WO2009122362A1

WO2009122362A1 - Aspergillus carneus strain and use thereof

Info

Publication number: WO2009122362A1
Application number: PCT/IB2009/051366
Authority: WO
Inventors: Alfred Botha; Bernard Alexander Prior; Christiaan Wilhelm Cruywagen; Willem Heber Van Zyl
Original assignee: University Of Stellenbosch
Priority date: 2008-04-01
Filing date: 2009-04-01
Publication date: 2009-10-08
Also published as: ZA201007640B; EP2268158A1; CN102098927A

Abstract

The invention describes a new Aspergillus carneus fungus strain, designated Aspergillus carneus (van Tiegham) Blockwitz (CBS 116150). The fungus strain produces a number of exogenous fibrolytic enzymes which are capable of increasing cell wall degradation, and thereby digestibility, of an animal feed, such as wheat straw, ruminant feed, fish feed or poultry feed. Products containing these enzymes, such as a culture supernatant, a feed additive and an animal feed, are also described.

Description

ASPERGILLUS CARNEUS STRAIN AND USE THEREOF

BACKGROUND OF THE INVENTION

The invention relates to an isolated fungus strain and the use thereof on animal feed.

Ruminants are well adapted to utilize plant cell walls, and the degradation thereof by the animal is of major economic importance. However, even under ideal feeding conditions, cell wall digestibility in the total digestive tract is still generally less than 65% (Van Soest, 1994). With plant cell walls typically contributing towards 40 to 70% of forage dry matter (Van Soest, 1994), attempts to improve ruminal fibre degradability have been a research focus area for many years.

Although much progress has been made in the development of products that improve protein and energy utilization, relatively little has been achieved in the forage area

(Cruywagen, 1999). Recent positive responses in feeding trials with regard to the use of fibrolytic enzymes as feed additives for ruminants resulted in the topic receiving much research interest in the past few years (Yang et al., 1999; Kung et al., 2000).

Diet composition (Beauchemin et al., 1995) and the diet component to which the enzyme is added (McAllister et al., 1999) appear to influence its effectiveness.

Enzyme additives have in the past resulted in positive animal responses, but the mode of action of exogenous enzymes in the ruminant is still not fully understood (Columbatto et al., 2003). The possibility exists that added enzymes can stimulate fibre digestion in the rumen (Wallace et al., 2001 ) as well as increase total tract digestibility in ruminants (Yang et al., 1999). Improvements in body weight gain and increased digestibility of ruminant diets that consist mainly of forages have been reported in studies where enzyme additives had been used (Beauchemin et al., 1995; Feng et al., 1996).

The applicant has now identified a fungus strain that produces enzymes which are capable of improving the digestibility of an animal feed.

SUMMARY OF THE INVENTION

According to a first embodiment of the invention, there is provided an isolated Aspergillus carneus fungus strain, designated Aspergillus carneus (van Tiegham) Blockwitz (CBS 116150). The fungus strain may produce a number of exogenous fibrolytic enzymes. The enzymes may be capable of increasing cell wall degradation, and thereby digestibility, of an animal feed, such as wheat straw, ruminant feed, fish feed or poultry feed. The fungus strain may also produce other proteins, growth factors and sugars, which may also contribute to improving the digestibility of the animal feed.

According to a second embodiment of the invention, there is provided a culture supernatant obtained by fermenting the fungus strain described above. The culture supernatant may include one or more exogenous fibrolytic enzymes, such as β- xylanase, β-endoglucanase, β-mannanase, β-glucosidase, α-arabinofuranosidase, β- xylosidase and/or feruloyl esterase. The supernatant may also include other proteins, sugars and/or growth factors.

According to a third embodiment of the invention, there is provided an extract of a culture supernatant obtained by culturing the fungus strain above, the extract including one or more exogenous fibrolytic enzymes, such as β-xylanase, β-endoglucanase, β- mannanase, β-glucosidase, α-arabinofuranosidase, β-xylosidase and/or feruloyl esterase, and optionally also including other proteins, sugars and/or growth factors.

According to a further embodiment of the invention, there is provided an animal feed additive, the additive including the fungus strain above and/or one or more exogenous fibrolytic enzymes produced by the fungus strain.

The feed additive may be for use in ruminant, poultry or fish feeds. The feed additive may be in liquid or powdered form.

According to a further embodiment of the invention, there is provided an animal feed that has been treated with a feed additive as described above.

