WO2009024789A1

WO2009024789A1 - Hiv-2 antigenic peptides

Info

Publication number: WO2009024789A1
Application number: PCT/GB2008/002831
Authority: WO
Inventors: Jones Sarah Rowland; Aleksandra Leligdowicz
Original assignee: Isis Innovation Limited
Priority date: 2007-08-23
Filing date: 2008-08-21
Publication date: 2009-02-26
Also published as: GB0716494D0

Abstract

An isolated polypeptide consisting of 9 to 149 contiguous amino acids of the HIV Gag polypeptide sequence shown in SEQ ID NO: 2 to 6 or a functional equivalent thereof, or a sequence showing at least 60% identity to said polypeptide.

Description

HIV-2 Antigenic Peptides

Field of Invention

This invention relates to novel HIV peptides, particularly HIV-2 peptides and to their use in pharmaceutical compositions

Background

HIV infection in humans can be caused by two related yet distinct viruses: HIV-I and HIV-2. Infection with HIV-2 is associated with a reduced rate of progression to AIDS (1) and significantly lower levels of plasma viral RNA (2, 3) in spite of similar proviral load (4) and a 30-60% sequence homology between the two viruses (5) . Consequently, the majority of HIV-2 -infected individuals are asymptomatic and die of causes unrelated to immunodeficiency (1) . Although HIV-2 infection has no effect on survival in most adults, individuals who do progress to AIDS are clinically indistinguishable from those infected with HIV-I (6, 7) , demonstrating that HIV-2 is not simply an attenuated virus.

To date, there is no absolute explanation for the lower viral set point and the long-term non-progression characteristic of HIV-2 infection. There is evidence to support that control of HIV-2 replication may result from superior immune protection (8-13) . In HIV-I infection, antigen-specific CD8 T cells are important in controlling viremia (14-16) and comprehensive epitope analysis established that virus-specific immune responses can be mounted to the entire HIV-I proteome (17-23) . However, the contribution of the cellular immune system to viremia control is controversial with evidence to support either a positive (18, 19), a negative (14, 24-26), or no correlation (17, 21, 22) with HIV-I plasma viral load (VL) . Previous studies in HIV-2 infection similarly report positive (27) , negative (10, 11, 28) , or no correlation (29, 30) with clinical markers of disease progression. However, past investigations of HIV-2 -specific immune responses have been constrained by incomplete coverage of the entire HIV-2 proteome and until now, there has been no comprehensive study of antigen-specific immune responses directed against the HIV-2 expressed genome.

The highest HIV-2 prevalence is in Guinea-Bissau reaching up to 20% in individuals over 40 years of age (31) . In 1989, the only community-based HIV-2 cohort in the world was established in Caio, a remote village in the north western part of the country. Prior studies that examined the role of the immune system in HIV-2 infection have been conducted on clinical cohorts, thus much of what is known about HIV-2 - specific immune responses is derived from the minority of HIV-2 -positive patients who progress to AIDS and may not be informative of protective immune responses. To date, the contribution of antigen-specific immune responses* to HIV-2 viremia control has not been defined. The Caio cohort provides an excellent opportunity to address this question. A better understanding of immune control in HIV-2 infection could reveal the reasons for the attenuated disease course in many infected people and may help to identify correlates of effective protective immunity essential in the design of

HIV vaccines . Using an ex vivo IFN-γ enzyme-linked immunospot (ELISpot) assay and a 3 -dimensional matrix of overlapping peptides spanning the HIV-2 proteome, the current inventors have studied the in vivo frequency, relative dominance, breadth, and specificity of HIV-2 -specific T cell responses. Using this approach, they have identified a number of highly immunogenic HIV-2 peptides which may be used to prevent or treat HIV infection.

Summary of the Invention

According to a first aspect of the present invention there is provided an isolated polypeptide consisting of 9 to 149 contiguous amino acids of the HIV Gag polypeptide sequence shown in at least one of SEQ ID NOS: 2 to 6 or a functional equivalent thereof, or a sequence showing at least 60% identity to said polypeptide.

In preferred embodiments, the sequence shows at least 70, 80, 85, 90 or 95% identity to the sequence of at least one of SEQ ID NOS: 2 to 6 or a functional equivalent thereof.

Preferably, the polypeptide consists of 9 to 21 contiguous amino acids of the polypeptide sequence shown in SEQ ID NOS : 2 to 6 or a functional equivalent thereof, or a sequence showing at least 60% identity to said polypeptide. More preferably, the polypeptide consists of between 9 and 18 contiguous amino acids.

As used herein the term functional equivalent refers to a polypeptide comprising the corresponding sequence from the Gag protein of an alternative HIV virus clade. HIV-I comprises clades A-H all of which have differing Gag protein sequences and which show different prevalence in different regions of the world.

As used herein, the term at least 90% identical thereto includes sequences that range from 90 to 99.99% identity to the indicated sequences and includes all ranges in between. Thus, the term at least 90% identical thereto includes sequences that are 91, 91.5, 92, 92.5, 93, 93.5. 94, 94.5, 95, 95.5, 96, 96.5, 97, 97.5, 98, 98.5, 99, 99.5 percent identical to the indicated sequence. Similarly the term "at least 60% identical" includes sequences that range from 60 to 99.99% identical, with all ranges in between. The determination of percent identity is determined using the algorithms described herein.

Preferably, the polypeptide consists of 9 to 21 contiguous amino acids of the polypeptide sequence shown in any one of SEQ ID NOS: 7 to 11 or a functional equivalent thereof or a sequence showing at least 60% identity to said polypeptide.

More preferably, the polypeptide consists of the amino acid sequence shown in at least one of SEQ ID NOS: 7-21 or a functional equivalent thereof, or a sequence showing at least 60% identity to said polypeptides.

In preferred embodiments, the sequence shows at least 70, 80, 85, 90 or 95% identity to the sequence of any one of SEQ ID NOS: 7 to 21 or a functional equivalent thereof.

In a most preferred embodiment, the isolated polypeptide consists of the amino acid sequence shown in SEQ ID NO: 12. According to a second aspect there is provided an isolated polypeptide which comprises a biologically active fragment of the HIV-2 Gag polypeptide, wherein said fragment consists of the amino acid sequence shown in at least one of SEQ ID NO: 7 or 12 to 16, or a sequence showing at least 60% identity to at least one of said sequences.

In preferred embodiments, the sequence shows at least 70, 80, 85, 90 or 95% identity to the sequence of any one of SEQ ID NOS: 7 or 12 to 16.

According to a third aspect there is provided an isolated nucleic acid encoding a polypeptide according to any previous aspect

Preferably, the nucleic acid is DNA or RNA.

It will be apparent that the nucleic acid may be an artificial synthesised nucleic acid, produced by any suitable means known to the skilled man.

According to a fourth aspect there is provided a vector comprising the nucleic acid of the third aspect. In one embodiment the vector is an expression vector and the nucleic acid is operably linked to a control sequence which is capable of providing expression of the nucleic acid in a host cell. A variety of vectors may be used. For example, suitable vectors may include viruses (e.g. vaccinia virus, adenovirus, etc., baculovirus) ; yeast vectors, phage, chromosomes, artificial chromosomes, plasmids, cosmid DNA and lipososmes, polyplexes, or cells (e.g. mesenchymal stem cells, macrophages) . According to a fifth aspect there is provided a host cell transformed with a vector according the fourth aspect. A wide variety of host cells may be used for expression of the nucleic acid of the invention. Suitable host cells for use in the invention may be prokaryotic or eukaryotic. They include bacteria, e.g. E. coli, yeast, insect cells and mammalian cells. Mammalian cell lines which may be used include but are not limited to, Chinese hamster ovary (CHO) cells, baby hamster kidney cells, NSO mouse melanoma cells, monkey and human cell lines and derivatives thereof and many others .

For further details relating to known techniques and protocols for manipulation of nucleic acid, for example, in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, see, for example, Current Protocols in Molecular Biology, 2nd ed., Ausubel et al . eds. , John Wiley & Sons, 1992 and, Molecular Cloning: a Laboratory Manual: 3^rd edition Sambrook et al . , Cold Spring Harbor Laboratory Press, 2000.

According to a sixth aspect there is provided a method of producing a polypeptide according to any of aspects one to three, said method comprising culturing a host cell transformed with a vector according to the fourth aspect under conditions which permit expression of said polypeptide and recovering the expressed polypeptide.

According to a seventh aspect there is provided a vaccine composition comprising at least one polypeptide of aspects one to three or the nucleic acid of the fourth aspect and a pharmaceutically acceptable diluent and/or carrier and optionally an excipient and/or adjuvant.

