Rev. Immunol, 7: 303-329, 1991.
Rosenberg et al, Ann. Surg. 210(4):474-548, 1989. Rosenberg et al , N Engl. J. Med. , 319:1676, 1988.
Sambrook et al, In: Molecular cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001.
Sartor et al, Cancer Res., 57:978-987, 1997.
Schaefer et al, Oncogene, 21 : 2058-2065, 2000. Scheit, In: Synthesis and Biological Function, Wiley-Interscience, NY, 171-172, 1980.
Schmidt and Kraft, Eur. J. Med. Res., 1 :528-532, 1996.
Seeman, Ann. Behav. Med, 16:95-106, 1994.
Sengupta et al, J. Exp. Med, 181(3):1015-1025, 1995. Sinibaldi et al., Oncogene, 19:5419-5427, 2000.
Sioud and Sorensen, Biochem. Biophys. Res. Comm., 312:1220-1225, 2003.
Siwak et al, Clin. Cancer Res., 8: 955-56, 2002.
Stalling et α/., Gynecol. Oncol., 60:72-80, 1996.
Song and Grandis, Oncogene, 19:2489-2495, 2000. Song et al., Nature Med. 9:347-351, 2003.
Sood et al, Am. J. Pathol, 158:1279-1288, 2001.
Sood et al, Am. J. Pathol, 165: 087-1095, 2004.
Sood et al, Clin. Cancer Res., 12:369-375, 2006.
Soutschek et al, Nature, 432:173-178, 2004. Spiegel and Kato, Harv. Rev. Psychiatry, 4(l):10-26, 1996.
Spiegel, Nat. Rev. Cancer, 2:383-389, 2002.
Strange et al, Neurotoxicol Teratol, 22:89-102, 2000.
Szoka and Papahadjopoulos, Proc. Natl. Acad. ScL USA, 75:4194-4198, 1978.
Takanaga et al., J. Biol. Chem., 279:15441-15447, 2004. Thaker et al. , Nat. Med, 12:939-944, 2006
Thurston et al, J. Clin. Invest., 101(7):1401-1413, 1998.
Udayakumar et al, Prostate, 58:66-75, 2004.
Wadhwa et al, Curr. Opin. MoI Ther., 6(4):367-372, 2004.
Wang et al, J. Exp. Med, 182(6): 1825-1831, 1995. Wang et al. , Nat. Med, 10: 48-54, 2004.
Wong et al, Gene, 10:87-94, 1980.
Xie et al, Cancer Res., 66:3188-3196, 2006.
Xie et al, Oncogene, 23:3550-3560, 2004.
Ye et al, Gynecol. Oncol, 94:125-133, 2004.

