WO2009119782A1 - Modified photoreceptor channel type rhodopsin protein - Google Patents

Abstract

Disclosed is a novel photoreceptor channel type protein which is improved in various functional properties or is imparted with various functional properties. Specifically disclosed is a modified rhodopsin protein which is characterized in that at least one of two or more transmembrane-structure-containing domains in a photoreceptor channel type rhodopsin protein is a corresponding transmembrane-structure-containing domain derived from channelopsin-1 of Chlamydomonas reinhardtii or a mutant of the transmembrane-structure-containing domain, and/or at least one of the two or more transmembrane-structure-containing domains is a corresponding transmembrane-structure-containing domain derived from channelopsin-2 of Chlamydomonas reinhardtii or a mutant of the transmembrane-structure-containing domain.

Description

 Description Modified Photoreceptor Channel Type Oral Dopsin Protein Technical Field

 The present invention relates to a modified photoreceptor channel-type rhodopsin protein, a polynucleotide encoding the protein, an expression vector containing the polynucleotide, and a cell expressing the protein. Background art

 Chlamydomonas, which normally lives in freshwater ponds, belongs to the green alga, a unicellular eukaryote that has chloroplasts and photosynthesizes. Chlamydomonas has the habit of gathering in light (ie, phototaxis) by receiving light in a special membrane region called the eye point and controlling flagellar movement.

 The gene sequence of the prokaryotic oral dopsin family protein distributed in the eyes of Chlamydomonas reinhardti i has been elucidated and published (GenBank accession number AF461397). This protein is an example of a photoreceptor channel in the biological world because it transmits ions in response to visible light and controls membrane potential (Non-patent Documents 1 and 2).

In Chlamydomonas, there are two prokaryotic oral dopsin proteins, chanenorepsin 1 and channelopsin 2. These are a type of photoreceptor channel that is a single molecule that combines photosensitivity and ion channel functions. Channel opsin 1 has the property of transmitting H ⁺ in response to light when expressed in force oocytes (Non-Patent Document 1). Channelopsin 2 also has a cation permeability such as Na ⁺ and is expressed in cultured mammalian cells (HEK293, BHK) to cause depolarization in response to blue light at 400 to 500 nm. (Non-patent document 2).

Photoreceptor channels such as those described above are expected to be used in a variety of fields, including medical care, welfare 'nursing and information communication. For example, Patent Document 1 discloses that a neuron newly imparted with photosensitivity is created by introducing and expressing channelopsin 2 into a neuronal cell using a genetic engineering method. . In addition, by applying this technology to in vivo and in vitro systems, attempts have been made to make neural cell networks work by light irradiation (Non-Patent Documents 3 to 6).

 Furthermore, it is possible to restore visual acuity by introducing and expressing channelopsin 2 in ganglion cells and bipolar cells using animals whose retinal photoreceptor cells have degenerated due to various causes. (Non-Patent Documents 7 and 8).

 Patent Document 1 Japanese Unexamined Patent Publication No. 2006-217866

 Non-Patent Document 1 Nagel et al., 2002, Science 296, 2395-2398.

 Non-Patent Document 2 Nagel et al., 2003, Proc. Natl. Acad. Sci. USA 100, 13940-13945.

 Non-Patent Document 3 Boyden et al., 2005, Nat. Neurosci. 8, 1263-1268.

 Non-Patent Document 4 Li et al., 2005, Proc. Natl. Acad. Sci. USA 102, 17816-17821.

 Non-Patent Document 5 Ishizuka et al., 2006, Neurosci. Res 54, 85-94.

 Non-Patent Document 6 Arenkiel et al., 2007, Neuron 54, 205-218.

 Non-Patent Document 7 Bi et al., 2006, Neuron 50, 23-33.

 Non-Patent Document 8 Tomita et al., 2007, Invest. Ophthalmol. Vis. Sci. 48, 3821-3826.

 The above-mentioned attempts are based on the concept that photoreceptor channels are introduced and expressed in eukaryotic cells such as mammalian cells and used for functional control such as depolarization caused by light irradiation. . In such photoreceptor channel applications, the photoreceptor channel is generally desired to have functions such as weak inactivation of photocurrent, high conductance, and high frequency response characteristics. No photoreceptor channel has been found to date.

In addition, for example, the introduction and expression of photoreceptor channels in retinal neurons In an attempt to restore the vision of a more blind patient, it would be desirable to have functions such as being able to sense faint light and responding to white light with low wavelength selectivity.

 Therefore, it is very useful to provide a photoreceptor channel having a function desirable for use for function control and having additional functional characteristics depending on the intended use.

 Accordingly, an object of the present invention is to provide a photoreceptor channel type protein having various functional properties improved or imparted.

 In the process of analyzing the structure-function relationship of two types of photoreceptor channel-type proteins derived from the green alga Chlamydomonas, channel opsin 1 and channel opsin 2, As a result, various hybrid apoproteins with recombination of the transmembrane domain were prepared, and among them, it was found that there was a hybrid apoprotein having functional properties different from those of the wild type. In addition, accompanying this, it was possible to identify the transmembrane-containing domain involved in various functional properties of channel opsin 1 and channel opsin 2, and the present invention was completed.

 That is, the present invention includes the following features.

 (1) A modified photoreceptor channel-type oral dopsin protein having a plurality of transmembrane domains, wherein at least one of the transmembrane domains is a Chlamydomonas reinhardti i Is a transmembrane domain derived from 1 or a variant thereof and / or at least one transmembrane domain is derived from the equivalent chinenoreopsin 2 of Chlamydomonas reinhardti i The protein, which is a transmembrane structure domain or a variant thereof.

 (2) 'At least one of the transmembrane domains is a transmembrane domain derived from the corresponding channel opsin 1 of Chlamydomonas reinhardti i or a variant thereof, and at least one of the transmembrane domains is present. The protein according to (1) above, wherein one is a transmembrane domain or a variant thereof derived from a corresponding channel opsin 2 of Chlamydomonas reinhardtii.

(3) The photoreceptor channel-type oral dopsin protein is channel opsin 1, The protein according to (1) above, wherein at least one of the transmembrane domain is a transmembrane domain derived from channel opsin 2 of Chlamydomonas reinhardtii or a variant thereof.

 (4) The protein according to (3) above, wherein the photoreceptor channel-type oral dopsin protein is channel opsin 1 derived from Chlamydomonas reinhardtii.

 (5) Photoreceptor channel type dopsin protein is channel opsin 2 and at least one transmembrane domain is a transmembrane domain derived from the corresponding channel opsin 1 of Chlamydomonas reinhardtii Or the protein according to (1) above, which is a variant thereof.

 (6) The protein according to (5) above, wherein the photoreceptor channel-type oral dopsin protein is chinenorepsin 2 derived from Chlamydomonas reinhardtii.

(7) The protein according to any one of (1) to ( ⁶ ) above, comprising the polypeptide shown in any one of the following (a) to (: 1) or a variant thereof.

 (a) a polypeptide comprising amino acids 1-117 of SEQ ID NO: 2 and amino acids 79-315 of SEQ ID NO: 4

 (b) Polypeptide consisting of amino acids 1 to 164 of SEQ ID NO: 2 and amino acids 126 to 315 of SEQ ID NO: 4

 (c) A polypeptide consisting of amino acids 1 to 184 of SEQ ID NO: 2 and amino acids 146 to 315 of SEQ ID NO: 4

 (d) A polypeptide consisting of amino acids 1-212 of SEQ ID NO: 2 and amino acids 174-315 of SEQ ID NO: 4.

 (e) a polypeptide consisting of amino acids 1 to 242 of SEQ ID NO: 2 and amino acids 204 to 315 of SEQ ID NO: 4

 (f) a polypeptide comprising amino acids 1 to 276 of SEQ ID NO: 2 and amino acids 238 to 315 of SEQ ID NO: 4

 (g) a polypeptide consisting of amino acids 118 to 345 of SEQ ID NO: 2 and amino acids 1 to 78 of SEQ ID NO: 4

(h) a polypeptide comprising amino acids 165 to 345 of SEQ ID NO: 2 and amino acids 1 to 125 of SEQ ID NO: 4 (i) Polypeptide consisting of amino acids 185 to 345 of SEQ ID NO: 2 and amino acids 1 to 145 of SEQ ID NO: 4

 (j) A polypeptide consisting of amino acids 213 to 345 of SEQ ID NO: 2 and amino acids 1 to 4 of SEQ ID NO: 4; L73

 (k) Polypeptide consisting of amino acids 243 to 345 of SEQ ID NO: 2 and amino acids 1 to 203 of SEQ ID NO: 4

 (1) Polypeptide consisting of amino acids 277 to 345 of SEQ ID NO: 2 and amino acids 1 to 237 of SEQ ID NO: 4

 (8) The protein according to (7) above, comprising a polypeptide consisting of amino acids 1-164 of SEQ ID NO: 2 and amino acids 126-315 of SEQ ID NO: 4 or a variant thereof.