It will be understood that a vaccine according to the present invention may be a prophylactic vaccine for preventing HIV infection, or a therapeutic vaccine for treating individuals previously infected with HIV-I and/ or HIV-2.

It will be readily apparent that vaccines formed according to the invention may target simultaneously a plurality of epitopes of HIV.

Preferably, the vaccine comprises a polypeptide having the sequence of SEQ ID NO: 12.

In particularly preferred embodiments the pharmaceutical composition includes at least one pharmaceutically acceptable excipient.

According to an eighth aspect there is provided a polypeptide according to any of aspects one to three or the nucleic acid according to the fourth aspect for use in therapy.

According to a ninth aspect there is provided a polypeptide according to any of aspects one to three or the nucleic acid according to the fourth aspect for use in the prevention or treatment of HIV infection.

Preferably, the HIV infection is HIV-2 infection. According to a tenth aspect there is provided the use of a composition comprising the polypeptide of aspects one to three or the nucleic acid according to the fourth aspect in the manufacture of a medicament for the prevention or treatment of HIV infection.

Preferably, the HIV infection is HIV-I and/or HIV-2 infection.

It will be apparent to the skilled person that the above vaccines/ medicaments, may be formulated into pharmaceutical dosage forms, together with suitable pharmaceutically acceptable carriers, such as diluents, fillers, salts, buffers, stabilizers, solubilizers, etc. The dosage form may contain other pharmaceutically acceptable excipients for modifying conditions such as pH, osmolarity, taste, viscosity, sterility, lipophilicity, solubility etc.

Suitable dosage forms include solid dosage forms, for example, tablets, capsules, powders, dispersible granules, cachets and suppositories, including sustained release and delayed release formulations. Powders and tablets will generally comprise from about 5% to about 70% active ingredient. Suitable solid carriers and excipients are generally known in the art and include, e.g. magnesium carbonate, magnesium stearate, talc, sugar, lactose, etc. Tablets, powders, cachets and capsules are all suitable dosage forms for oral administration.

Liquid dosage forms include solutions, suspensions and emulsions. Liquid form preparations may be administered by intravenous, intracerebral, intraperitoneal, parenteral or intramuscular injection or infusion. Sterile injectable formulations may comprise a sterile solution or suspension of the active agent in a non-toxic, pharmaceutically acceptable diluent or solvent. Suitable diluents and solvents include sterile water, Ringer's solution and isotonic sodium chloride solution, etc. Liquid dosage forms also include solutions or sprays for intranasal administration.

Aerosol preparations suitable for inhalation may include solutions and solids in powder form, which may be combined with a pharmaceutically acceptable carrier, such as an inert compressed gas .

Also encompassed are dosage forms for transdermal administration, including creams, lotions, aerosols and/or emulsions. These dosage forms may be included in transdermal patches of the matrix or reservoir type, which are generally known in the art.

Pharmaceutical preparations may be conveniently prepared in unit dosage form, according to standard procedures of pharmaceutical formulation. The quantity of active compound per unit dose may be varied according to the nature of the active compound and the intended dosage regime.

The active agents are to be administered to human subjects in "therapeutically effective amounts" , which is taken to mean a dosage sufficient to provide a medically desirable result in the patient. The exact dosage and frequency of administration of a therapeutically effective amount of active agent will vary, depending on such factors as the nature of the active substance, the dosage form and route of administration.

According to an eleventh aspect there is provided a method of treating a patient infected with HIV comprising administering a therapeutically effective amount of the polypeptide of aspects one to three or the nucleic acid according to the fourth aspect to a patient in need thereof.

Preferably the patient is infected with HIV-2.

According to a twelfth aspect there is provided a method of immunising an individual against HIV infection comprising administering to an individual an effective amount of the polypeptide of aspects one to three or the nucleic according to the fourth aspect .

Preferably the HIV is HIV-I and/or HIV-2.

According to a thirteenth aspect there is provided an antibody characterised that it is capable of selectively reacting with the polypeptide of aspects one to three.

The term "antibody" as used herein encompasses purified or isolated naturally occurring antibodies of any isotype having the required immunological specificity, as well as synthetically produced antibodies or structural analogs thereof. Preparations of antibody can be polyclonal or monoclonal. Reference to such an "antibody" as described above includes not only complete antibody molecules, but also fragments thereof which retain substantial antigen binding capability. It is not necessary for any effector functions to be retained in such fragments, although they may be included. Suitable antibody fragments which may be used include, inter alia, F(ab')₂ fragments, scAbs, Fv, scFv fragments and nanoantibodies etc. Antibody fragments which contain the idiotype of the molecule can be generated by known techniques, for example, such fragments include but are not limited to the F(ab')2 fragment which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent . Other antibody fragments with the required antigen binding activity can be prepared by recombinant expression techniques generally known in the art.

Chimeric humanized and fully humanized monoclonal antibodies can be made by recombinant engineering. By addition of the human constant chain to F(ab')2 fragments it is possible to create a humanized monoclonal antibody which is useful in immunotherapy applications where patients making antibodies against the mouse Ig would otherwise be at a disadvantage. Breedveld F. C. Therapeutic Monoclonal Antibodies. Lancet 2000 Feb 26; 335, P735-40. Recombinant therapeutic monoclonal antibodies may be advantageously prepared by recombinant expression in mammalian host cells (e.g. CHO cells) .

Monoclonal antibodies with immunological specificity for HIV Gag can be prepared by immunisation of a suitable host animal (e.g. mouse or rabbit) with a suitable challenging antigen. Detailed Description of the invention

The invention will be described in greater detail with reference to the following figures in which: -

Figure 1 shows the proportion of patients with positive IFN- γ ELISpot responses to HIV-2 gene products

Figure 2 shows the relationship between HIV-2 -specific IFN-γ immune response magnitude and HIV-2 plasma viral load.

Correlation between a) Proteome and b) Gag-specific immune responses and viral load (Spearman rank correlation) . Proteome magnitude is the sum of responses in pools 1-24 and Gag magnitude is the sum of responses to pools 1-4 in the first matrix dimension. c) Comparison of IFN-γ ELISpot response magnitude in patients with undetectable (0) and detectable (♦) HIV-2 viral load. Black horizontal bars represent median values and significant p values are indicated.

Figure 3 shows the relative dominance of each gene product for every member of the two groups (plasma viral load <100 or ≥IOO copies/ml) . Pie charts display mean relative dominance values for each gene product expressed as a percentage of the total IFN-γ immune response.

Figure 4 shows the relationship between breadth of ELISpot responses and HIV-2 viral load. Breadth of ELISpot responses was defined as the average number of pools recognized per matrix dimension (range 0-24) . a)

Relationship between the breadth of ELISpot responses and HIV-2 viral load. b) Comparison of breadth of ELISpot responses in patient patients with controlled viremia (VL <100 copies/ml, (O)) and detectable viral load (VL ≥IOO copies/ml, (♦) ) .

Figure 5 shows the peptide 46-specific immune responses. a) Association between peptide 46-specific IFN-γ responses and viremia control. Peptide 46 (+) are responders (0, N=20) , and Peptide46 (-) are non-responders (♦, N=44) to this peptide. b) Peptide 46-specific IFN-γ responses can be blocked with anti -HLA-DR antibodies

Definitions

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Practitioners are particularly directed to Current Protocols in Molecular Biology (Ausubel) for definitions and terms of the art. Abbreviations for amino acid residues are the standard 3- letter and/or 1-letter codes used in the art to refer to one of the 20 common L-amino acids.

It is further noted that, as used in this specification, the singular forms "a," "an," and "the" include plural referents unless expressly and unequivocally limited to one referent. The term "or" is used interchangeably with the term "and/or" unless the context clearly indicates otherwise.

Also, the terms "portion" and "fragment" are used interchangeably to refer to parts of a polypeptide, nucleic acid, or other molecular construct. "Polypeptide" and "protein" are used interchangeably herein to describe protein molecules that may comprise either partial or full-length proteins. The term "peptide" is used to denote a less than full-length protein or a very short protein unless the context indicates otherwise.

As is known in the art, "proteins", "peptides," "polypeptides" and "oligopeptides" are chains of amino acids (typically L-amino acids) whose alpha carbons are linked through peptide bonds formed by a condensation reaction between the carboxyl group of the alpha carbon of one amino acid and the amino group of the alpha carbon of another amino acid. Typically, the amino acids making up a protein are numbered in order, starting at the amino terminal residue and increasing in the direction toward the carboxy terminal residue of the protein.