Claims

1. A composition comprising:
(a) a nucleic acid component comprising a nucleic acid that inhibits the expression of a gene that encodes a STAT; and
(b) a lipid component comprising one or more phospholipids, wherein the lipid component has an essentially neutral charge.
2. The composition of claim I5 wherein the nucleic acid component comprises a siRNA or a nucleic acid encoding a siRNA, wherein the siRNA inhibits the expression of a gene that encodes a STAT.
3. The composition of claim 1, wherein the STAT is STATl, STAT2, STAT3, STAT4, STAT5a, STAT5b, or STAT6.
4. The composition of claim 3, wherein the STAT is STAT3.
5. The composition of claim I5 wherein the lipid component forms a liposome.
6. The composition of claim 2, wherein the siRNA component is encapsulated in the lipid component.
7. The composition of claim 1, wherein the composition is comprised in a pharmaceutically acceptable carrier.
8. The composition of claim 1, wherein the lipid component comprises a neutral phospholipid.
9. The composition of claim 8, wherein the neutral phospholipid is a phosphatidylcholine or phosphatidylethanolamine.
10. The composition of claim 9, wherein the neutral phospholipid is egg phosphatidylcholine ("EPC"), dilauryloylphosphatidylcholine ("DLPC"), dimyristoylphosphatidylcholine ("DMPC"), dipalmitoylphosphatidylcholine ("DPPC"), distearoylphosphatidylcholine ("DSPC"), l-myristoyl-2-palmitoyl phosphatidylcholine ("MPPC"), l-palmitoyl-2-myristoyl phosphatidylcholine ("PMPC"), l-palmitoyl-2-stearoyl phosphatidylcholine ("PSPC"), l-stearoyl-2-palmitoyl phosphatidylcholine ("SPPC"), dimyristyl phosphatidylcholine ("DMPC"), l,2-distearoyl-sn-glycero-3-phosphocholine ("DAPC"), l^-diarachidoyl-sn-glycero-S-phosphocholine ("DBPC"), 1 ,2-dieicosenoyl-sn- glycero-3-phosphocholine ("DEPC"), palmitoyloeoyl phosphatidylcholine ("POPC"), lysophosphatidylcholine, dilinoleoylphosphatidylcholine distearoylphophatidylethanolamine ("DSPE"), dimyristoyl phosphatidylethanolamine ("DMPE"), dipalmitoyl phosphatidylethanolamine ("DPPE"), palmitoyloeoyl phosphatidylethanolamine ("POPE"), or lysophosphatidylethanolamine.
11. The composition of claim 9, wherein the phosphatidylcholine is DOPC.
12. The composition of claim 9, wherein the phosphatidylethanolamine is dioleoylphosphatidylethanolamine ("DOPE").
13. The composition of claim 8, wherein the phospholipid component comprises two or more types of neutral phospholipid.
14. The composition of claim 1, wherein the lipid component comprises a positively charged lipid or phospholipid, and a negatively charged lipid or phospholipid.
15. The composition of claim 14, wherein the lipid component further comprises a neutrally charged lipid.
16. The composition of claim 14, wherein the negatively charged phospholipid is a phosphatidylserine or phosphatidylglycerol.
17. The composition of claim 14, wherein the negatively charged phospholipid is dimyristoyl phosphatidylserine ("DMPS"), dipalmitoyl phosphatidylserine ("DPPS"), brain phosphatidylserine ("BPS"), dilauryloylphosphatidylglycerol ("DLPG"), dimyristoylphosphatidylglycerol ("DMPG"), dipalmitoylphosphatidylglycerol ("DPPG"), distearoylphosphatidylglycerol ("DSPG"), or dioleoylphosphatidylglycerol ("DOPG").
18. The composition of claim 1, wherein the composition further comprises cholesterol or polyethyleneglycol (PEG).
19. The composition of claim 2, wherein the siRNA is a double stranded nucleic acid of 18 to 100 nucleobases.
20. The composition of claim 19, wherein the siRNA is 18 to 30 nucleobases.
21. The composition of claim 1 , further comprising a chemotherapeutic agent.
22. The composition of claim 21, wherein the chemotherapeutic agent is a taxane or taxane derivative.
23. The composition of claim 22, wherein the taxane is docetaxel, paclitaxel, abraxane, 7- epipaclitaxel, t-acetyl paclitaxel, 10-desacetyl-paclitaxel, lO-desacetyl-7-epipaclitaxel, 7- xylosylpaclitaxel, 10-desacetyl-7-glutarylpaclitaxel, 7-N,N-dimethylglycylpaclitaxel, 7 -L- alanylpaclitaxel, or a mixture thereof.
24. The composition of claim 21, wherein the chemotherapeutic agent is cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP 16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, gemcitabien, navelbine, farnesyl-protein transferase inhibitors, transplatinum, 5-fluorouracil, vincristine, vinblastin, methotrexate, or a combination thereof.
25. A method of treating a subject with cancer comprising administering to the subject a pharmaceutically effective amount of a composition of any of claims 1-24.
26. The method of claim 25, wherein the subject is a human subject.
27. The method of claim 25, wherein the cancer is breast cancer, lung cancer, prostate cancer, ovarian cancer, brain cancer, liver cancer, cervical cancer, colon cancer, renal cancer, skin cancer, head and neck cancer, bone cancer, esophageal cancer, bladder cancer, uterine cancer, lymphatic cancer, stomach cancer, pancreatic cancer, testicular cancer, lymphoma, or leukemia.
28. The method of claim 27, wherein the cancer is ovarian cancer.
29. The method of claim 25, further defined as comprising identifying a subject in need of treatment.
30. The method of claim 25, further comprising administering an additional anticancer therapy to the subject.
31. The method of claim 30, wherein the additional anticancer therapy is chemotherapy, radiation therapy, surgical therapy, immunotherapy, gene therapy, or a combination thereof.
32. The method of claim 31 , wherein the additional anticancer therapy is chemotherapy.
33. The method of claim 32, wherein the chemotherapy comprises administration of docetaxel, paclitaxel, cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP 16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, gemcitabien, navelbine, farnesyl-protein tansferase inhibitors, transplatinum, 5-fluorouracil, vincristine, vinblastin, methotrexate, or a combination thereof.
34. The method of claim 25, wherein the composition is administered to the patient intravenously, intraperitoneally, intratracheally, intratumorally, intramuscularly, endoscopically, intralesionally, percutaneously, subcutaneously, regionally, or by direct injection or perfusion.
35. The method of claim 25, wherein the siRNA inhibits the expression of a gene that encodes STAT3, and wherein the lipid component comprises DOPC.
36. The method of claim 25, wherein the subject has a tumor and the method is further defined as a method to reduce the invasiveness of the tumor.
37. The method of claim 36, wherein the tumor is an ovarian cancer.
PCT/US2008/066753 2007-06-22 2008-06-12 Liposomal inhibitory nucleic acid against stat proteins WO2009002719A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US94583207P 2007-06-22 2007-06-22
US60/945,832 2007-06-22