The feed may be a ruminant, poultry or fish feed.

The feed may be a forage feed, such as wheat straw or a concentrated feed, such as pelleted feed.

According to a further embodiment of the invention, there is provided a method of improving digestibility of an animal feed, the method including the step of treating the animal feed with the above fungus strain, culture supernatant, extract or feed additive.

The fungus strain and its enzymes and other products may degrade the cell walls of the animal feed.

The fungus strain, culture supernatant, extract or feed additive may be applied to the animal feed in an amount ranging from about 1 ml of enzyme per kg of animal feed to about 20 ml/kg, more particularly in the range of from about 5 ml enzyme/kg of animal feed to about 10 ml/kg, and even more particularly in an amount of about 5 ml enzyme per kg animal feed.

The feed may be treated from about 6 to about 24 hours prior to it being fed to an animal, and more particularly about 18 hours prior to feeding.

The feed may be treated prior to it being pelleted.

According to a further embodiment of the invention, there is provided a method of increasing weight gain in an animal, the method comprising the step of treating an animal feed with a fungus strain, culture supernatant, extract or feed additive, substantially as described above, prior to feeding the animal feed to the animal. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a profile of an ABO374 fungal enzyme composition used for in-vivo lamb trials.

Figure 2 is a graphical depiction of the weekly and cumulative weight gains of Donne Merino lambs receiving diets containing wheat straw treated with different levels of an enzyme supernatant (Abo 374) and negative control (example

1 ).

Figure 3 is a graphical depiction of the weekly and cumulative weight gains of Dόhne

Merino lambs receiving low and high concentrate finishing diet containing wheat straw treated with Abo 374, Cattle-Ase and negative control (example

2).

Figure 4 is a graphical depiction of the effect of enzyme treatment of (A) pelleted diets and (B) unpelleted diets on bi-weekly weight gain of Donne Merino lambs

(example 3).

DETAILED DESCRIPTION OF THE INVENTION

The invention describes the isolation and characterisation of an isolated fungus strain, designated Aspergillus carneus (van Tiegham) Blockwitz (CDS 116150) (also referred to herein as ABO374) and its ability to enhance an animal feed such as wheat straw, ruminant feed, fish feed or poultry feed, to a sufficient degree so that its administration to animals results in improved weight gain of the animals.

The fungus culture was isolated from alkaline soil of the Fish River Plains in the Eastern Cape, South Africa (approximately 100 km inland).

A composition comprising enzymes and other compounds produced by the fungus strain can be applied to the animal feed prior to pelleting of the feed, typically in an amount of from about 1 ml of enzyme per kg of animal feed to about 20 ml/kg, more particularly in the range of from about 5 ml enzyme/kg of animal feed to about 10 ml/kg, and even more particularly in an amount of about 5 ml enzyme per kg animal feed. Identification

Morphological Standard morphological criteria were used to identify the isolate as Aspergillus carneus using keys from Klich (2002), Domsch et al. (1980) and Thorn et al. (1951). This finding also correlates with the natural habitat of this species, which is especially widespread in warm arable soils.

Table 1 : Macroscopic characteristics after 10 days incubation

Microscopic features:

Stipe: Length: ±380 μm Width: vary Surface texture: Smooth and thick-walled

Vesicle: Diameter: 1 0 μm Shape: some are clavate, some are pyriform

Seriation: Biseriate

Conidia: Shape: spherical to elipsoidal Diameter: ± 3 μm

Surface texture: smooth

Other distinguishing features:

The biseriate conidial heads were fertile over only the upper one third to one half of the vesicle. The media formulae in Table 1 was as follows:

Malt Extract Agar (MEA)

Powdered Malt Extract 20.0 g Peptone 1.O g

Glucose 20.0 g

Agar 20.0 g

Distilled water 1.0 I

Czapek Concentrate

NaNO₃ 30.O g

KCI 5.O g

MgSO₄JH₂O 5.O g

FeSO₄JH₂O 0.1 g

ZnSO₄JH₂O 0.1 g

CuSO₄.5H₂O 0.05 g

Distilled water 100 ml

Czapek Yeast Aαar (CYA25, CYA37)

K2HPO4 1.O g

Czapek Concentrate 10.0 ml Powdered Yeast Extractδ.O g

Sucrose 30.0 g

Agar 15.O g

Distilled water 1.0 1

Molecular

Culture conditions for fungal biomass production: Cultures of the fungal strain were prepared by using five-day-old hyphal growth and spores on malt extract agar (Biolab) as inoculum for 100 ml malt extract (Biolab) contained in a 250 ml Erlenmeyer flask. The liquid cultures were incubated for three days on a shaker (120 rpm, 30 °C), harvested by filtration through a sterile polypropylene-based cloth and frozen using liquid nitrogen.