A "nucleic acid" is a polynucleotide such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) . The term is used to include single-stranded nucleic acids, double-stranded nucleic acids, and RNA and DNA made from nucleotide or nucleoside analogues.

The term "vector" refers to a nucleic acid molecule that may be used to transport a second nucleic acid molecule into a cell. In one embodiment, the vector allows for replication of DNA sequences inserted into the vector. The vector may comprise a promoter to enhance expression of the nucleic acid molecule in at least some host cells. Vectors may replicate autonomously (extrachromasomal) or may be integrated into a host cell chromosome. In one embodiment, the vector may comprise an expression vector capable of producing a protein derived from at least part of a nucleic acid sequence inserted into the vector.

The terms "identity" or "percent identical" refers to sequence identity between two amino acid sequences or between two nucleic acid sequences. Percent identity can be determined by aligning two sequences and refers to the number of identical residues (i.e., amino acid or nucleotide) at positions shared by the compared sequences. Sequence alignment and comparison may be conducted using the algorithms standard in the art {e.g. Smith and Waterman, 1981, Adv. Appl. Math. 2:482; Needleman and Wunsch, 1970, J. MoI. Biol. 48:443; Pearson and Lipman, 1988, Proc . Natl. Acad. Sci . , USA₁ 85:2444) or by computerized versions of these algorithms (Wisconsin Genetics Software Package

Release 7.0, Genetics Computer Group, 575 Science Drive, Madison, WI) publicly available as BLAST and FASTA. Also, ENTREZ, available through the National Institutes of Health, Bethesda MD, may be used for sequence comparison. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTN; available at the Internet site for the National Center for Biotechnology Information) may be used. In one embodiment, the percent identity of two sequences may be determined using GCG with a gap weight of 1, such that each amino acid gap is weighted as if it were a single amino acid mismatch between the two sequences. Or, the ALIGN program (version 2.0), which is part of the GCG (Accelrys, San Diego, CA) sequence alignment software package may be used.

As used herein, an "effective amount" means the amount of an agent that is effective for producing a desired effect in a subject. The term "therapeutically effective amount" denotes that amount of a drug or pharmaceutical agent that will elicit therapeutic response of an animal or human that is being sought. The actual dose which comprises the effective amount may depend upon the route of administration, the size and health of the subject, the disorder being treated, and the like.

The term "pharmaceutically acceptable carrier" as used herein may refer to compounds and compositions that are suitable for use in human or animal subjects, as for example, for therapeutic compositions administered for the treatment of a disorder or disease of interest.

The term "pharmaceutical composition" is used herein to denote a composition that may be administered to a mammalian host, e.g., orally, parenterally, topically, by inhalation spray, intranasally, or rectally, in unit dosage formulations containing conventional non-toxic carriers, diluents, adjuvants, vehicles and the like.

The term "parenteral" as used herein, includes subcutaneous injections, intravenous, intramuscular, intracisternal injection, or infusion techniques.

A "stable" formulation is one in which the polypeptide or protein therein essentially retains its physical and chemical stability and biological activity upon storage. Various analytical techniques for measuring protein stability are available in the art and are reviewed in

Peptide and Protein Drug Delivery, 247-301, Vincent Lee Ed., Marcel Dekker, Inc., New York, N. Y. , Pubs. (1991) and Jones, A. Adv. Drug Delivery Rev. 10: 29-90 (1993) . Stability can be measured at a selected temperature for a selected time period. For rapid screening, the formulation of interest may be kept at 40° C for 1 week to 1 month, at which time stability is measured. The extent of aggregation following lyophilization and storage can be used as an indicator of peptide and/or protein stability. For example, a "stable" formulation is one wherein less than about 10% and preferably less than about 5% of the polypeptide or protein is present as an aggregate in the formulation. An increase in aggregate formation following lyophilization and storage of the lyophilized formulation can be determined. For example, a "stable" lyophilized formulation may be one wherein the increase in aggregate in the lyophilized formulation is less than about 5% or less than about 3%, when the lyophilized formulation is incubated at 40 °C for at least one week. Stability of the fusion protein formulation may be measured using a biological activity assay such as a binding assay as described herein.

Examples

Materials and Methods

Study participants

Sixty-four chronically HIV-2-infected subjects of Manjako ethnic background were recruited in Caio, Guinea Bissau. HIV screening was performed using the Murex ICE HIV- 1.2.0 capture enzyme immunoassay (Murex Diagnostics) . Reactive sera were confirmed using an immunochromatographic rapid test for viral differentiation (HEXAGON HIV, Human GmbH) . Weakly positive HIV-I or HIV-2 tests or dually positive results were tested by a synthetic peptide-based strip method, (Pepti-Lav 1-2, Sanofi Diagnostics Pasteur) . Indeterminate results were subjected to HIV-I and HIV-2 - specific PCR using nested primers based on long terminal repeat regions specific for the respective virus (7, 47) .

HIV-I Primers

HIV-I OR (mo 023) : GCGCCACTGCTAGAGATTTT SEQ ID NO: 91 HIV-I LTR OF (mo 034) : TGAGCCTGGGAGCTCTCTG SEQ ID NO: 92

HIV-I IF (mo 024) : AACCCACTGCTTAAGCCTCA SEQ ID NO: 93

HIV-I LTR IR (mo 035) : GTCTGAGGGATCTCTAGKTACCAG SEQ ID NO: 94

HIV-2 Primers HIV-2 OF (mo 026) : GCTGGCAGATTGAGCCCTG SEQ ID NO: 95

HIV-2 OR (mo 027) : AAGGGTCCTAACAGACCAGGG SEQ ID NO: 96

HIV-2 IF (mo 028) : CAGCACTAGCAGGTAGAGCCTGGG SEQ ID NO: 97

HIV-2 IR (mo 029) : GGCGGCGACTAGGAGAGATGG SEQ ID NO: 98

Patients with confirmed HIV-l/HIV-2 dual status were excluded from the study. HIV-2 plasma viral load was quantified by RT-PCR using specific LTR primers (47) .

HIV-2 -specific LTR primers used for quantification of HIV-2 plasma viral load by RT-PCR:

Sense primer (H2SO) : ATTGAGCCCTGGGAGGTTCTCTCCA SEQ ID NO: 99 Antisense primer (H2AOB) : Bio-TTCGGGCGCCAACCTGCTAGGGATTTT SEQ ID NO: 100

The lower limit of detection was 100 RNA copies/ml and results below the level of detection were assigned an arbitrary value of 50 copies/ml. CD4 count analysis was carried out using a manual total white blood cell (WBC) count and differential lymphocyte count based on freshly collected blood. CD4 percentage analysis was done using BD MultiTest reagents and Multiset software (BD Immunocytometry Systems) on whole blood stabilized in a 5:1 ratio with TransFix™ (Cytomark) . CD4 counts were calculated using the following formula: (total WBC)x(%lymphocytes)x (CD4%) . A summary of the cohort's clinical and demographic parameters is presented in Table 1

All participants were antiretroviral naive and provided informed consent . Ethical approval was obtained from the Gambian Government/MRC Ethics Committee, from The Republic of Guinea Bissau Ministry of Health, and from the Oxford Tropical Research Ethics Committee (OXTREC) , UK.

Table 1

k Median values and range Mean values and range

HIV-2 overlapping peptides

Four complete HIV-2 subtype A genome sequences from West Africa available on the Los Alamos National Laboratory HIV Database were used to create a consensus sequence for all

HIV-2 gene products (Gag, Pol, Vif, Tat, Rev, Vpr, Vpx, Env, Nef ) . The consensus sequence was used to generate 424 peptides overlapping by 10 amino acids, which were 15 to 19 amino acids in length (PeptGen, http : //hiv-web . lanl . gov) . Peptides were synthesized by the PEPscreen service from

Sigma-GenoSys (70% purity as determined by MALDI-ToF mass spectrometry) . The final ELISpot assay peptide concentration was 2μg/ml per peptide and the final DMSO concentration in any pool was always ≤0.04%. Table II shows the distribution of overlapping HIV-2 peptides used in the ELISpot matrix. Table I I

Accessory proteins: Vif, Vpx, Vpr, Tat, Rev

^B Overlapping peptides encoded by the gene product expressed as a percent of all peptides

Design of a 3D peptide matrix

Overlapping peptides spanning the HIV-2 proteome were arranged in a 3 -dimensional matrix of 24 pools per dimension with 13-20 peptides per pool. This peptide configuration was deduced by the "Deconvolute This!" software (48) as the most optimal matrix design based on the number of expected positive peptides. Since there is no information on HIV-2 specific immune responses to the entire HIV-2 expressed genome, the expected number of positive peptides was derived based on data from HIV-1-specific IFN-γ responses that suggest that approximately 18 epitopic regions are recognized (17) . Past data show that the mean magnitude of responses to homologous HIV-I and HIV-2 Gag, Tat, and Env gene products is either similar (29) or lower when compared to HIV-1-specific responses (27) . Therefore, recognition of 18 or less epitopic regions would be expected per HIV-2- positive subject.