Publications (1)

Publication Number Publication Date
WO2009002719A1 true WO2009002719A1 (en) 2008-12-31

Family

ID=40185981

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/066753 WO2009002719A1 (en) 2007-06-22 2008-06-12 Liposomal inhibitory nucleic acid against stat proteins

Country Status (1)

Country Link
WO (1) WO2009002719A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8900627B2 (en) 2008-06-06 2014-12-02 Mirna Therapeutics, Inc. Compositions for the in vivo delivery of RNAi agents
GB2515658A (en) * 2013-06-27 2014-12-31 Pgs Geophysical As Survey techniques using streamers at different depths
FR3038606A1 (en) * 2015-07-06 2017-01-13 Inst Nat Sciences Appliquees Lyon GLYCEROPHOSPHOCHOLINES FOR THEIR USE IN THE TREATMENT OF INTESTINAL INFLAMMATION OR INTESTINAL CANCER
WO2019027055A1 (en) * 2017-08-04 2019-02-07 協和発酵キリン株式会社 Nucleic-acid-containing lipid nanoparticles
US11092710B2 (en) 2013-06-27 2021-08-17 Pgs Geophysical As Inversion techniques using streamers at different depths

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030223998A1 (en) * 2002-02-27 2003-12-04 Lamb Lawrence S. Targeted immunotherapy of acute lymphoblastic leukemia (ALL)
US20050196781A1 (en) * 2001-05-18 2005-09-08 Sirna Therapeutics, Inc. RNA interference mediated inhibition of STAT3 gene expression using short interfering nucleic acid (siNA)
US20060008910A1 (en) * 2004-06-07 2006-01-12 Protiva Biotherapeuties, Inc. Lipid encapsulated interfering RNA
US7119078B2 (en) * 2000-09-08 2006-10-10 Baylor College Of Medicine Technology of intracellular delivery of DNA oligonucleotides to improve drug activity