 (9) The protein according to (7) above, comprising a polypeptide consisting of amino acids 1 to 242 of SEQ ID NO: 2 and amino acids 204 to 315 of SEQ ID NO: 4 or a variant thereof.

(10) A polynucleotide encoding the protein according to any one of (1) to ( ⁹ ) above.

 (11) An expression vector comprising the polynucleotide according to (10) operably linked to a promoter.

 (12) A cell that expresses the protein according to any one of (1) to (9) above.

 (13) The cell according to (12), which is a nerve cell.

 This specification includes the contents described in the specification and Z or drawings of Japanese Patent Application No. 2008-076538, which is the basis of the priority of the present application. Brief Description of Drawings

 Figure 1 shows (A) amino acid primary structure alignment of Chopl and Chop2, and (B) a transmembrane domain structure of a modified oral dopsin protein in which the C-terminus of the channelopsin gene is replaced with Venus.

 FIG. 2 shows the transmembrane domain structure of the hybrid apoprotein produced in the example.

 Fig. 3 shows a schematic diagram of the experimental apparatus used in the examples.

Figure 4 shows the circuit diagram of the booster circuit used in the example. FIG. 5 shows confocal images of (A) HEK293 cells expressing hybrid Abcdefg and (B) HEK293 cells expressing hybrid ABcdefg.

 Fig. 6A shows photocurrent of HEK293 cells expressing hybrid Abcdefg (upper: blue light, lower: green light) and photoelectric current of HEK293 cells expressing hybrid ABcdefg (upper: blue light, lower: green light) ) Figure 6B shows a comparison of the absorption wavelength response characteristics of the hybrid apoprotein according to the G / B ratio (Green / Blue ratio) of the blue light response and the green light response.

Figure 7A shows the IV relationship of the hybrid Abcdefg photocurrent (black: extracellular Na + concentration 142 mM, red: extracellular Na + concentration 20 mM). Figure 7B shows the IV relationship of the hybrid Abcdefg photocurrent (black: extracellular Na ⁺ concentration 142 mM, red: extracellular Na + concentration 20 mM). Figure 7C shows a comparison of photocurrent reversal potential shifts for each hybrid apoprotein.

 Figure 8 shows the Honore cell conductance per unit membrane capacity of the photoreceptor channel of each hybrid apoprotein.

 Figure 9A shows the relative size of the irradiated pulsed light. Figures 9B and C show the comparison of the current response to the light intensity for the photocurrents of the hybrids Abcdefg and ABcdefg, respectively.

 Figure 10A shows a comparison between the wild-type Chop2 (1-315) abcdefg photocurrent (黑) and the hybrid ABcdefg photocurrent (red). Figure 10B shows the results of quantifying the degree of inactivation by the ratio of steady photocurrent and maximum photocurrent (plateau / peak ratio) for each hybrid apoprotein.

 Fig. 11 A shows a comparison of the rise of photocurrent in hybrid Abcdefg (black) and hybrid ABcdefg (red). Figure 11B shows a comparison of photocurrent termination for hybrid Abcdefg (black) and hybrid ABcdefg (red). Fig. 1 1C shows a comparison of the photocurrent ON rate constant and OFF rate constant between the hybrid apoprotein and the wild type apoprotein.

 Figure 12 shows the transmembrane domain structure and amino acid primary structure of the channel opsin wide receiver (chopWR).

Fig. 13 shows the transmembrane structure of channel opsin 'fast tracer (chopFR). Best mode for carrying out the invention showing the main structure and amino acid primary structure

 The present invention relates to a modified photoreceptor channel-type oral dopsin protein (hereinafter also referred to as “modified rhodopsin protein” or “hybrid apoprotein”). Specifically, at least one of the multiple transmembrane domains possessed by the photoreceptor channel-type rhodopsin protein corresponds to the channel opsin 1 of Chlamydomonas reinhardti i (hereinafter “Chopl”). The membrane-containing transmembrane domain derived from (2), or a variant thereof, and / or the equivalent, the membrane-containing membrane derived from Chlamydomonas reinhardti i channelopsin 2 (hereinafter also referred to as “Chop2”) The present invention relates to a photoreceptor channel-type rhodopsin protein, which is a penetrating domain or a variant thereof.

 As used herein, “transmembrane-containing domain” refers to a region containing a transmembrane structure deduced from homology with bacteriophage dopsin in a photoreceptor channel-type rhodopsin protein.

1. Modified rhodopsin protein

 The modified oral dopsin protein of the present invention comprises a transmembrane domain derived from Chopl or a variant thereof, wherein at least one of the transmembrane domains in the photoreceptor channel type oral dopsin protein corresponds to this It is a transmembrane structure domain derived from Chop2 or a variant thereof, which is and / or equivalent thereto.

 That is, the modified rhodopsin protein of the present invention is preferably a transmembrane domain having a preferable functional property found in Chopl, and / or a preferred one found in Chop2. As a result of including the transmembrane-containing domain having the functional characteristics in the domain of the transmembrane-containing domain corresponding thereto, preferable functional characteristics are maintained.

Chopl及Pi Cho _P 2, in order to have different functional properties, the modified port Dopushi Ntanpaku quality of the present invention preferably has both a preferred functional properties. Therefore, in the present invention, the photoreceptor channel type oral dopsin protein is preferably Chopl. A transmembrane domain having a preferable functional property found in C. and a transmembrane domain having a preferred functional property found in Chop2 in the corresponding transmembrane domain region. .

 1.1 Photoreceptor channel-type rhodopsin protein

 As used herein, a photoreceptor channel-type oral dopsin protein refers to an archaeal type oral dopsin family protein having both a photoreceptor function and a channel function (hereinafter also referred to as “photoreceptor channel function”). Point to. To date, Chopl and Chop2, bacteriorhodopsin, halorhodopsin, sensory mouth dopsin, proteorhodopsin, and green algae opsin protein as structurally closely related proteins belonging to the archaeal type mouth dopsin family. There are known opsin proteins of unknown function found in fungi, and any of them can be used in the present invention.

 The preferred photoreceptor channel-type oral dopsin protein in the present invention is Chopl or Chop2, or a homologue or variant thereof. The gene sequence and amino acid sequence of Chopl and Chop2 are known (Chopl: GenBank accession number AF385748, Chop2: GenBank accession number AF461397). The gene sequence and amino acid sequence of Chopl are shown in SEQ ID NOS: 1 and 2, and the gene sequence and amino acid sequence of Chop2 are shown in SEQ ID NOS: 3 and 4, respectively.

 Here, the “homolog” refers to a protein (or nuclear acid) having the same function derived from different organisms. The homologous protein and the sequence of the nucleic acid that encodes it can be searched using algorithms such as BLAST and FASTA by accessing well-known databases such as NCBI and EMBL. Such homologous nucleic acid or gene can be isolated according to a conventional method. For example, a primer that specifically amplifies a gene identified using a database that stores base sequence information is designed, chemically synthesized, and the above-mentioned primer that uses the genomic DNA extracted from the target organism as a cage is used. The desired homologue of chop 1 or chop 2 gene can be amplified and isolated by PCR.

 The term Chopl (or Chop2) mutant used in the present invention includes Chopl (or

Chop2) amino acid sequence, substitution, addition, insertion or insertion of one to several amino acids A polypeptide having a deletion and functional properties equivalent to those of Chopl (or Chop2), and an amino acid sequence of Chopl (or Chop2) at least 90%, preferably at least 95%, more preferably at least 96 Polypeptides having sequence homology of%, 97%, 98% or 99% sequence homology and functional properties equivalent to Chopl (or Chop2) are included.

 As used herein, “several” is an integer of 10 or less, for example, an integer of 2 to 9, 2 to 7, or 2 to 5. In this specification, the value of sequence homology was calculated using software (for example, FASTA, DNASYS, BLAST, etc.) that calculates the homology between multiple (two) amino acid sequences with default settings. Value.

 In this specification, “equivalent functional characteristics” used in connection with Chopl or Chop2 means that at least one of the functional characteristics such as conductance, optical absorption wavelength characteristics, inactivation characteristics, and frequency response characteristics of Chopl or Chop2 is substantially. Are identical.

The mutant of Chopl (or Cho _P 2) may be a naturally occurring mutant or an artificially introduced mutant. Artificial mutations can be introduced by introducing mutations into the chopl (or cho _P 2) gene using, for example, site-specific mutagenesis or PCR-based mutagenesis. (Proc Natl Acad Sci USA., 1984 81: 5662; Sambrook et al., Molecular Cloning A Laboratory Manual (1989) Second edition, Cold Spring Harbor Laboratory Press; Ausubel et al., Current Protocols in Molecular Biology 1995 John Wiley & Sons) .