Peptides in the first matrix dimension (Pools 1-24) were arranged in sequential order, allowing the calculation of IFN-γ responses to individual gene products (Gag, Pol,

Accessory proteins, Env, Nef) . Total IFN-γ immune response to the proteome was calculated by averaging the IFN-γ magnitude of each of the 3 dimensions. Peptides in the second and third matrix dimensions were in a predicted random distribution that permitted the identification of epitope-containing peptides. For an epitope-containing peptide to be positive, a response must have been present in a unique 3 pool pattern (1 pool in each of 3 dimensions) . Only peptides for which the average spot forming units (SFU) of the 3 pools was less than three times the standard deviation from the average of the 3 pools were used in the analysis to prevent overestimation of epitope-containing peptides.

Ex vivo IFN-γ ELISpot assay

Freshly isolated PBMC were used in ex vivo IFN-γ ELISpot assays. Assays were carried out in 96-well Multiscreen filter plates (Millipore) coated with 15μg/ml of anti-IFN-γ monoclonal antibody (1-DIK, MABTECH) . PBMC were added at

10⁵ cells/well in a volume of 80 μl of HlO medium (RPMI 1640 (Sigma) , 10% Human AB serum, 2mM L-glutamine, 50U/ml penicillin/streptomycin) and stimulated with 20μl of lOμg/ml peptide pools (final concentration 2μg/ml per peptide) , 5ug/ml phytohemagglutinin (PHA, final concentration lμg/ml) , lOμg/ml optimized CD8 Influenza A, EBV, and CMV epitope [FEC] epitopes (16-20 peptides/pool , final concentration 2ug/ml) or media control in quadruplicate. Anti-HLA-DR L243 blocking antibodies (ATCC-LGC Promochem) were used at lOμg/ml and lOOμg/ml under the same assay conditions. Plates were incubated for 16 hours at 37 ^*C, 5% CO₂. Spot enumeration was performed with an AID ELISpot reader system (Autoimmun Diagnostika GmbH) . To quantify antigen-specific responses, mean spots of the control wells were subtracted from the positive wells and results were expressed as SFU per 10⁶ PBMC. Responses were regarded as positive if at least three times the mean of the quadruplicate negative control wells and over 50 SFU/10⁶ PBMC. If background wells were more than 30 SFU/l0^G PBMC or if both positive control wells (PHA or FEC stimulation) were negative, the assay was excluded from further analysis.

Statistical analysis

Statistical analysis was preformed using STATA 8.0 and graphical presentation was done using MS Excel 2003 and

GraphPad Prism 4.02. Normally distributed or transformed data were analyzed using parametric tests: Pearson's correlation or two-sample unpaired t-tests. Non-normally distributed data were analyzed using non-parametric tests: Spearman rank correlation or Wilcoxon-Mann-Whitney test. Results are given as means with standard deviations (parametric tests) or medians with ranges (non-parametric tests) . Statistical test differences were considered significant if p values were <0.05. Results

Characteristics of participants

Fifty percent of the study participants have been HIV-2 seropositive for at least 17 years (first serological HIV-2 diagnosis made in 1989 (32) ) , and HIV-2 plasma viral load did not differ in patients diagnosed before or after 1989, implying this cohort represents a unique population of HIV- infected long-term non-progressors, see Table I.

Previous studies that examined HIV-2 viral load as a predictor of survival found that HIV-2 RNA plasma levels below the limit of detection (<100 copies/ml) predict normal survival (2) and may be a surrogate marker for long-term non-progression. Therefore, in this cross-sectional study, the cohort was stratified into two groups on the grounds that viral load was undetectable (VL<100 copies/ml, N=31) or detectable (VL≥IOO copies/ml, N=33) . This division showed that patients with undetectable HIV-2 viral load had higher mean absolute CD4 counts and CD4 percentages, thus the stratification facilitated studying the relationship between immune response specificity and viremia control in patients with an intact immune system compared to those progressing to AIDS. The overall results of the ELISpot parameters investigated in the patient groups classified by plasma viral load are summarized in Table III. Table I II

VL<100 (N = 31) VL≥IOO (N = 33) p value

IFN-γ magnitude¹*

Proteome 1, 594 (95, 675 (0 , 6,660) 0.032

16 ,670)

Gag 1, 120 (0, 9,640) 385 (0, 2,470) 0.004

Pol 0 (0, 3,953) 0 (0 , 4,940) 0.303

Accessory 0 (0, 2,505) 0 (0 , 1,540) 0.153

Env 130 (0, 2,480) 0 (0 , 1,140) 0.269

Nef 0 (0, 810) 0 (0 , 465) 0.719

Relative dominance

% Gag 88 (0, 100) 64 .5 (0, 100) 0.023

% Pol 0 (0, 36) 6 (0 , 100) 0.056

% 0 (0, 36) 0 (0 , 23) 0.187

Accessory

% Env 5 (0, 61) 0 (4 , 100) 0.958

% Nef 0 (0, 38) 0 (0 ,35) 0.620

Breadth 4. 51 (± 2.65) 3. 76 (± 2.67) 0.137

B

^A Spot forming units per 10⁶ PBMC

B Average number of pools recognized per matrix dimension (range 0-24)

Gag is the most frequently recognized HIV-2 gene product and Nef responses are infrequent

Using the ELISpot assay, all HIV-2 gene products could stimulate IFN-γ secretion after in vitro stimulation with overlapping peptide pools, see Figure 1. The majority of HIV-2-infected individuals can mount an HIV-2-specific immune response, with 61/64 patients recognizing at least one gene product. The most frequently recognized peptides were in the Gag region of the proteome (87.5% of patients), followed by Env (51.6% of patients), Pol (43.8% of patients), Nef (10.9% of patients), and Accessory proteins (7.8% of patients) . Within the Gag region (first matrix dimension, pools 1-4) , pools 2 and 3 had the highest frequency of positive responses, with 76% patients making pool 2-specfic and 68% patients making pool 3 -specific IFN-γ immune responses (data not shown) .

Inverse correlation between IFN-γ magnitude and HIV-2 viral load

The IFN-γ responses to the first ELISpot matrix dimension were used to quantify the total number of functional antigen- specific T cells. When the IFN-γ immune response to the entire HIV-2 proteome (pools 1-24) was examined in relation to plasma viral load, a significant negative correlation was found, see Figure 2a. More specifically, this relationship was due to immune responses targeted to the Gag region (70 peptides present in pools 1-4) of the proteome, see Figure 2b. The cohort was next divided into two groups according to HIV-2 plasma viral load (VL <100 and VL ≥IOO copies/ml) to evaluate the role of the strength of gene product - specific IFN-γ immune responses in the control of plasma viremia see Figure 2c. The analysis revealed a significantly greater IFN-γ immune response magnitude to the proteome and to Gag in subjects with undetectable viral load. This relationship was significant only for immune responses targeted to peptides present in pool 2 (500 versus 210 spot-forming units (SFU) /10⁶ PBMC, p=0.02) and pool 3 (280 versus 85 SFU/10⁶ PBMC, p=0.005) . No difference was observed between responses targeting other HIV-2 gene products or other peptide pools and the control of viral replication.

After having identified an inverse association between Gag-specific immune responses in patients with and without detectable viremia, the cohort was dichotomized based on plasma viral load into the top 10^th percentile representing progressing patients (mean viral load of 82,647 copies/ml, range of 9,659-283,542 copies/ml, n=6) and undetectable viremia representing normal survival (<100 copies/ml, n=31) . The same analysis was performed on these two patient groups to determine if the association observed in the division of the cohort based on VL <100 or ≥IOO copies/ml would be preserved. It was found that the magnitude of IFN-γ immune responses to the proteome and to Gag was significantly greater in patients with lower viral loads (p=0.0007 and p=0.0013 respectively) and that there was no difference in the magnitude of the other protein-specific immune responses .