Isolation of DNA: Genomic DNA was extracted using a method based on the protocol of Raeder & Broda (1985). Using acid-washed sand, frozen mycelia were ground to a fine powder using a mortar and pestle. Approximately 0.5 ml of the powdered mycelium was transferred to a 1.5 ml micro-centrifuge tube. Subsequently, 500 μl ice- cold extraction buffer (200 mM Tris-HCI pH 8.5, 250 mM NaCI, 25 mM EDTA, 0.5% SDS) was added to the tube and the sample was vortexed briefly. The resulting suspension was extracted on ice, using 350 μl phenol and 150 μl chloroform:isoamyl alcohol (24:1 ), vortexed and centhfuged (13 793 x g, 60 minutes, 4 °C) in a table microfuge. The aqueous phase was subsequently treated with 25 μl RNase, incubated at 37 ⁰C for ten minutes, then extracted using 1 volume of chloroform: isoamyl alcohol (24:1 ). The nucleic acids were precipitated with 0.54 vol. of isopropanol. After washing with 70 % ethanol, the DNA pellet was dissolved in TE buffer (10 mM Tris-HCI pH 8.0, 1 mM EDTA) and stored at -16 ⁰C.

Polymerase chain reaction (PCR) protocol: Experiments were carried out with Expand™ High Fidelity DNA Polymerase from Boehringer Mannheim (South Africa) in a Perkin-Elmer 2400 thermal cycler. Primers used for the PCR experiments were synthesized by Boehringer Mannheim, Germany. Primers ITS 4 (5¹- TCCTCCGCTTATTGATATGC-3' (SEQ ID NO: 1)) and ITS 5 (5¹- AAGTAAAAGTCGTAACAAG-S¹ (SEQ ID NO: 2)) were used to amplify the internal transcribed spacer (ITS) region according to the method of White et ah, 1990. The conditions under which the PCR reactions were performed are as follows: denaturation for 5 minutes at 94 ⁰C and 45 seconds at 94 ⁰C, followed by 25 cycles of annealing for 30 seconds at 55 ⁰C, elongation for two minutes at 72 °C, denaturation for 45 seconds at 94 ⁰C followed by a final elongation step of seven minutes at 72 ⁰C. The PCR products were purified using the GFX PCR DNA and Gel Band Purification Kit (Amersham Biosciences) and sequenced using a Perkin Elmer ABI PRISM™ genetic sequencer, Model 3100, Version 3.7. The forward and reverse sequences were aligned with DNAMAN for WINDOWS Version 4.13 (Lynnon Biosoft). The fungal strain was identified by comparing the sequence results with known sequences using the BLAST program reverse sequences of the National Center for Biotechnology Information (NCBI).

The identity of the fungal isolate Abo374 was also investigated using the primer pair LR3 (GGTCCGTGTTTCAAGACGG (SEQ ID NO: 3)) and F63 (GCATATCAATAAGCGGAGGAAAAG (SEQ ID NO: 4)) to amplify and sequence the D1/D2 region of the large sub-unit ribosomal DNA.

The results of the blast search revealed that the ribosomal gene sequences of the isolate is closely related to Aspergillus terreus and Fennellia nivea (anamorph: Aspergillus niveus) when the primer pairs ITS 4 and ITS 5 were used in the PCR reaction. When primer pairs F63 and LR3 were used in the PCR reaction, the blast search indicated that the isolate may be Aspergillus terreus, Fennellia nivea or Aspergillus carneus. However, it is known that, according to Samson and Pitt (2000), phylogenetically A. carneus, A. terreus and F. nivea are closely related. The decision to classify this unknown organism in a specific species was eventually based on the morphology of the unknown culture. It was subsequently decided that it belongs to the species Aspergillus carneus (van Tiegham) Blockwitz. The identity of the fungus was later confirmed by the Centraalbureau voor Schimmelcultures in Utrecht, The Netherlands (http://www.cbs.knaw.nl/).