Whether or not the above-mentioned Chopl (or Chop2) homologue or mutant has functional characteristics equivalent to those of Chopl (or Cho _P 2) can be determined by, for example, membrane potential recording using electrophysiological methods, membrane current recording, It can be assessed by examining changes in intracellular ion concentration using a fluorescent probe. '

In the present invention, Chopl or Chop2 is not necessarily its length, it may be a fragment of Chopl or Cho _P 2 having a light-receiving channel activity. Chopl or Chop2 is an N-terminal region containing a transmembrane structure (Chopl: 1-345 (SEQ ID NO: 5));

Chop2: 1-315 (SEQ ID NO: 6)) has been reported to have photoreceptive activity, and it is preferable to use a polypeptide containing these regions as the fragment. 1.2 Transmembrane domain

 Chopl and Chop2 are each assumed to have seven transmembrane structures due to their similarity to bacteriodopsin (see Figure 1). In addition, as described above, it has been reported that the N-terminal region (Chopl: 1-345, Chop2: 1-315) including each hypothetical transmembrane structure has photoreceptive channel activity. Therefore, A, B, C, D, E, F, and G are defined as transmembrane-containing domain including each hypothetical transmembrane structure of Chopl, and a photoreceptor channel that holds Chopl's A to G. Type mouth Dopsin protein or fragment thereof

Indicated as ABCDEFG. Similarly, a, b, c, d, e, f, and g are defined as transmembrane structure domains including each hypothetical transmembrane structure of Chop2, and the transmembrane structure domains a to g of Chop2 are retained. Photoreceptor channel type mouth Dopsin protein or fragment thereof is expressed as abcdefg. For example, a photoreceptor channel-type oral dopsin protein or fragment thereof in which A to D are derived from Chopl and e to g is derived from Chop2 is represented as ABCDefg.

 Chopl transmembrane structure domains A to G are amino acid regions shown below.

 Domain A: amino acids 1-117 of the amino acid sequence shown in SEQ ID NO: 2

 Domain B: amino acids 118 to 164 of the amino acid sequence shown in SEQ ID NO: 2

 Domain C: amino acids 165 to 184 of the amino acid sequence shown in SEQ ID NO: 2

 Domain D: Amino acids 185 to 212 of the amino acid sequence shown in SEQ ID NO: 2

 Domain E: amino acids 213 to 242 of the amino acid sequence shown in SEQ ID NO: 2

 Domain F: Amino acids 243 to 276 of the amino acid sequence shown in SEQ ID NO: 2

 Domain G: amino acids 277 to 345 of the amino acid sequence shown in SEQ ID NO: 2

 Chop2 transmembrane domains ag are amino acid regions shown below. Domain a: Amino acids 1 to 78 of the amino acid sequence shown in SEQ ID NO: 4

 Domain b: amino acids 79 to 125 of the amino acid sequence shown in SEQ ID NO: 4

 Domain c: amino acids 126 to of the amino acid sequence shown in SEQ ID NO: 4;

 Domain d: amino acids 146 to 173 of the amino acid sequence shown in SEQ ID NO: 4

 Domainein e: amino acids 174 to 203 of the amino acid sequence shown in SEQ ID NO: 4

 Domain f: amino acids 204 to 237 of the amino acid sequence shown in SEQ ID NO: 4

 Domain g: amino acids 238 to 315 of the amino acid sequence shown in SEQ ID NO: 4

In the present invention, a variant of the transmembrane domain of Chopl (or Chop2) (hereinafter referred to as (Also referred to as “mutant transmembrane domain”) has one to several amino acid substitutions, additions, insertions or deletions in the amino acid region of the transmembrane domain, and has not been modified. At least 90%, preferably at least 95%, more preferably at least 96%, 97%, with respect to the amino acid sequence of the polypeptide having functional properties equivalent to the transmembrane domain, and the transmembrane domain It includes polypeptides having 98% or 99% sequence homology and functional properties equivalent to unmodified transmembrane domains. Note that “several” and sequence homology values are defined above. “Equivalent functional characteristics” used in the context of mutant transmembrane domains are the types of functional characteristics of the mutant transmembrane domains (conductance, light absorption wavelength characteristics, inactivation characteristics, frequency response characteristics, etc.) ) Is substantially the same as the unmodified transmembrane domain, and the properties of the functional properties of the mutant transmembrane domain (conductance intensity, light absorption wavelength range, degree of inactivation of photocurrent) The degree of frequency response etc.) is substantially the same as the unmodified transmembrane domain.

 The mutant transmembrane domain may be a naturally occurring one or an artificially introduced mutation. Artificial mutations can be introduced by introducing mutations into a polynucleotide encoding a transmembrane domain using, for example, site-specific mutagenesis or PCR-based mutagenesis. Yes (Proc Natl Acad Sci USA., 1984 81: 5662; Sambrook et al., Supra; Ausubel et al., Supra) ο

 1.3 Construction of modified rhodopsin protein

 The modified oral dopsin protein of the present invention is a transmembrane domain or a variant thereof derived from Chopl, in which at least one of the transmembrane domains in the photoreceptor channel type oral dopsin protein corresponds to this. Is and / or equivalent

It is a transmembrane domain derived from Chop2 or a variant thereof. In other words, in the modified oral dopsin protein of the present invention, at least one transmembrane domain in the photoreceptor channel type oral dopsin protein is equivalent to the transmembrane domain derived from Chopl, which corresponds to this domain. Alternatively, it can be said that it is substituted with a mutant thereof, and / or is substituted with a corresponding transmembrane domain derived from Chop2 or a mutant thereof. This allows for the preferred functional characteristics of Chopl or Chop2. Can be provided. “Equivalent transmembrane domain” is the same as the transmembrane domain to be replaced in the type of functional characteristics (conductance, light absorption wavelength characteristics, inactivation characteristics, frequency response characteristics, etc.) However, it refers to domains with a transmembrane structure that have the same or different functional properties (conductance strength, light absorption wavelength range, degree of photocurrent inactivation, frequency response, etc.). For example, the transmembrane domain of Chop2 corresponding to the domain A of Chopl is the domain a.

 In addition, since the Chopl transmembrane domain and the Chop2 transmembrane domain have different functional properties, both the Chopl transmembrane domain and the Chop2 transmembrane domain are various. By holding them in combination, it is possible to provide a lineup of photoreceptor channel-type rhodopsin proteins having various functional properties.

 For example, based on the functional properties of Chopl's transmembrane domain A to G and Chop2's transmembrane domain ag, the modified oral dopsin protein of the present invention has increased conductance and long wavelength photoresponse. It can have at least one of the following functional characteristics: increased performance, weak inactivation, and high frequency response.

 An increase in conductance is a preferable functional characteristic in that a large membrane potential response and membrane current response are generated even for weak light.

 The increase in the long wavelength photoresponsiveness is a preferable functional characteristic in that the wavelength band of light that can be used for activation is expanded and the response to white light is increased.

 Weak inactivation is a favorable functional characteristic in that the light input pattern is more accurately reflected in the membrane potential and membrane current, and the response is not attenuated by repeated stimulation.

 High frequency response is a preferable functional characteristic in that the response to optical information that fluctuates at high frequencies is not attenuated.

 When the photoreceptor channel-type oral dopsin protein is Chopl, the modified oral dopsin protein of the present invention is replaced with at least one of the transmembrane domains of Chopl (for example, domain A), instead of Chop2 It can be created by retaining a transmembrane domain (eg domain a).

In addition, when the photoreceptor channel-type rhodopsin protein is Cho _P 2, The modified rhodopsin protein of the invention is created by retaining Chopl's transmembrane domain (eg, domain A) instead of at least one (eg, domain a) of Chop2's transmembrane domain. be able to.

 Examples of such modified oral dopsin protein created between Chopl and Chop2 include proteins including the following exemplified polypeptides or variants thereof.

 (Abcdefg) A polypeptide comprising amino acids 1 to 5 of SEQ ID NO: 2; L17 and amino acids 79 to 315 of SEQ ID NO: 4

 (ABcdefg) A polypeptide consisting of amino acids 1-164 of SEQ ID NO: 2 and amino acids 126-315 of SEQ ID NO: 4.

 (ABCdefg) Polypeptide consisting of amino acids 1 to 184 of SEQ ID NO: 2 and amino acids 146 to 315 of SEQ ID NO: 4

 (ABCDefg) A polypeptide consisting of amino acids 1-212 of SEQ ID NO: 2 and amino acids 174-315 of SEQ ID NO: 4.

 (ABCDEfg) A polypeptide comprising amino acids 1 to 242 of SEQ ID NO: 2 and amino acids 204 to 315 of SEQ ID NO: 4.