Inverse correlation between relative dominance of Gag- specific immune responses and HIV-2 viral load

The strength of a protein-specific immune response as a proportion of the entire virus-specific response is defined as the relative dominance (protein-specific IFN-γ magnitude/proteome IFN-γ magnitude xlOO) . Analysis of relative dominance identified a hierarchy in HIV-2 protein recognition, with Gag-specific IFN-γ secretion dominating the immune response (66%), followed by Env (16.3%), Pol (13.7%), Nef (2.3%), and Accessory proteins (1.7%) . The relative dominance of Gag-specific T cell responses is particularly striking considering that Gag peptides constituted only 16.5% of the total peptides used in the ELISpot matrix, see Table II.

When the cohort was stratified according to plasma viral load as shown in Figure 3, the median relative dominance of Gag-specific immune responses was significantly higher in patients who demonstrate control of viremia (88% versus 64.5%, p=0.02) . For individuals with viral load ≥IOO copies/ml, Pol -specific immune responses tended to contribute more to the total IFN-γ HIV-2 -specific immune response, however, this difference did not reach statistical significance .

Relationship between the breadth of HIV-2 -specific immune responses and control of viremia

To assess whether the breadth of T cell responses contributes to control of viremia, the average number of matrix pools with positive ELISpot responses was calculated by dividing the total number of positive peptide pools by the number of dimensions used in the ELISpot assay (range 0-

24 pools) . When the average number of positive peptide pools was related to HIV-2 viral load, as shown in Figure 4a, there was a weak but, not significant inverse association between the number of positive pools and plasma viral load. Similarly, when the breadth of immune responses was compared among patients with VL<100 and VL≥IOO copies/ml, no difference was detected see Figure 4b.

Most frequently targeted peptides cluster in a narrow part of the virus The design of the ELISpot matrix allowed delineation of the precise antigen specificity of HIV-2-specific T cells. 133 epitope-containing peptides were identified and six of these peptides were recognized by at least 10% of the cohort as shown in Table IV. These six peptides clustered in a highly conserved, 149 amino acid-long sequence within the Gag region of HIV-2 proteome (Gagi_75-323, SEQ ID NO: 2) . This region contains a total of 18 overlapping peptides (4.2% of all of the tested peptides) , 13 of which were recognized by at least one subject.

Table IV

Matrix Gene Sequence Frequency* Average

Peptide # product SFU/10⁶ PBMC

Peptide 46 Gag₂₉8-3is YVDRFYKSLRAEQTDPAV 20 706

Peptide 27 Gag₁₇₅_₁₉o QALSEGCTPYDINQML 13 982

Peptide 38 Gag₂5i-268 MYRQQNPVPVGNIYRRWI 11 1403

Peptide 47 Ga9306-323 LRAEQTDPAVKNWMTQTL 10 1359

Peptide 36 Gag₂₄₅-252 SDIAGTTSTVDEQIQWMY 10 662

Peptide 41 Gag2_59-276 PVGNIYRRWIQIGLQKCV 9 254

Number of patients making peptide-specific response

Responses to a single peptide correlate with viremia control

The most frequently recognized peptide was peptide 46 (Gag₂₉8-3i5, YVDRFYKSLRAEQTDPAV, SEQ ID NO: 12) and a response to this peptide was present in 31% of the cohort. When patients were stratified into either responders or non- responders to the six most frequently targeted peptides, only the presence of peptide 46-specific responses was inversely related to HIV-2 plasma viral load see Figure 5a, To further characterize peptide 46-specific T cells, CD8⁺ and CD8^" PBMC fractions were used in an IFN-γ ELISpot assay and IFN-γ intracellular staining to determine T cell subtype restriction of these responses. Results showed that peptide 46 responses can be CD4 and CD8 T cell-restricted (data not shown) . Anti -HLA-DR antibodies were next used in an IFN-γ ELISpot assay in the presence of fresh PBMC from a peptide 46 responder stimulated with peptide 46. This eliminated the antigen-specific response, see Figure 5b, indicating that peptide .46 responses can be restricted by HIJA-DR, thus supporting the potential role of CD4 T cells in the restriction of this epitope-containing peptide. The role of CD4 T cell help in the function of CD8 T cells remains incompletely defined. The fact that this frequently targeted region can be restricted by CD4 T cells (as shown by ELISpot assays done using CD8 -depleted T cell, by using HLA-DR blocking in ELISpot assays, and by intracellular cytokine staining using flow cytometry) suggests that the function of CD4 T cells specific for this region may offer insight into the correlates of protection associated with beneficial HIV-specific CD4 immune responses.

Discussion

HIV-2 infection is a relatively neglected model of naturally attenuated HIV infection with infected subjects falling into two broad groups: progressors, who are clinically indistinguishable from people infected with HIV-I, and non- progressors. As the majority of HIV-2 -positive patients have a low or undetectable viral load and are long-term non- progressors, this infection serves as a human model for controlled retroviral infection. The question of what antigen-specific immune responses could account for long- term non-progression in HIV-2 infection has never previously been addressed. A more complete understanding of the interplay between the immune system and HIV-2 replication may provide information about correlates of immune protection pertinent to HIV-I infection. This data has been difficult to acquire as nearly all HIV-I patients progress to disease.

The current work, which included 64 patients from a well- characterized community-based cohort with follow-up exceeding 17 years, is the largest study to date examining HIV-2 -specific T cells and the only study to do so outside clinical cohorts that are dominated by the minority of HIV- 2 -positive patients who progress to AIDS. It is also the first comprehensive characterization of cellular immune responses against the entire HIV-2 proteome using a novel 3- dimensional peptide matrix in an ex vivo IFN-γ ELISpot assay. Using this approach, it was demonstrated that antigen- specific T cell responses can be mounted to all HIV- 2 proteins. HIV-2 -specific immune responses were unevenly distributed across the expressed genome which is similar to HIV-1-specific responses (17, 18, 20, 33) . However, unlike HIV-I infection, an unquestionably clear relationship between control of HIV-2 viremia and antigen- specific immune responses to the whole proteome, to Gag, and to a single peptide (peptide 46) within the p26 region of Gag has been identified.

It is striking that the strongest immune responses were made significantly more often by individuals with plasma viral loads below the limit of assay detection (<100 RNA copies/ml) , with HIV-2-specific T cells accounting for up to 1.6% of circulating PBMC. The most frequently targeted peptides clustered in a highly conserved, 149 amino acid- long region of HIV-2 Gag, representing 28.6% of the Gag gene product and only 4.5% of the total HIV-2 proteome. In addition, Gag elicited the most vigorous IFN-γ immune responses, reaching up to 9640 SFU/10⁶ PBMC. This suggests that as much as 1% of the PBMCs of an HIV-2 -infected individual can recognize a very narrow part of the viral proteome. Results from stratifying the cohort based on the highest (10^th percentile of all plasma viral load) and undetectable viral load similarly identified an unequivocal strong negative association between the level of viremia and Gag-specific immune responses, suggesting that the relationship is valid over a wide range of viral loads. The importance of Gag recognition became apparent upon matrix deconvolution which identified a peptide recognized by over 30% of the cohort (peptide 46, Gag₂₉₈-3i5/ SEQ ID NO: 12) with patients who made responses to this peptide having a lower viral load than those who did not .

In HIV-I infection, Gag is among the most immunogenic region of the virus (20) and preferential targeting of Gag (18) , especially by CD8 T cells (33, 34) , is associated with enhanced control of viral replication. The region of HIV-I Gag corresponding to peptide 46 (SEQ ID NOS: 18-21) contributes to the total immune response in HIV-I infection in terms of frequency of recognition (35) , immunodominance (18, 36), and avidity (22) . This frequently targeted and highly immunogenic region of Gag can be restricted by both CD4 (21, 37) and CD8 (35) T cells as well as by a variety of HLA haplotypes (38) . However this is the first time that this region has been shown to be associated with control of viral replication. Gag₂₉₈-₃i₅ in HIV-2 is located in area of the virus equivalent to the HIV-I capsid (CA) protein. More precisely, the 18 amino acid-long sequence of the peptide overlaps with the Major Homology Region (MHR) , a conserved stretch of 20 amino acids found in the carboxyl-terminal domain of the capsid protein. The MHR is highly conserved across all retroviruses and is essential for viral assembly, maturation, and infectivity and its deletion impairs membrane binding, vira_.l particle formation, and correct assembly of the viral core (39-41) . In our cohort, analysis of HIV-2 p26 sequences revealed a 96.5% amino acid sequence identity in the 18aa-long region corresponding to peptide 46 (Clayton Onyango, manuscript in preparation) . Therefore, evasion of capsid-specific T cell responses by the virus may be severely limited by the structural and functional requirements imposed on this region (42, 43) .