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7119078B2 (en) * 2000-09-08 2006-10-10 Baylor College Of Medicine Technology of intracellular delivery of DNA oligonucleotides to improve drug activity
US20050196781A1 (en) * 2001-05-18 2005-09-08 Sirna Therapeutics, Inc. RNA interference mediated inhibition of STAT3 gene expression using short interfering nucleic acid (siNA)
US20030223998A1 (en) * 2002-02-27 2003-12-04 Lamb Lawrence S. Targeted immunotherapy of acute lymphoblastic leukemia (ALL)
US20060008910A1 (en) * 2004-06-07 2006-01-12 Protiva Biotherapeuties, Inc. Lipid encapsulated interfering RNA

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8900627B2 (en) 2008-06-06 2014-12-02 Mirna Therapeutics, Inc. Compositions for the in vivo delivery of RNAi agents
GB2515658A (en) * 2013-06-27 2014-12-31 Pgs Geophysical As Survey techniques using streamers at different depths
GB2515658B (en) * 2013-06-27 2020-07-29 Pgs Geophysical As Survey techniques using streamers at different depths
US11092710B2 (en) 2013-06-27 2021-08-17 Pgs Geophysical As Inversion techniques using streamers at different depths
FR3038606A1 (en) * 2015-07-06 2017-01-13 Inst Nat Sciences Appliquees Lyon GLYCEROPHOSPHOCHOLINES FOR THEIR USE IN THE TREATMENT OF INTESTINAL INFLAMMATION OR INTESTINAL CANCER
WO2019027055A1 (en) * 2017-08-04 2019-02-07 協和発酵キリン株式会社 Nucleic-acid-containing lipid nanoparticles
JPWO2019027055A1 (en) * 2017-08-04 2020-08-20 協和キリン株式会社 Nucleic acid-containing lipid nanoparticles
US11633365B2 (en) 2017-08-04 2023-04-25 Kyowa Kirin Co., Ltd. Nucleic acid-containing lipid nanoparticle
JP7429536B2 (en) 2017-08-04 2024-02-08 協和キリン株式会社 Nucleic acid-containing lipid nanoparticles

Similar Documents

Publication Publication Date Title
US8067390B2 (en) Therapeutic targeting of interleukins using siRNA in neutral liposomes
AU2006236453B2 (en) Delivery of siRNA by neutral lipid compositions
AU2018214137B2 (en) MiRNA and its diagnostic therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated BRAF pathway
US10898506B2 (en) P-ethoxy nucleic acids for liposomal formulation
EP3800256A1 (en) Combination to be used in therapeutic use against diseases or conditions associated with melanoma, or in diseases or conditions associated with activated b-raf pathway
WO2009097351A2 (en) TAK1-D MEDIATED INDUCTION OF CELL DEATH IN HUMAN CANCER CELLS BY SPECIFIC SEQUENCE SHORT DOUBLE STRANDED RNAs
WO2009059201A2 (en) Id2 as a target in colorectal carcinoma
WO2009070609A2 (en) Therapeutic targeting of il-6 using sirna in neutral liposomes
WO2009002719A1 (en) Liposomal inhibitory nucleic acid against stat proteins
WO2009126805A2 (en) Therapeutic tarageting of mmps in neutral liposomes
WO2009099959A2 (en) Tumor cell expression of neuropilin as a target for cancer therapy
CA3096670A1 (en) Therapeutic targeting of oncogenes using exosomes
US20220127608A1 (en) P-ethoxy nucleic acids for stat3 inhibition
WO2018195281A1 (en) P-ethoxy nucleic acids for igf-1r inhibition
US10870854B2 (en) Inhibitory RNA-based therapeutics targeting ANLN for cancer treatment
EP3612160A1 (en) P-ethoxy nucleic acids for bcl2 inhibition
WO2008100922A2 (en) Methods and compositions related to prefoldin and its regulation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08780805

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08780805

Country of ref document: EP

Kind code of ref document: A1