 (ABCDEFg) A polypeptide consisting of amino acids 1 to 276 of SEQ ID NO: 2 and amino acids 238 to 315 of SEQ ID NO: 4

 (aBCDEFG) A polypeptide consisting of amino acids 118 to 345 of SEQ ID NO: 2 and amino acids 1 to 78 of SEQ ID NO: 4.

 (abCDEFG) A polypeptide consisting of amino acids 165 to 345 of SEQ ID NO: 2 and amino acids 1-125 of SEQ ID NO: 4.

 (abcDEFG) A polypeptide comprising amino acids 185 to 345 of SEQ ID NO: 2 and amino acids 1 to 145 of SEQ ID NO: 4.

 (abcdEFG) Polypeptide consisting of amino acids 213 to 345 of SEQ ID NO: 2 and amino acids 1 to 173 of SEQ ID NO: 4

 (abcdeFG) Polypeptide consisting of amino acids 243 to 345 of SEQ ID NO: 2 and amino acids 1 to 203 of SEQ ID NO: 4

(abcdefG) amino acids 277 to 345 of SEQ ID NO: 2 and amino acids 1 to 237 of SEQ ID NO: 4 Polypeptide consisting of

 Each variant of the above polypeptide has one to several amino acid substitutions, additions, insertions or deletions in each amino acid sequence of the above polypeptide, and is equivalent to the above polypeptide. And at least 90%, preferably at least 95%, more preferably at least 96%, 97%, 98% or 99% sequence homology to the amino acid sequence of said polypeptide. And a polypeptide having functional properties equivalent to those of the polypeptide. Note that “several”, sequence homology values, and “equivalent functional properties” are defined above.

 The mutants may be naturally occurring or artificially introduced with mutations. Artificial mutations are introduced by, for example, site-directed mutagenesis or active mutagenesis using PCR (Proc Natl Acad Sci USA., 1984 81: 5662; Sambrook et al., Supra. In addition to Ausubel et al., The above), it may be produced from a convenient aspect of production, such as an operation for increasing the expression efficiency of the above-mentioned polypeptide.

Among the modified oral dopsin proteins created between Chopl and Chop2, ABCDEfg (hereinafter also referred to as “channel opsin” wide receiver (chop WR) J) has conductance and long-wavelength light absorption. The size, weakness of inactivation, etc. are remarkably superior, and the selectivity to Na ⁺ ions is high.The channelopsin wide receiver is excellent in the reception of faint light. It is a modified type of oral dopsin protein that is excellent for use in cells that are deep in the region.

 Among the above modified oral dopsin proteins, ABcdefg (hereinafter also referred to as “channel opsin 'fast receiver (chop FR) J)” is remarkably superior in frequency response characteristics. The channelops fast receiver is excellent in accepting optical information that fluctuates at high frequencies, for example, a neural cell network module that can input information by light. It is an excellent modified type of dopsin protein.

 1.4 Production of modified rhodopsin protein

The modified oral dopsin protein of the present invention is a photoreceptor channel type oral dopsin tongue. Based on the sequence information of protein gene, chopl gene and chop2 gene, it can be produced by genetic engineering techniques.

Specifically, first, a polynucleotide encoding the modified oral dopsin protein of the present invention (hereinafter also referred to as “modified oral dopsin gene”) is prepared. The modified oral dopsin gene can be prepared by techniques known to those skilled in the art. For example, the sequence information of the gene encoding the photoreceptor channel type load de trypsin proteins, based on chopl gene及Pi cho _P 2 gene sequence information, the desired modified port Dopushinta protein co one de polynucleotide It can be chemically synthesized. Alternatively, based on the above sequence information, a PCR primer that amplifies the desired region of the photoreceptor channel-type oral dopsin gene and a PCR primer that amplifies the desired domain of the chopl gene and / or chop2 gene are designed and chemically synthesized. By the PCR using the genomic DNA extracted from the target organism as a cocoon, a polymorphism encoding the photoreceptor channel type mouth dopsin gene region constituting the modified mouth dopsin gene and the Chopl and / or Chop2 domain region. It may be prepared by amplifying each nucleotide and ligating them.

 Next, the modified rhodopsin gene of the present invention operably linked to the promoter can be maintained in the host cell, and the protein can be stably expressed, and the gene can be stably expressed. The modified expression vector of the present invention can be produced in the host by transforming the host using the obtained recombinant expression vector, which is incorporated into an expression vector that can be maintained. For recombination techniques, see Sambrook et al. (Supra), Ausubel et al. (Supra).

Examples of expression vectors include, but are not limited to, plasmids derived from Escherichia coli (eg, pET28, pGEX4T, pUC118, pUC119, pUC18, pUC19, and other plasmid DNAs), Bacillus subtilis ( Bacillus subtil is) (eg, pUB110, pTP5, and other plasmid DNA), yeast-derived plasmids (eg, YEpl3, YEp24, YCp50, and other plasmid DNA), phage (; L gtl l, λ ZAP, etc.), mammalian plasmids (pCMV, pSV40), viral vectors (adenovirus vectors, adeno-associated winores vectors, retrovirus vectors, lentiwinoles vectors, ヮ kucinia winores vectors, etc.) The baki Insect virus vectors such as mouth virus vectors), plant vectors (binary vectors such as pBi), cosmid vectors, and the like can be used.

 As used herein, “operably linked” refers to a functional sequence between a promoter sequence and a polynucleotide sequence of interest such that the promoter sequence can initiate transcription of the polynucleotide sequence of interest. This is a simple bond.

 The promoter is not particularly limited, and a suitable promoter may be selected depending on the host, and any of a constitutive promoter and an inducible promoter known in the art may be used. In the present invention, it is particularly preferable to use a constitutive promoter. For example, promoters that can be used in the present invention include CMV promoter, SV40 promoter, CAG promoter, synapsin promoter, oral dopsin promoter, CaMV promoter, corn sugar enzyme promoter, lac promoter, trp promoter, tac promoter, GAPDH Examples include promoters, GAL1 promoter, PH05 promoter, PGK promoter, thyl promoter and the like.

 Insertion of the modified rhodopsin gene into the expression vector is, for example, creating or ligating a restriction enzyme site flanking the modified rhodopsin gene and inserting it into the restriction enzyme site or multiple cloning site of an appropriate vector. By doing. In addition to promoters and modified rhodopsin genes, expression vectors include drugs such as enhancers and other cis elements, splicing signals, poly A-added signals, selection markers (ampicillin resistance markers, tetracycline resistance markers, etc.) Resistance gene markers, auxotrophic complementary gene markers such as LEU1, TRPi, and URA3, dominant selection markers such as APH, DHFR, and TK), liposome binding sites (RBS), and the like.

 In order to transform the host, the protoplast method, the spheroplast method, the combinatorial cell method, the virus method, the calcium phosphate method, the ribofusion method, the microinjection method, the gene bombardment method, the agrobatterium method, the electroporo method For example.

The obtained transformant is cultured under a suitable condition using a medium containing an assimilating carbon source, nitrogen source, metal salt, vitamin and the like. Transformants are usually cultured by shaking culture or Is performed at 25-37 ° C for 3-6 hours under aerobic conditions such as aeration and agitation. During the culture period, the pH is kept near neutral. The pH is adjusted using an inorganic or organic acid, an alkaline solution, or the like. During the culture, an antibiotic such as ampicillin or tetracycline may be added to the medium according to the selection marker inserted into the recombinant expression vector, if necessary. The host used for transformation is not particularly limited as long as it can express the modified oral dopsin protein of the present invention. Bacteria (such as Escherichia coli and Bacillus subtilis), yeast (such as Saccharomyces cerevisiae), Examples include animal cells (COS cells, Chinese nomstar ovary (CH0) cells, 3T3 cells, BHK cells, HEK293 cells, etc.) and insect cells. The modified oral dopsin protein of the present invention is separated from a culture obtained by culturing a transformant (culture supernatant, cultured cell, cultured cell, cell or cell homogenate, etc.) by a general method. It can be obtained in such a way that its activity is maintained by ultrafiltration concentration, freeze drying, spray drying, crystallization, etc. Alternatively, the modified rhodopsin protein of the present invention may be provided in the form of a cell that expresses the protein without isolation and purification. In this case, the host cell used for transformation is a host cell suitable for the subsequent use, for example, a nerve cell, preferably a human nerve cell.

 In addition, when the modified oral dopsin protein of the present invention is used for medical purposes, it may be provided in the form of the protein expression vector. In this case, it is preferable to use an expression vector excellent in efficiency of introduction into cells, maintenance of replication in the cells, stability, expression efficiency, and the like. Examples of such vectors include, but are not limited to, viral vectors such as adeno-associated virus vectors, retrovirus vectors, and lentivirus vectors, plasmids capable of autonomous replication, and transposons. it can.