A vital aim of HIV vaccine design is eliciting antigen- specific CD8 T cell responses, thus it is important that vaccine constructs include areas of the viral genome that are often recognized by antigen-specific T cells, are restricted by various HLA alleles, and are resistant to escape mutations. In naturally- infected HIV-I and HIV-2 subjects, the capsid region of Gag represents such an area and since peptide 46 is located in this region, it is crucial to further examine the function and phenotype of peptide 46-specific T cells in the context of natural infection and to include this peptide in future CTL- inducing vaccines. Comprehensive analysis of HIV-2 -specific immune responses has demonstrated that a narrow part of the proteome is most often targeted by functional, IFN-γ-producing T cells. This raises the question of why the host immune system targets the capsid region of the virus so frequently. The capsid region of Gag may be better processed by the host and more effectively presented on MHC molecules relative to other areas of the viral proteome. If this is the case, it would support the prior finding that CTL effectiveness critically depends upon epitope density (44) . It is also possible that antigens from this region may be more available for presentation since capsid is expressed at higher levels compared to other parts of viral genome (45) . Also, the ample capsid from incoming virions may provide abundant substrate for antigen processing without requiring de novo protein synthesis early after viral entry (46) . Regardless, the capsid area of HIV-I and HIV-2 Gag represents an equilibrium between the host immune response and the virus functional constraints.

Immunodominance hierarchy of HIV-I epitopes is determined early in infection and is seldom modified in chronic infection (23) . Thus it is likely that responses to conserved parts of the genome, such as the capsid region of HIV-2 Gag, are made early in the course of infection and are maintained for many years post -infection. To address the question of maintenance of antigen-specific responses over time, individual peptide responses after 6-12 months were first examined. It was found that responses observed in the initial screen were preserved in the follow-up sample collection. Whether the length of infection influences the ^'specificity of immune responses was then tested. The cohort was stratified according to time of first diagnosis into patients diagnosed before 1989 and infected for over 17 years (n=32) and those diagnosed after 1989 and infected for 3-15 years, median 9 years (n=32) . It was found that in the two subject groups with established HIV-2 infection, there was no difference in the frequency or the relative dominance of Gag-specific immune responses. The detection of robust immune responses to the same region of the virus in many patients irrespective of the duration of infection implies that T cells that target epitopes in areas of the HIV-2 proteome incapable of escaping immune pressure are durable. This is particularly striking considering the high magnitude of responses that appear to have been maintained over decades despite low levels of viral replication. Even though the virus is undetectable in the plasma of the majority of HIV-2 -infected individuals, controlled viral replication is likely ongoing in lymphoreticular tissues thus satisfying the requirement for antigen presence for the maintenance of antigen-specific memory T cells despite the absence of the virus in the blood. During states of high viremia, the lower frequency of antigen-specific T cells could reflect their exhaustion or their decay as the high viral replication rate drives viral evasion of the immune response. Taken together, the data suggest that IFN-γ immune responses to conserved antigens contribute to the control of HIV-2 viremia and the resulting low levels of circulating virus may prevent immune exhaustion.

The Gag and Nef proteins are consistently identified as the most frequently targeted parts of the HIV-I proteome and responses to Nef contribute to almost one-third of the response to the expressed genome (17, 18, 20) . Therefore, the paucity of HIV-2 Nef-specific immune responses observed in this study was unexpected. In fact, the only difference in HIV-I and HIV-2 immune response specificity is in the recognition of Nef (29) . To rule out the possibility that the sequence of peptides used in this study did not accurately represent the Nef sequences of circulating viral strains, Nef sequences generated from HIV-2 -infected members of the cohort (Jerome Feldmann, manuscript in preparation) were compared to the Nef consensus sequence used for the synthesis of overlapping peptides. Sequence alignment revealed a mean 82.5% amino acid identity for the whole protein. When the region of HIV-2 Nef corresponding to the immunodominant part of HIV-I Nef (Nef7₀-94) (17) was analyzed, an 87% identity was seen, suggesting that the peptide sequence was a reasonable representation of the HIV- 2 Nef sequences present in the community and should have elicited ELISpot responses. There are differences in sequence, size, and function between HIV-I and HIV-2 Nef proteins. In comparison to HIV-I, HIV-2 Nef is longer (257aa and 34kDa versus 208aa and 27kDa) and the sequence homology between the two viral consensus sequences has only a 30.9% identity (http://hiv-web.lanl.gov) . It is possible the sequence variation could affect a combination of epitope processing, MHC binding and epitope presentation, or T cell receptor recognition of the peptide-MHC complex thereby altering HIV-2 Nef-specific immune responses. An alternate possibility is that the level of Nef in controlled HIV-2 infection is insufficient for adequate immunogenicity.

The inventors have shown that specificity of the immune response may account for the distinct clinical outcome associated with long-term non-progression characteristic of HIV-2 infection and provide in vivo support for the importance of cellular immune responses in the control of viral replication, there are limitations to this conclusion. While IFN-γ secretion is antigen-specific, it is not the only cytokine secreted upon antigen exposure. Therefore, further studies are being conducted to determine the functional profile of antigen-specific cells identified during the cross-sectional analysis of HIV-2 -specific immune responses. The IFN-γ ELISpot assay does not discriminate the subset of lymphocytes that contribute to the antigen- specific cytokine secretion. Therefore further studies examining IFN-γ intracellular staining using flow cytometry were undertaken to deduce whether CD4 or CD8 T cells were responsible for the cellular immune response. It was found that the majority of responses were CD8 T cell-restricted, suggesting that it is mainly the CD8 subset of T cells that contributes to HIV-2 -specific immune response.

In summary, the inventors have shown that in HIV-2 infection, robust IFN-γ immune responses made by antigen- specific T cells are an important determinant of control of viral replication and disease outcome. Furthermore, immune responses mounted to a narrow and highly conserved region of the HIV-2 capsid region of Gag are a strong marker for control of HIV-2 viremia. It has been demonstrated that both the recognition of this region as well as the magnitude of the IFN-γ response mounted by antigen-specific T cells significantly correlate with low viral loads in HIV-infected subjects. The findings suggest that cellular mediated immunity is far better preserved in non-progressive HIV-2 -positive patients, implying that the immune .system strives to control chronic HIV-2 infection. References

1. Marlink, R., Kanki, P., Thior, I., Travers, K., Eisen, G., Siby, T., Traore, I., Hsieh, CC, Dia, M. C, Gueye, E. H., et al . 1994. Reduced rate of disease development after HIV-2 infection as compared to HIV-I. Science 265:1587-1590.

2. Berry, N., Jaffar, S., Schim van der Loeff, M., Ariyoshi, K., Harding, E., N'Gom, P. T., Dias, F., Wilkins, A., Ricard, D., Aaby, P., et al . 2002. Low level viremia and high CD4% predict normal survival in a cohort of HIV type-2- infected villagers. AIDS Res Hum Retroviruses 18:1167-1173.

3. Andersson, S., Norrgren, H., da Silva, Z., Biague, A., Bamba, S., Kwok, S., Christopherson, C, Biberfeld, G., and Albert, J. 2000. Plasma viral load in HIV-I and

HIV-2 singly and dually infected individuals in Guinea- Bissau, West Africa: significantly lower plasma virus set point in HIV-2 infection than in HIV-I infection. Arch Intern Med 160:3286-3293. 4. Popper, S.J., Sarr, A. D., Gueye-Ndiaye, A., Mboup, S., Essex, M. E., and Kanki, P.J. 2000. Low plasma human immunodeficiency virus type 2 viral load is independent of proviral load: low virus production in vivo. J Virol 74:1554-1557. 5. Guyader, M., Emerman, M., Sonigo, P., Clavel, F., Montagnier, L., and Alizon, M. 1987. Genome organization and transactivation of the human immunodeficiency virus type 2. Nature 326:662-669. 6. Whittle, H., Egboga, A., Todd, J., Corrah, T., Wilkins, A., Demba, E., Morgan, G., Rolfe, M., Berry, N., and

Tedder, R. 1992. Clinical and laboratory predictors of survival in Gatnbian patients with symptomatic HIV-I or HIV-2 infection. AIDS 6:685-689.

7. Ariyoshi, K., Jaffar, S., Alabi, A. S., Berry, N., Schim van der Loeff, M., Sabally, S., N'Gom, P. T., Corrah, T., Tedder, R., and Whittle, H. 2000. Plasma RNA viral load predicts the rate of CD4 T cell decline and death in HIV-2-infected patients in West Africa. Aids 14:339- 344.