Toxicity and safety of strain ABO374

High Performance Liquid Chromatography (HPLC) was used to test for aflatoxin B₁ (AFBi) production by the isolate Abo 374. The culture supernatant of a 5 day old culture in complex growth medium was extracted with chloroform. The chloroform was evaporated under nitrogen, the sample dissolved in methanol, filtered (Millex-GV,

Durapore, 0.22 μm), and analyzed by HPLC. HPLC analysis was performed through a guard column [LiChroCART 4-4 RP-C18 (5 μm)] followed by a LiChroCART 250-4 Hypersil ODS RP-C18 (5 μm) column. The mobile phase was acetonitrile:methanol:water (1 :1 :2, v/v/v) at a flow rate of 1 ml/min. AFB₁ was measured by UV (365 nm) detection. Standard curves for AFB-i concentration

(determined spectrophotometrically) versus HPLC peak areas were prepared. The linear regression slope was used to calculate AFB₁ concentration. No AFB₁ was detected in culture supernatant of the strain ABO 374.

No reports of diseases arising from Aspergillus carneus have been found in the literature. The fungus is a Class I organism, and is therefore safe to cultivate at scale.

Enzyme composition

A profile of individual fibrolytic enzymes produced by ABO374 is shown in Figure 1 and Table 2. The most prominent enzyme activities found were β-xylanase, β- endoglucanase, β-mannanase and β-glucosidase. Both fungal β-xylanase and β- endoglucanase have been shown to improve ruminant feed digestibility (Beauchemin et a/., 2003) However, in-vitro assay results do not indicate a key enzyme profile with efficacy on wheat straw which can be replicated successfully from pure commercials enzyme products. It is possible that the key parameter in the ABO374 enzyme supernatant is a specific ratio of fibrolytic enzymes or a yet unknown growth factor/stimulant for the lamb gut flora rather than a critical enzyme fingerprint profile, but this has yet to be confirmed. Table 2. Average protein and enzyme cocktail profiles of ABO374 over a six week period of enzyme production.

Examples

The invention is further described by the following examples. Such examples, however, are not to be construed as limiting in any way either the spirit or scope of the invention.

The ability of an exogenous fibrolytic enzyme composition containing enzymes from ABO374 to degrade cellulose, and in particular cellulose cell walls of a plant animal feed, was investigated using wheat straw and a lamb finishing feed as the substrate.

The enzyme composition was obtained by culturing the ABO374 fungal strain on 2% carbon source supplemented with corn steep liquor. After fermentation, the culture solution was centrifuged in a super speed (16 K rpm) centrifuge to remove the remainder of the biomass. The resulting clear supernatant is stable for a few weeks at 4⁰C, and when used in this form gave better response than when it was lyophilised or mixed with a stabilizer, such as starch. The supernatant was used at 1 - 10 ml / kg dry animal feed. A general profile of the supernatant composition is shown in Table 2 and Figure 1. In these examples, the term "pre-treatment" should be understood to refer to the application of an enzyme composition to an animal feed prior to the feed being fed to animals.

Example 1 : Wheat straw as a substrate on experimental scale

Thirty two Dohne Merino ram lambs with an initial body weight of 30.3±2.5 kg were used in a randomised block experiment (four blocks, eight repetitions) of six weeks to determine the effect of an exogenous fibrolytic enzyme composition containing an enzyme supernatant of Abo374 on body weight gain, dry matter intake and efficiency of feed conversion. The lambs were housed individually in 1.8 x 1.2 m pens on wooden slatted floors in a semi-open metabolism building. They were stratified according to initial weight and randomly allocated to four treatment blocks with eight repetitions.

All the lambs received the same basal diet consisting of 392 g/kg enzyme-treated wheat straw, 276 g/kg lucerne hay, 197 g/kg maize meal, 65 g/kg cottonseed oil cake, 57 g/kg molasses, 11 g/kg urea and 2 g/kg of a trace mineral and vitamin premix. The diet contained 130 g/kg crude protein, 300 g/kg crude fibre, 4.6 g/kg Ca and 1.8 g/kg P.