2. Application

Park Teri O rhodopsin, which is one of the photoreceptor channel port Dopushin is since its function is revealed, visual recovery (for example, JP 2002-363107) or re searching tool (e.g. Kohyo basic research ² 004 As well as photoelectric conversion elements (for example, JP-A-2002-271265, JP-A-2000-67939), optical information storage materials (for example, JP-A-2006-515683), or neural model elements (for example, JP-A 6-295350) It is a substance that has been obtained. However, since one electron moves per photon, which is a feature of bacteriorhodopsin, there remains a problem to be solved for use in the above applications.

 On the other hand, in the case of channel mouth dopsin, the ion channel is opened by absorbing one photon, so the number of electrons moving is much larger, and as a result, highly efficient photoelectric conversion is expected. On the other hand, wild type channel dopsin also has problems such as the need to consider the effects of desensitization.

 According to the present invention, various lineups of modified rhodopsin proteins having functional characteristics that differ greatly from the wild type photoreceptor channel-type rhodopsin proteins can be obtained. Therefore, modified rhodopsin protein can be selected and used according to the application.

 2.1 Visual recovery and availability of treatment

 In the human eye, light is sensed by receptor cells in the retina, and the activity is transmitted to ganglion cells via bipolar cells. The neurites of ganglion cells send nerves to the brain as optic nerves. In retinitis pigmentosa and age-related macular degeneration, visual loss is lost due to degeneration of receptor cells. The former has a genetic background and is blinded when it is relatively young, but it is said that there are 1.5 million patients worldwide. The latter is the biggest cause of blindness at age 65 and older. In such patients, retinal ganglion cells are healthy. Therefore, retinal bipolar cells and ganglion cells are not inherently light sensitive, but by introducing and expressing wild-type Chop2 (1-315) abcdefg into retinal neurons via genetic engineering methods, Research to restore vision is underway. For this purpose, oral dopsin protein requires the following characteristics: (i) Sensitive to weak light; (ii) Low wavelength selectivity and response to white light; iii) Photocurrent inactivation is weak. Wild-type Chop2 (1-315) abcdefg is not excellent in these properties because of its high selectivity to blue light and strong photocurrent inactivation.

In contrast, channel opsin wide receivers, for example, have excellent conductance, response to a wide wavelength range from blue to green, and almost no photocurrent inactivation. Because of its characteristics, it is deep in the organization It is expected to impart high photosensitivity to cells.

 Therefore, it is expected to be the most suitable material for visually impaired people with degeneration of retinal photoreceptor cells to restore high-resolution vision completely non-invasively and improve their living ability.

 Specifically, the modified oral dopsin protein of the present invention (for example, a channelopsin wide receiver), an expression vector containing a polynucleotide encoding the protein, or a eukaryotic cell (for example, an optic nerve) that expresses the protein. Cell) can be used as a pharmaceutical composition for restoring visual function.

 2.2 Introduction to the nerve cells of the auditory system

 The nerve cells of the auditory system are known to have a high frequency of several hundred Hz. In order to cause high-frequency activity in these neurons by light irradiation, it is necessary that the inactivation of the photocurrent is weak and that the frequency response characteristic is high. Therefore, for example, by using a channel opsin fast receiver (chopFR), it is expected to cause high frequency activity in these neurons.

2.3 Applicability as a research tool in basic research

 In addition to mammals such as mice, rats, and monkeys, various types of animals such as zebrafish, insects, stink bugs, and nematodes are used to study the functions of neurons and the networks they create. In order to study the functions of proteins encoded by genes in organisms, it is essential to study the functions of neurons and synapses. In developing drugs that affect the nervous system, it is necessary to assess how these chemicals modify the functions of nerve cells and synapses. These studies are carried out by stimulating nerve cells in the in vivo or in vitro nervous system and measuring animal behavior and synaptic activity caused thereby. Stimulation of nerve cells is generally performed by bringing a monopolar or bipolar stimulation electrode close and energizing a short electric pulse. However, it is difficult to specify the number, location, and type of nerve cells that are stimulated.

On the other hand, by introducing a gene into a neuronal cell and expressing the photoreceptor channel, the neuronal cell can acquire photosensitivity. Attempts have been made to stimulate the vesicles. However, the photocurrent of wild-type channel rhodopsin (eg Chop2) quickly desensitizes and takes tens of seconds to recover from desensitization. Therefore, it is difficult to repeatedly stimulate frequently.

 The photoelectric current obtained when expressing the modified oral dopsin protein of the present invention, for example, channelopsin.wide receiver or channelopsin 'fast receiver, has high conductance and weak inactivation. Suitable for repeated stimulation purposes. Since the channel opsin wide receiver has a large absorption on the long wavelength side, it is possible to generate a larger photoelectric current by using broadband light. Therefore, the light pulse can surely cause a large depolarization exceeding the action potential threshold value in the nerve cell, and high reliability is expected. In addition, the channel opsin 'fast receiver 1 is suitable for the purpose of activating nerve cells at a high frequency because of its high following frequency.

 By using these modified mouth dopsin proteins, it is expected to promote the research on the functions of neurons and the networks made by neurons, and the development of drugs that use these functions in the assembly system. In addition, recombinant virus vectors incorporating these modified rhodopsin protein genes and transgenic animals such as mice, rats, zebrafish, Drosophila, nematodes, etc. will be produced and widely applied in research and development. There is expected.

 2.4 Application to Brain 'Machine' Interface (BMI), Brain 'Computer One' Interface (BCI)

 The technology that decodes brain information and uses it to control the machine and input information to the computer as well as to input information to the brain is the brain 'machine interface (BMI), brain' computer 'interface ( BCI). These are technologies that enable new communication through the brain, and in order to realize these technologies, development of a minimally invasive and long-term stable interactive information technology for brain information is indispensable. It is ideal to use light as a bi-directional information medium to realize information input / output with high density and high resolution in time and space. Also, by using light, mechanical invasion to the brain can be minimized.

Modified oral dopsin protein of the present invention, such as channelopsin. One bar or channel opsin. Fast receiver is expected to be the most suitable medium for inputting information into the brain using light.

 2.5 Computer element development using neural network

 Computers have excellent ability to process information quickly and accurately. In addition, the network enables real-time communication with computers all over the world. The brain, on the other hand, excels in the ability to actively create errors and derive the best answer for the environment and situation from many options. This ability is the source of inspiration and emotion. Therefore, an attempt has been made to create a computer that can process information closer to the brain by combining a neuron network with artificial hardware. As a specific method, a silicon substrate or a glass plate is processed, electrodes for stimulation and measurement are arranged on a matrix, and cultured neurons and brain slices are set thereon.

 Attempts have also been made to use living animal brains for computer information processing. As a method for stimulating neurons, an electric stimulation method using a metal or a semiconductor electrode or a glutamic acid administration method has been used. The conventional method has a problem that the spatial resolution is low. Furthermore, when a living animal is used, it is invasive because it is necessary to embed a multi-electrode stimulation device in the brain, and it is difficult to use it safely for a long time. Katsuta.

On the other hand, by introducing a photoreceptor channel into a neuron and expressing it, the neuron can acquire photosensitivity. In the case of cultured neurons, by using one laser, etc., it becomes possible to stimulate individual neurons and even some of them simultaneously, and send complex patterns of information to the neuron network. This makes it possible to reproduce the trial and error information processing performed by the brain, even with a simple cultured neuron network. When using the cerebral cortex of a living animal, multiple points of pattern stimulation can be realized with high resolution by irradiating light from the brain surface. When light stimulation is used, there is no electrical artifact, so it is easy to measure the activity of individual neurons in real time and feed back to the computer. As a result, the ability of the brain, such as pattern recognition and self-organization, has been improved. It is expected that a computer with the ability will be made.

 The modified oral dopsin protein of the present invention, for example, channel opsin / wide receiver bar or channel opsin / fast receiver, is expected to be optimal as an information input medium to nerve cell networks using light. . In addition, there is a prospect that multi-channel information can be input to the neuronal network using the difference in light absorption characteristics of these modified oral dopsin proteins. For example, it is considered that multi-channel input using the difference in photocurrent wavelength dependency between channel-capable pushin wide receiver and channel opsin fast receiver will be possible.

 2.6 Development of micromachine (MEMS) using muscle power

 Muscle fibers (muscle cells), which are the smallest unit of muscle, are very small, but can generate strong force. It is also very energy efficient. Because of these advantages, attempts have been made to use biological contraction mechanisms to power micromachines (Soong et al., 2000; Bachand and Montemagno, 2000; Hess et al., 2004; Shu et al., 2003; Xi et al., 2005). However, when operating a micromachine, there is a problem of how to control and drive the contraction mechanism in time and space. In muscle, the motor nerves of the spinal cord form almost one-to-one synapses in muscle fibers. When motor nerves are excited, action potentials are generated at the synaptic site of the muscle fiber through the synapse, which conducts the muscle fiber plasma membrane and depolarizes the T-tubule, thereby causing muscle contraction. . Therefore, subtle movements are controlled by controlling the contraction of each muscle fiber at the nerve cell level. However, it is very difficult to control the activity by letting an artificial micro machine control the nerve. Although it is ideal to stimulate individual muscle cells directly, conventional electrical stimulation methods have limited temporal and spatial control.