8. Bertoletti, A., Cham, F., McAdam, S., Rostron, T., Rowland-Jones, S., Sabally, S., Corrah, T., Ariyoshi, K., and Whittle, H. 1998. Cytotoxic T cells from human immunodeficiency virus type 2 -infected patients frequently cross-react with different human immunodeficiency virus type 1 clades. J Virol 72:2439- 2448.

9. Gotch, F., McAdam, S.N., Allsopp, CE. , Gallimore, A., Elvin, J., Kieny, M. P., Hill, A. V. , McMichael, A.J., and Whittle, H. C. 1993. Cytotoxic T cells in HIV2 seropositive Gambians . Identification of a virus- specific MHC-restricted peptide epitope. J Immunol 151:3361-3369.

10. Sarr, A. D. , Lu, Y., Sankale, J. L., Eisen, G., Popper, S., Mboup, S., Kanki, P.J., and Cao, H. 2001. Robust HIV type 2 cellular immune response measured by a modified anthrax toxin-based enzyme-linked immunospot assay. AIDS Res Hum Retroviruses 17:1257-1264.

11. Duvall, M. G., Jaye, A., Dong, T., Brenchley, J. M. , Alabi, A. S., Jeffries, D.J., van der Sande, M., Togun, T.O., McConkey, S.J., Douek, D. C, et al . 2006. Maintenance of HIV-specific CD4+ T cell help distinguishes HIV-2 from HIV-I infection. J^" Immunol 176:6973-6981. 12. Lope^'s, A. R., Jaye, A., Dorrell, L., Sabally, S., Alabi, A., Jones, N.A. , Flower, D. R., De Groot, A., Newton, P., Lascar, R. M., et al . 2003. Greater CD8+ TCR heterogeneity and functional flexibility in HIV-2 compared to HIV-I infection. J Immunol 171:307-316.

13. Rowland-Jones, S., Sutton, J., Ariyoshi, K., Dong, T., Gotch, F., McAdam, S., Whitby, D., Sabally, S., Gallimore, A., Corrah, T., et al . 1995. HIV-specific cytotoxic T-cells in HIV-exposed but uninfected Gambian women. Nat Med 1:59-64.

14. Ogg, G. S., Jin, X., Bonhoeffer, S., Dunbar, P. R., Nowak, M.A. , Monard, S., Segal, J. P., Cao, Y., Rowland- Jones, S. L., Cerundolo, V., et al . 1998. Quantitation of HIV-I-specific cytotoxic T lymphocytes and plasma load of viral RNA. Science 279:2103-2106.

15. Walker, B. D., Chakrabarti, S., Moss, B., Paradis, T.J., Flynn, T., Durno, A. G. , Blumberg, R. S., Kaplan, J. C, Hirsch, M.S., and Schooley, R. T. 1987. HIV-specific cytotoxic T lymphocytes in seropositive individuals. Nature 328:345-348.

16. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M. , and Oldstone, M. B. 1994. Virus-specific CD8+ cytotoxic T- lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. J Virol 68:6103-6110.

17. Addo, M. M., Yu, X. G., Rathod, A., Cohen, D., Eldridge, R. L., Strick, D., Johnston, M.N., Corcoran, C, Wurcel, A. G., Fitzpatrick, CA. , et al . 2003. Comprehensive epitope analysis of human immunodeficiency virus type 1 (HIV-I) -specific T-cell responses directed against the entire expressed HIV-I genome demonstrate broadly directed responses, but no correlation to viral load. J^" Virol 77:2081-2092.

18. Masemola, A., Mashishi, T., Khoury, G., Mohube, P., Mokgotho, P., Vardas, E., Colvin, M., Zijenah, L., Katzenstein, D., Musonda, R., et al . 2004. Hierarchical targeting of subtype C human immunodeficiency virus type 1 proteins by CD8+ T cells: correlation with viral load. J Virol 78:3233-3243.

19. Betts, M. R., Ambrozak, D. R., Douek, D. C, Bonhoeffer, S., Brenchley, J.M. , Casazza, J. P., Koup, R.A. , and

Picker, L.J. 2001. Analysis of total human immunodeficiency virus (HIV) -specific CD4 (+) and CD8 (+) T-cell responses: relationship to viral load in untreated HIV infection. J^" Virol 75:11983-11991. 20. Novitsky, V., Cao, H., Rybak, N., Gilbert, P., McLane, M. F., Gaolekwe, S., Peter, T., Thior, I., Ndung'u, T., Marlink, R., et al . 2002. Magnitude and frequency of cytotoxic T-lymphocyte responses: identification of immunodominant regions of human immunodeficiency virus type 1 subtype C. J Virol 76:10155-10168.

21. Kaufmann, D. E., Bailey, P.M., Sidney, J., Wagner, B., Norris, P.J., Johnston, M.N. , Cosimi, L.A., Addo, M. M. , Lichterfeld, M., Altfeld, M., et al . 2004. Comprehensive analysis of human immunodeficiency virus type 1-specific CD4 responses reveals marked immunodominance of gag and nef and the presence of broadly recognized peptides. J Virol 78:4463-4477.

22. Cao, J., McNevin, J., Holte, S., Fink, L., Corey, L., and McElrath, M.J. 2003. Comprehensive analysis of human immunodeficiency virus type 1 (HIV-I) -specific gamma interferon-secreting CD8+ T cells in primary HIV- 1 infection. J Virol 77:6867-6878. 23. Yu, X. G., Addo, M. M., Rosenberg, E. S., Rodriguez, W. R., Lee, P. K., Fitzpatrick, CA. , Johnston, M.N. , Strick, D., Goulder, P.J., Walker, B. D. , et al . 2002. Consistent patterns in the development and immunodominance of human immunodeficiency virus type 1 (HIV-I) -specific CD8+ T-cell responses following acute HIV-I infection. J Virol 76:8690-8701.

24. Edwards, B. H., Bansal , A., Sabbaj , S., Bakari, J., Mulligan, M.J., and Goepfert, P.A. 2002. Magnitude of functional CD8+ T-cell responses to the gag protein of human immunodeficiency virus type 1 correlates inversely with viral load in plasma. J Virol 76:2298- 2305.

25. Kalams, S.A., Buchbinder, S. P., Rosenberg, E. S., Billingsley, J. M. , Colbert, D. S., Jones, N. G., Shea,

A. K., Trocha, A. K., and Walker, B. D. 1999. Association between virus-specific cytotoxic T-lymphocyte and helper responses in human immunodeficiency virus type 1 infection. J Virol 73:6715-6720. 26. Rinaldo, C, Huang, X. L., Fan, Z. F., Ding, M., Beltz,

L., Logar, A., Panicali, D., Mazzara, G., Liebmann, J., Cottrill, M., et al . 1995. High levels of anti-human immunodeficiency virus type 1 (HIV-I) memory cytotoxic T-lymphocyte activity and low viral load are associated with lack of disease in HIV-1-infected long-term nonprogressors. J Virol 69:5838-5842. 27. Gillespie, G.M. , Pinheiro, S., Sayeid-Al-Jamee, M.,

Alabi, A., Kaye, S., Sabally, S., Sarge-Njie, R., Njai, H., Joof, K., Jaye, A., et al . 2005. CD8+ T cell responses to human immunodeficiency viruses type 2 (HIV-2) and type 1 (HIV-I) gag proteins are distinguishable by magnitude and breadth but not cellular phenotype. Eur J Immunol 35:1445-1453.

28. Ariyoshi, K., Cham, F., Berry, N., Jaffar, S., Sabally, S., Corrah, T., and Whittle, H. 1995. HIV-2-specific cytotoxic T-lymphocyte activity is inversely related to proviral load. Aids 9:555-559.

29. Zheng, N.N. , Kiviat, N. B., Sow, P. S., Hawes, S. E., Wilson, A., Diallo-Agne, H., Critchlow, CW. , Gottlieb, G. S., Musey, L., and McElrath, M.J. 2004. Comparison of human immunodeficiency virus (HIV) -specific T-cell responses in HIV-I- and HIV-2 -infected individuals in Senegal. J Virol 78:13934-13942.

30. Jaye, A., Sarge-Njie, R., Schim van der Loeff, M., Todd, J., Alabi, A., Sabally, S., Corrah, T., and Whittle, H. 2004. No differences in cellular immune responses between asymptomatic HIV type 1- and type 2- infected Gambian patients. J Infect Dis 189:498-505.

31. Poulsen, A. G., Aaby, P., Gottschau, A., Kvinesdal, B. B., Dias, F., Molbak, K., and Lauritzen, E. 1993. HIV-2 infection in Bissau, West Africa, 1987-1989: incidence, prevalences, and routes of transmission. J Acquir Immune Defic Syndr 6:941-948.