In producing muscle cells and myoblast clones incorporating photosensitivity by genetic engineering and controlling muscle contraction directly with light, the modified oral dopsin protein of the present invention, such as channel opsin wide receiver and channel opsin '' Fastresi bar is expected to be optimal as a muscle contraction medium using light. Furthermore, the construction of a system that can freely operate such an optically operated micromachine under a microscope is expected. For example, Microscissors that cut an object under a microscope, For example, a micrograbber that bites, a microconveyor that carries the object, and a mic mouth worm that swims in liquid. These are expected to be used in precision microsurgery under a microscope, for example, surgery that removes cancer cells while protecting blood vessels and nerves in tissues.

 EXAMPLES Hereinafter, the present invention will be described in detail with reference to examples, but the present invention is not limited to the following examples.

 (Example)

 (1) Preparation of hybrid molecules

 In this example, first, 12 types of hybrid apoproteins shown in FIG. 2 were prepared from Chopl (1-345) ABCDEFG and Chop2 (1-315) abcdefg.

 These hybrid apoproteins were prepared by overlap extension PCR. The process will be specifically described below.

 The overlap extension PCR method consists of two steps. First, in the first step, the cDNA fragment encoding the N-terminal amino acid residue sequence and the cDNA fragment encoding the C-terminal amino acid residue sequence of the hybrid apoprotein to be prepared are each obtained by PCR. Make it. At this time, the reverse primer used when preparing the N-terminal fragment and the cDNA sequence of the forward primer used when generating the C-terminal fragment are designed to have a complementary relationship. For example, when preparing hybrid Abcdefg, the cDNA fragment of the A domain is a combination of chopl-345-EcoRI-F1 and chop-chRl primer, and the cDNA fragment of the bcdefg domain is chop-chFl and chop2-315-EcoRI. -In combination with R1, make Chop l (1-345) and Chop2 (l- 315) into a saddle,

PCR was performed using KOD-Plus-DNA polymerase (Toyobo) to prepare each fragment. In the second step, the A and bcdefg fragments are mixed and PCR is performed using KOD-Plus-DNA polymerase. At this time, one end of the A fragment and the bcdefg fragment contains mutually complementary sequences.

CDNA extension occurs between the sense strand of the A fragment and the antisense strand of the bcedfg fragment, and a chimeric molecule called Abcdefg is created. Similarly, in the production of hybrid ABcdefg, chopl-345- EcoRI- F1 and chop-chR2 yarns are combined. The cdefg fragment was prepared using a combination of chop-chF2 and chop2-315-BamHI-R1, and the ABcdefg fragment was prepared by the second PCR. Table 1 summarizes the names and sequences of the primers used for the preparation of the hybrid apoprotein, and Table 2 summarizes the combinations of primers used for the preparation of the hybrid apoprotein and the cDNA used for the saddle type.

 table 1

No. Forward primers Sequences (5 '-> 3')

 1 chop2-315 "EcoRPFl gcgaattccaccatggattatggaggcgccctg

 2 chop-chFl tggaagtctacttgcggctgggaggag

 3 chop-chF2 gtggcttcgttacgcggagtggctgct

 4 chop-chF3 tctggcgaacgactatagcaggcgcaccatggg

 5 chop-chF4 tgtccaagggatacgtcaaggtcatcttcttc

 6 chop-chF5 gaggcgtaccacaccgtgccgaagggc

 7 chop-chF6 ctgttcctgctgggccccgagggcttcggc

 8 chop-c F7 cttgtccaacgactacaacaagcg accatgg

 9 chop-c F8 ggccacc ^ gatacgtccgtgtcattttcttc

 10 chop-chF9 catcga ^ ggttaccacaccgtgcccaaggg

 11 chopl-345-EcoRI-Fl gcgaattccaccatggcgcggaggccatggcttc

No. Reverse primers Sequences (5,-> 3,)

 12 cliop2 "315-BamHI-Rl gcggatccttgccggtgcccttgttgaccg

 13 c op-chEl atctcctcccagccgcaagtagacttcca

 14 cliop "chR2 agcagccactccgcgtaacgaagccac

 15 cliop "chE3 atggtgcgcctgctatagtcgttcgccagacc

 16 cliop-chE4 gaagaagatgaccttgacgtatcccttggaca

 17 chop "chR5 gaagaagatgaccttgacgtatcccttggaca

 18 chop-c R6 gaagaagatgaccttgacgtatcccttggaca

 19 chop-chR7 ggtacgcttgttgtagtcgttggacaagcccg

 20 chop "c R8 gaaaatgacacggacgtatccggtggccatgg

 21 chop-c R9 cccttgggcacggtgtggtaaccctcgatg

22 chopl-345-BamHI-Rl gcggatcctcgtcgtcctcctcgtgcacca Combine and mold type

Both ends of the hybrid apoprotein cDNA fragment prepared by overlap extension PCR are cleaved by restriction enzymes EcoRI and BamHI. The The cDNA fragment treated with both restriction enzymes was cloned between EcoRI and BamHI of the pVenus-Nl vector (Clontech's pDsRed2-N1 vector DsRed2 was replaced with Venus) and placed on the C-terminal side of the hybrid apoprotein. A plasmid vector for mammalian cell expression that expresses a fusion protein with Venus added, a kind of yellow fluorescent protein, was prepared.

 (2) HEK293 cell culture

 HEK293 cells derived from human fetal kidney cells were cultured and maintained on a 60 mm plastic dish (BD Falcon PRIMARIA dish). The culture solution is 90% D-MEM, 10 ° /. Fetus fetus serum was used. Gene transfer was performed when 30-50% confluent after passage into a 4-well plate (NUNC) with collagen coating. The day after gene transfer, the cells were dispersed by trypsin treatment, and the cells were reseeded on a 12 brittle round cover glass that had been subjected to collagen coating, and the function test was performed the next day. One isolated cell was used for the functional test.

 (3) Gene transfer

 For the introduction of the oral dopsin apoprotein gene into HEK293 cells, Qiagen's Effectene (registered trademark) Transfection Reagent was used, and the gene was introduced by the method specified by the manufacturer. For gene transfer, a 0.2- to 26-mouth oral dopsin apoprotein expression plasmid was used per 12 mm round cover glass.

 (4) Experimental equipment

 Mouth dopsin apoprotein conjugated with retinal responds to light wavelengths of 400-550 nm, so it does not contain blue to green light when cells are transported under a microscope or observed in a bright field. Had made. We used a yellow fluorescent lamp (Panasonic FL 40S. Y-F) for lighting in the laboratory, blocking light with a wavelength of 520 nm or less. The background color of the CRT monitor was changed to yellow. All of the following devices were installed on an air table to eliminate the effects of vibration. It was also installed in the curtain to eliminate the effects of room light. Figure 3 shows an outline of the main equipment.

(i) Upright epi-illumination microscope (Olympus BH2-RFC): Transmitted light during cell observation was blocked through light with a wavelength of 490 nm or less via a GIF filter. Venus was excited. A xenon lamp light source was used for observation, and the ON / OFF of the light was controlled by an electromagnetic shutter. F By combining the filter and dichroic mirror, the excitation light wavelength

450-490 nm, fluorescence wavelength> Cells expressing Chop2-Venus were identified by 515 nm. A 60 × water immersion lens (Olympus LUMplanPl / IR60x) was used as the objective lens.

(ii) Switching between blue light (477 ± 10 nm) and green light (532 ± 10 nm): A xenon lamp was used as the incident light source. The electromagnetic shutter was driven by a square wave pulse current created by an electrical stimulator (Nihon Kohden SEN-720 ³ ) to control the light ON-OFF. A blue light bandpass filter (477 ± 10 nm) and a green light bandpass filter (532 ± 10 nm) were switched by a chipper (Olympus 0SP-EXCH) in the middle of the optical path. The light was introduced into the microscope objective through a dichroic mirror.

 (ii i) Blue light-emitting diode (LXHL-NB98; Lumileds Lighting Inc.): The pulse is generated by patch clamp control software (Axon p-Clamp 9.1), and the digital-analog converter (Axon DIGIDATA1200) and electrical The rectangular wave pulse current created by the stimulator (Nihon Kohden SEN-7203) was amplified in the booster circuit (Fig. 4) and turned on. The diode light was introduced into the microscope objective lens through a dichroic mirror.

 (iv) Monochromator (JASCO CAM-230): Spectroscopy xenon lamp light to extract an arbitrary wavelength of 10nm width. The extracted light was introduced into an epifluorescence microscope using an optical fiber. Light on / off was controlled by a built-in electromagnetic shutter.

 (v) Microscope XY drive device (Medical Agent 0XY-1): A 3D micro-mapulator described later was installed on the fixed part, and the upright epi-illumination fluorescent microscope was installed on the drive part. The micrometer controlled the drive in the X-Y2 axis direction finely.

 (vi) Three-dimensional micromanipulator (Narishige MX-1R): A patch electrode holder, which will be described later, was driven in the X-Y-Z triaxial directions. Each drive shaft uses both coarse and fine motion modes.

 (vii) Measuring chamber: A transparent acrylic plate was processed and a cover glass was attached to the lower part. Tyrode liquid (see Table 3 below) was circulated through the chamber by a peristaltic pump. A force bar glass with cultured cells attached was placed in the chamber.

(vi ii) Photodiode (Sharp BS500B): Scattered before the microscope objective lens Light was received and amplified by a microelectrode amplifier ₍ Table 3).

 Tyrode solution (pH adjusted to 7.4)

Low Na ⁺ Thai Mouth Solution (ϋΗ to 7.4

 Pipe clamp pipet solution (pH adjusted to 7.4)

The ion-permeable experiments, replacing the Cs ⁺ in Na +.

(5) Measurement and recording equipment and data analysis The membrane potential and membrane current of HEK293 cells were measured simultaneously. In addition, the intensity of the irradiated light was measured simultaneously as the photodiode current. These were converted from analog to digital and recorded on a computer. The following apparatus was used for the measurement.

 (i) Patch clamp amplifier (Axon AXOPATCIEOOA): The membrane current was measured when the membrane potential was maintained constant by feedback through the notch electrode (potential fixation experiment).

 (i i) Microelectrode amplifier (Nihon Kohden MEZ-8201): Photocurrent was measured while applying a reverse current of 20 nA to the photodiode. The measured value was expressed as a value relative to the maximum output of the blue light emitting diode.

 (ii i) Analog-to-digital converter (Axon DIGIDATA1200): The current output and voltage output of the patch clamp amplifier and the voltage output of the microelectrode amplifier were converted from analog to digital and output to a computer. In addition, a rectangular wave pulse created by a computer was output externally.

 (iv) Computer (Dell Optiplex GXi): The data was acquired using a no-o-clamp control software (Axon p-Clamp 9.1). In addition, a square wave pulse was created. Clamp-fit Ver. 9.2 (Axon) and Microsoft Excel were used for data analysis.

 (6) Whole cell patch clamp method

The properties of wild-type Chopl and 2, and the hybrid apoprotein were confirmed by the whole cell patch clamp method. In other words, a 1.5 mm diameter glass tube (Harhard Aparathus GC150) is heated and pulled using a patch pipette puller (Narishige PC-10), and a 3-4 m tip glass tube pipette (patch pipe). (Pet) was prepared, and the tip was heated and polished with a microforge (Narishige MF-830). A patch electrode was prepared by filling the solution in the patch pipette (Table 3) up to the tip of the patch pipette. The patch electrode was fixed to the patch electrode holder. Under an upright epifluorescence microscope, cells expressing mouth dopsin apoprotein were identified by Venus fluorescence. While applying positive pressure to the patch electrode, approach the cell, press against the cell surface to create dimples, switch to negative pressure to attach the cell membrane to the glass tube, and apply a stronger negative pressure to the glass tube. Breaks the membrane of the part attached to the cell, electrically connects the inside of the cell and the inside of the glass tube (Whole cell mode). The following potential fixation experiment was performed in the whole cell mode.

 (7) Identification of transmembrane domains that control photoresponse characteristics

 As a marker for these hybrid apoproteins, a construct cDNA was prepared by coordinating Venus, one of the green fluorescent protein GFP variants derived from the jellyfish, to the C-terminal. When these were introduced and expressed in HEK293 cells, high expression was observed in the plasma membrane in all two types of hybrid apoproteins (Fig. 5). In other words, it was suggested that the structure as a membrane protein was maintained. Using Venus's fluorescence as a clue, the cells were identified, and the photocurrent was measured with the whole cell patch potential fixed.

 The magnitude of the photocurrent of wild-type Chop2 (1-315) abcdefg is maximum at 460 nm, depending on the wavelength of the irradiated light. This is explained by the wavelength dependence of the light energy absorption efficiency. In order to compare the absorption light wavelength response characteristics of hybrid photocurrent, we measured the photocurrent induced by blue light (477 ± 10 nm) and green light (532 ± 10 nm). Figure 6A compares the photocurrents of the hybrids Abcdefg and ABcdefg. The response of the hybrid ABcdefg to green light is increasing. Using the G / B ratio (Green / Blue ratio) of the blue and green light responses, the absorption wavelength response characteristics are quantified, and this is compared between the hybrid apoprotein and the wild-type apoprotein. 6 Posted in B. That is, the hybrid Abcdefg showed almost the same absorption wavelength response characteristics as the wild-type channelopsin 2 (1-315) abcdefg. In contrast, the absorptions on the long wavelength side increased in the hybrids ABcdef g, ABCdefg, and ABCDefg. In the hybrid ABCDEfg, the absorption at the long wavelength side was further increased and was almost equal to the wild type channel opsin 1 and ABCDEFG. In other words, there are structures that control the absorption wavelength characteristics in the transmembrane domain B / b and E / e, and it is suggested that when these are b and e, they shift to the longer wavelength side.

 (8) Identification of transmembrane domain controlling ionic permeability

Photoreceptive channels expressed in Xenopus oocytes expressing wild-type Chopl (1-345) ABCDEFG have been reported to have high H + permeability but little permeability to Na + (Nagel et al. , 2002; Hegemann et al., 2005). In contrast, the wild type Chop2 (1-315) abcdefg has been reported to have high Na + permeability (Nagel et al., 2003; Ishizuka et al., 2006). In order to identify the structure that controls Na + permeability, the whole cell patch solution is Na + -glutamate (Na +, 100 mM), and the extracellular solution Na + is 142 mM and 20 mM (N-methyl-D-glucamine ion). We investigated the IV relationship between the holding potential and the photocurrent during the substitution.

Figure 7A shows the IV relationship of hybrid Abcdefg. In the external solution Na ⁺ 142 mM, the polarity was reversed at about 10 mV, but when the external solution Na ⁺ 20 mM, the reversal potential was about −10 mV. In other words, it shifted to the negative side by about 20mV. This change is significantly smaller than wild-type Chop2 (1-315) abcdefg. Figure 7B shows the IV relationship of hybrid ABcdefg. The reversal potential shifted more than 30mV. Figure 7C compares photocurrent reversal potential shifts for each hybrid apoprotein. In the hybrid ABCdefg and ABCDefg, the reversal potential shift was significantly small. Therefore, these hybrid opsin proteins may have reduced Na + selectivity for permeation. In contrast, in the I-V relationship of hybrids ABcdefg, ABCDEfgDEF ABCDEFg, ABCDEFG, the reversal of the inversion potential is strongly dependent on the external solution Na + and There was no significant difference. That is, the permeation selectivity is controlled by multiple transmembrane domains, suggesting that transmembrane domains A, B / b, and C have important functions.

 The photocurrents of hybrid ABCDEFg and wild-type Chopl (1-345) ABCDEFG tended to be very weak compared to others. Therefore, in Fig. 8, the whole cell conductance per unit membrane capacitance was compared. The whole cell conductance per unit membrane capacity is proportional to the single channel conductance of the photoreceptor channel and its density. The whole cell conductance per unit membrane capacity was the maximum in the hybrid ABCDEfg.

 (9) Identification of transmembrane domains that control kinetic properties

Figure 9A shows the relative intensity of blue LED illumination (470 ± 25 nm). In HEK293 cells expressing the hybrid Abcdefg, a photoelectric current depending on the intensity of the irradiated light was measured (Fig. 9B). The photocurrent peaks in a few milliseconds, but quickly fails. It was observed to activate. This photoresponsive property is similar to wild-type Chop2 (1-315) abcdefg. In contrast, the photocurrent of hybrid ABcdefg is hardly inactivated (Fig. 9C). Figure 10A shows a comparison of the photocurrent when the blue LED light with the maximum illuminance is irradiated for 1 second, together with the magnitude of the maximum photocurrent. Compared to wild-type Chop2 (1-315) abcdefg, the photocurrent of hybrid ABcdefg has been shown to have a large ratio of stationary photocurrent to maximum photocurrent. Therefore, the strength of inactivation was quantified using this ratio (plateau / peak ratio). A comparison between hybrid and wild type apoproteins is shown in Figure 10B. In other words, the hybrid Abcdefg was weakly inactivated compared to the biotype Chop2 (1-315) abcdefg, but was found to be more inactivated compared to the hybrid ABcdefg. The hybrid ABCDEfg further weakens inactivation. That is, there are structures that control inactivation in transmembrane domains A, B / b, and E / e, suggesting that when these are a, b, and e, strong inactivation is caused. Is done.