32. Wilkins, A., Ricard, D., Todd, J., Whittle, H., Dias, F., and Paulo Da Silva, A. 1993. The epidemiology of HIV infection in a rural area of Guinea-Bissau. AIDS 7:1119-1122.

33. Ramduth, D., Chetty, P., Mngquandaniso, N. C, Nene, N., Harlow, J. D. , Honeyborne, I., Ntumba, N., Gappoo, S., Henry, C, Jeena, P., et al . 2005. Differential immunogenicity of HIV-I clade C proteins in eliciting CD8+ and CD4+ cell responses. J Infect Dis 192:1588- 1596. 34. Kiepiela, P., Ngumbela, K., Thobakgale, C, Ramduth, D., Honeyborne, I., Moodley, E., Reddy, S., de Pierres, C, Mncube, Z., Mkhwanazi, N., et al . 2007. CD8 ( +) T- cell responses to different HIV proteins have discordant associations with viral load. Nature medicine 13:46-53.

35. Currier, J. R., Visawapoka, U., Tovanabutra, S., Mason, CJ. , Birx, D. L., McCutchan, F. E., and Cox, J. H. 2006. CTL epitope distribution patterns in the Gag and Nef proteins of HIV-I from subtype A infected subjects in Kenya: use of multiple peptide sets increases the detectable breadth of the CTL response . BMC Immunol 7:8.

36. Goulder, P. J. , Brander, C, Annamalai, K., Mngqundaniso, N., Govender, U., Tang, Y., He, S.,

Hartman, K. E., O'Callaghan, CA. , Ogg, G. S., et al . 2000. Differential narrow focusing of immunodominant human immunodeficiency virus gag-specific cytotoxic T- lymphocyte responses in infected African and caucasoid adults and children. J Virol 74:5679-5690.

37. Malhotra, U., Holte, S., Dutta, S., Berrey, M. M. , Delpit, E., Koelle, D. M. , Sette, A., Corey, L., and McElrath, M.J. 2001. Role for HLA class II molecules in HIV-I suppression and cellular immunity following antiretroviral treatment. J Clin Invest 107:505-517.

38. Ogg, G. S., Dong, T., Hansasuta, P., Dorrell, L., Clarke, J., Coker, R., Luzzi, C, Conlon, C, McMichael, A. P., and Rowland-Jones, S. 1998. Four novel cytotoxic T-lymphocyte epitopes in the highly conserved major homology region of HIV-I Gag, restricted through B*4402, B*1801, A*2601, B*70 (B*1509) . Aids 12:1561- 1563. 39. Gamble, T. R., Yoo, S., Vajdos, F. F., von Schwedler, U.K., Worthylake, D. K., Wang, H., McCutcheon, J. P., Sundquist, W.I., and Hill, CP. 1997. Structure of the carboxyl -terminal dimerization domain of the HIV-I capsid protein. Science 278:849-853.

40. Provitera, P., Goff, A., Harenberg, A., Bouamr, F., Carter, C, and Scarlata, S. 2001. Role of the major homology region in assembly of HIV-I Gag. Biochemistry 40:5565-5572. 41. Mammano, F., Ohagen, A., Hoglund, S., and Gottlinger, H. G. 1994. Role of the major homology region of human immunodeficiency virus type 1 in virion morphogenesis. J Virol 68:4927-4936. 42. Martinez-Picado, J., Prado, J. G., Fry, E. E., Pfafferott, K., Leslie, A., Chetty, S., Thobakgale, C, Honeyborne, I., Crawford, H., Matthews, P., et al . 2006. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. J^" Virol 80:3617-3623. 43. Melamed, D., Mark-Danieli, M., Kenan-Eichler, M.,

Kraus, O., Castiel, A., Laham, N., Pupko, T., Glaser, F., Ben-Tal, N., and Bacharach, E. 2004. The conserved carboxy terminus of the capsid domain of human immunodeficiency virus type 1 gag protein is important for virion assembly and release. J Virol 78:9675-9688.

44. Tsomides, T.J., Aldovini, A., Johnson, R. P., Walker, B. D., Young, R.A., and Eisen, H.N. 1994. Naturally processed viral peptides recognized by cytotoxic T lymphocytes on cells chronically infected by human immunodeficiency virus type 1. J Exp Med 180:1283-1293.

45. Chertova, E., Chertov, O., Coren, L. V., Roser, J. D. , Trubey, CM., Bess, J. W., Jr., Sowder, R. C, 2nd, Barsov, E., Hood, B. L., Fisher, R.J., et al . 2006. Proteomic and biochemical analysis of purified human immunodeficiency virus type 1 produced from infected monocyte-derived macrophages. Journal of virology 80:9039-9052.

46. Sacha, J. B., Chung, C, Rakasz, E.G., Spencer, S. P., Jonas, A. K., Bean, A. T., Lee, W., Burwitz, B.J., Stephany, J.J., Loffredo, J. T., et al . 2007. Gag- Specific CD8+ T Lymphocytes Recognize Infected Cells before AIDS-Virus Integration and Viral Protein Expression. Journal of immunology 178:2746-2754.

47. Berry, N., Ariyoshi, K., Jaffar, S., Sabally, S., Corrah, T., Tedder, R., and Whittle, H. 1998. Low peripheral blood viral HIV-2 RNA in individuals with high CD4 percentage differentiates HIV-2 from HIV-I infection. J Hum Virol 1:457-468.

48. Roederer, M., and Koup, R.A. 2003. Optimized determination of T cell epitope responses. J Immunol Methods 274:221-228.

Claims

1. An isolated polypeptide consisting of 9 to 149 contiguous amino acids of the HIV Gag polypeptide sequence shown in SEQ ID NO: 2 to 6 or a functional equivalent thereof, or a sequence showing at least 60% identity to said polypeptide.

2. The isolated polypeptide according to claim 1, wherein the polypeptide consists of 9 to 21 contiguous amino acids of the sequence shown in any one of SEQ ID NOS: 7 to 11 or a functional equivalent thereof, or a sequence showing at least 60% identity to said polypeptide.

3. The isolated polypeptide according to claim 1 or claim 2, wherein the polypeptide consists of the sequence shown in at least one of SEQ ID NOS: 7-21

4. The isolated polypeptide according to any one of claims 1 to 3 , wherein the polypeptide consists of the SEQ ID

NO: 12.

5. An isolated polypeptide which comprises a biologically active fragment of the HIV-2 Gag polypeptide, wherein said fragment consists of the amino acid sequence shown in at least one of SEQ ID NOS: 7 or 12 to 16.

6. An isolated nucleic acid encoding the polypeptide of any one of claims 1 to 5.

7. A vector comprising the nucleic acid of claim 6.

8. The vector according to claim 7 which is an expression vector.

9. A host cell transformed with a vector according to claim 7 or 8.

10. A method of producing a polypeptide according to any^¬ one of claims 1 to 5, said method comprising culturing a host cell transformed with a vector according to claim 8 under conditions which permit expression of said polypeptide and recovering the expressed polypeptide.

11. A vaccine composition comprising the polypeptide of any one of claims 1 to 5 or the nucleic acid of claim 6 and a pharmaceutically acceptable diluent and/or carrier and optionally an excipient and/or adjuvant.

12. The vaccine according to claim 11, comprising the polypeptide of claim 4.

13. A polypeptide according to any one of claims 1 to 5 or the nucleic acid according to claim 6 for use in therapy.

14. A polypeptide according to any one of claims 1 to 5 or the nucleic acid according to claim 6 for use in the prevention or treatment of HIV infection.

15. The polypeptide according to claim 14, wherein said HIV infection is HIV-2 infection.

16. Use of a composition comprising the polypeptide of any one of claims 1 to 5 or the nucleic acid according to claim 6 in the manufacture of a medicament for the prevention or treatment of HIV infection.

17. The use according to claim 16, wherein the HIV infection is HIV-I and/or HIV-2 infection.

18. A method of treating a patient infected with HIV comprising administering a therapeutically effective amount of the polypeptide of claims 1 to 5 or the nucleic acid according to claim 6 to a patient in need thereof.

19. The method according to claim 18, wherein the patient is infected with HIV-I and/or HIV-2.

20. A method of immunising an individual against HIV infection comprising administering to an individual an effective amount of the polypeptide according to any one of claims 1 to 5 or the nucleic acid according to claim 6.

21. An antibody characterised in that it is capable of selectively reacting with the polypeptide of any one of claims 1 to 5.