 Fig. 11 A compares the speed of photocurrent activation (ON) for hybrid Abcdefg and hybrid ABcdef g. Figure 11B compares the speed of photocurrent deactivation (OFF). It was observed that both photocurrent 0N and OFF were faster in the hybrid ABcdef g. A comparison of the photocurrent ON and OFF rate constants between the hybrid apoprotein and the wild-type apoprotein is shown in Figure 11C. It is suggested that when the transmembrane domain B / b is B, both 0N and OFF are faster, and when the transmembrane domain E / e is E, both 0N and OFF are slower.

 (1 0) Characterization of hybrid rhodopsin protein

 1. Modified mouth dopsin protein with increased conductance

The above examples suggest the existence of a structure controlling conductance in the transmembrane domain F / f. Therefore, a novel rhodopsin protein with increased conductance is created by setting the structure of this transmembrane domain to f. Among the hybrid rhodopsin proteins investigated to date, the maximum conductance per unit membrane capacity can be obtained by using ABCDEfg. 2. Modified oral dopsin protein with increased absorption at longer wavelengths

 The above examples suggest the existence of structures that control the absorption wavelength characteristics in the transmembrane-containing domains B / b, E, F / f, and G / g. Among the hybrid rhodopsin proteins investigated to date, ABCDEFg has the highest absorption at the long wavelength side, but ABCDEfg is superior in practical use when the conductance is taken into account.

 3. A weakly inactivated modified oral dopsin protein

 Wild-type Chop2 (1-315) abcdefg has been used as a means of photostimulating nerve cells, etc., but there is strong inactivation in the photocurrent, so when repeated light stimulation is performed at short intervals, light There was a drawback that the current decreased. In order to obtain the same photoelectric current, it was necessary to leave an interval of 10 seconds or more. According to the above example, there are structures that control inactivation in transmembrane domains A / a, B / b, and E / e. When these are A, B, and E, they are inactive It was suggested that the conversion will become weaker. Among the hybrid rhodopsin proteins studied to date, the use of ABCDEfg provides the weakest inactivation photocurrent.

 4. Modified mouth dopsin protein with high frequency response characteristics

 When a nerve cell is repeatedly stimulated with light, it becomes important how much frequency it can generate a photocurrent that follows the blinking of light. The magnitude of this following frequency is equal to the constant constant of the photocurrent ON speed. The magnitude of the ON speed constant depends on the transmembrane structure domains B / b and E / e, and is small for the combination of B-E and b-e and larger for the combination of B-e. Among the hybrid rhodopsin proteins investigated so far, photocurrents with high frequency response characteristics can be obtained by using ABcdefg, ABCdefg ヽ ABCDefg, etc. ABcdefg is the best, taking into account the selectivity for the ON speed constant Opi Na +.

 5. Modified oral dopsin protein with excellent practicality

 Among the modified mouth dopsin proteins prepared in the above examples, ABCDEfg

(chop WR), conductance, large absorption on the long wavelength side, weak deactivation, etc. It also has high selectivity for Na + ions. Therefore, the channel opsin wide receiver is designed to accept faint light. Excellent for use.

 Among the modified oral dopsin proteins prepared in the above examples,

ABcdefg (chop FR) Force S, excellent in frequency response characteristics. It also has excellent conductance, weak inactivation, and selectivity for Na ⁺ ions. Therefore, the channel opsin fast receiver is excellent for applications that accept optical information that fluctuates at high frequencies. Industrial applicability

 According to the present invention, a photoreceptor channel type protein having various functions improved or imparted can be provided.

 In addition, by including various combinations of the transmembrane domain of channel opsin 1 and the transmembrane domain of channel opsin 2, a photoreceptor channel-type protein specialized for a specific function is provided. be able to.

 Since the use of the modified rhodopsin protein of the present invention is via light, it is completely noninvasive to tissues such as the retina, nerves and brain. Further, the novel photoreceptive channel-type oral dopsin protein according to the present invention can be constructed as superior to the conventional channel-mouthed dopsin protein in terms of time and spatial resolution. Therefore, it is an extremely useful material in fields including medical care, welfare / care, and information communication. All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety.

Claims

The scope of the claims

1. a modified photoreceptor channel-type oral dopsin protein having multiple transmembrane domains, wherein at least one of the transmembrane domains is a corresponding channel opsin 1 of Chlamydomonas reinhardti i A transmembrane domain derived from the transmembrane domain of Chlamydomonas reinhardti i which is a transmembrane domain derived from or derived from and / or at least one of the transmembrane domains Or the protein, which is a variant thereof.

 2. At least one of the transmembrane domains is a transmembrane domain derived from the corresponding channel opsin 1 of Chlamydomonas reinhardtii or a variant thereof, and at least one of the transmembrane domains is at least one The protein according to claim 1, which is a transmembrane domain or a variant thereof derived from the corresponding channel opsin 2 of Chlamydomonas reinhardtii.

 3. The photoreceptor channel-type oral dopsin protein is channel opsin 1, and at least one of the transmembrane domains is a transmembrane domain derived from the corresponding channel opsin 2 of Chlamydomonas reinhardtii or The protein according to claim 1, which is a variant thereof.

 4. The protein according to claim 3, wherein the photoreceptor channel type oral dopsin protein is chine / leopsin 1 derived from Chlamydomonas reinhardti i.

 5. Photoreceptor channel-type oral dopsin protein is channel opsin 2, and at least one transmembrane domain is derived from the corresponding transmembrane domain derived from channel opsin 1 of Chlamydomonas reinhardti i. 2. The protein according to claim 1, which is a variant thereof.

 6. The protein according to claim 5, wherein the photoreceptor channel-type oral dopsin protein is channel opsin 2 derived from Chlamydomonas reinhardti i.

 7. The protein according to any one of claims 1 to 6, which comprises the polypeptide shown in any of the following (a) to (iii) or a variant thereof.

(a) a polypeptide consisting of amino acids 1 to 117 of SEQ ID NO: 2; 117 and amino acids 79 to 315 of SEQ ID NO: 4 (b) a polypeptide comprising the amino acids 1-164 of SEQ ID NO: 2 and the amino acids 126-315 of SEQ ID NO: 4

 (c) a polypeptide consisting of amino acids 1-184 of SEQ ID NO: 2 and amino acids 146-315 of SEQ ID NO: 4

 (d) a polypeptide consisting of amino acids 1-212 of SEQ ID NO: 2 and amino acids 174-315 of SEQ ID NO: 4

 (e) a polypeptide comprising the amino acids 1 to 242 of SEQ ID NO: 2 and the amino acids 204 to 315 of SEQ ID NO: 4

 (f) a polypeptide consisting of amino acids 1 to 276 of SEQ ID NO: 2 and amino acids 238 to 315 of SEQ ID NO: 4

 (g) Polypeptide consisting of amino acids 118 to 345 of SEQ ID NO: 2 and amino acids 1 to 78 of SEQ ID NO: 4

 (h) a polypeptide consisting of amino acids 165 to 345 of SEQ ID NO: 2 and amino acids of SEQ ID NO: 4; 1 to 125

 (i) a polypeptide comprising amino acids 185 to 345 of SEQ ID NO: 2 and amino acids 1 to 145 of SEQ ID NO: 4

 (j) A polypeptide comprising amino acids 213 to 345 of SEQ ID NO: 2 and amino acids 1 to 173 of SEQ ID NO: 4

 (k) a polypeptide comprising amino acids 243 to 345 of SEQ ID NO: 2 and amino acids 1 to 203 of SEQ ID NO: 4

 (1) Polypeptide consisting of amino acids 277 to 345 of SEQ ID NO: 2 and amino acids 1 to 237 of SEQ ID NO: 4

 8. The protein according to claim 7, comprising a polypeptide consisting of amino acids 1-164 of SEQ ID NO: 2 and amino acids 126-315 of SEQ ID NO: 4 or variants thereof.

 9. The protein according to claim 7, comprising a polypeptide consisting of amino acids 1 to 242 of SEQ ID NO: 2 and amino acids 204 to 315 of SEQ ID NO: 4 or a variant thereof.

 10. A polynucleotide encoding the protein according to any one of claims 1 to 9.

11. The polynucleotide of claim 10 operably linked to a promoter. An expression vector comprising

 1 2. A cell expressing the protein according to any one of claims 1 to 9.

1 3. The cell according to claim 12, which is a nerve cell.