Treatments consisted of different application rates of the compostion containing an exogenous fibrolytic enzyme produced by the fungus strain Abo 374 to the wheat straw component of the diet to provide either 10 ml (High), 5 ml (Med) or 1 ml (Low) enzyme supernatant/kg straw and a negative control. The appropriate amount of enzyme supernatant was diluted with water to provide a solution that was applied at a rate of 300 ml/kg straw. In the control treatment, water alone was applied at the same rate. Enzyme supernatant was produced fresh each day and the straw and enzyme solution (or water in the control treatment) was mixed daily with the aid of an electric concrete mixer for 10 minutes. The treated straw was then stored uncovered in plastic crates until the next morning to allow a pre-feeding enzyme-substrate interaction time of 18 hours. The straw was then added each morning at the same time to the rest of the mixed diet and offered to the lambs ad lib. plus 5%. Oils were weighed back and dried daily to determine dry matter intake. Lambs were weighed weekly on two consecutive days and the average weight was used to determine weekly gains. Data were subjected to an ANOVA and treatment means were separated with a Bonferroni test to determine significant differences with the aid of Statistica 6.1 (2003). Significance was declared at P<0.05.

The effect of enzyme treatment of wheat straw on body weight gain, feed intake and efficiency of feed conversion (EFC) is shown in Table 3.

Table 3: Body weight gain, dry matter intake (DMI) and efficiency of feed conversion (EFC) of Dόhne Merino lambs receiving diets containing wheat straw treated with different levels of an enzyme supernatant (Abo 374) and negative control

Treatment¹

Item High Med Low Control P-value

Body weight gain, 0-4 weeks (kg) 4.84 4.81 4.00 4.06 0.08

Body weight gain, 0-6 weeks (kg) 6.75^a 7.13^a 5.50^b 5.41 ^b 0.04

DMI, 0-4 weeks (kg) 7.53 7.76 7.34 7.33 0.72

DMI, 0-6 weeks (kg) 8.16 8.42 7.81 7.61 0.19

EFC, 0-4 weeks (kg gain/kg DMI) 0.18^a 0.17^a 0.14^b 0.15^b 0.04

EFC, 0-6 weeks (kg gain/kg DMI) 0.15^a 0.16^a 0.13^b 0.12^b 0.05

Abo 374 supernatant application to wheat straw: High = 10 ml/kg; Med = 5 ml/kg; Low = 1 ml/kg ^a'^bMeans with different superscripts differed significantly (PO.05)

There was a strong tendency for the High and Med treatments to have an effect on weight gain until four weeks of age. Considering the relatively small number of animals (eight per treatment) and the variation usually observed in lamb growth rates, the P- value of 0.08 is noteworthy. This tendency continued to manifest in a significant difference (P<0.04) observed for the total period of six weeks.

Treatment did not affect feed intake, but EFC ratios were improved for the High and Med treatment groups after 4 (P<0.04) and 6 (P<0.05) weeks, suggesting a possible improvement in the digestibility of the wheat straw component of the diet with certain levels of enzyme application.

Weekly and cumulative weight gains are shown in Figure 1. The effect of the High and Med enzyme application levels are clearly observable at four and six weeks. It appears as if the effect started at an earlier stage, possibly already at two weeks, but that it did not become significant before four weeks. It appears as if 5 ml supernatant/kg wheat straw was as effective as 10 ml/kg.

It was thus shown that pre-feeding treatment of wheat straw with Abo 374 supernatant at levels equivalent to 10 and 5 ml supernatant/kg straw resulted in improved weight gains and EFC ratios compared to a low level treatment (1 ml/kg) or no enzyme treatment.

Example 2: A low and high concentrate finishing diet as substrate on experimental scale

Forty-nine SA Mutton Merino lambs, five months of age and averaging 33.6 ± 2.4 kg body weight, were used in the trial. All the lambs received an adaptation diet, containing 25% concentrate, for the first two weeks. After the adaptation period, lambs were weighed again and this weight was regarded as the initial or starting weight. The animals were stratified according to initial weight and then randomly divided into seven treatments with seven blocks (repetitions) per treatment. Lambs were housed individually in a semi-open barn with slatted wooden floors.

Three treatments were designed to evaluate the effect of enzyme addition to high forage (low concentrate) diets and four treatments to evaluate the effect on high concentrate (low forage) diets. The high forage diets contained 92% forage and 8% concentrate, while the high concentrate diets contained 60% forage and 40% concentrate.

The composition of the adaptation diet and basal experimental diets are presented in Table 4.

Table 4. Composition (% inclusion on air dry basis) of the adaptation diet and basal experimental diets used in the evaluation of exogenous fibrolvtic enzymes on the growth of SA Mutton Merino lambs

Treatments were:

US-F: Fresh Abo 374 (freshly prepared daily), high forage diet

CSIR-F: Freeze-dried Abo 374, high forage diet

Cont-F: No enzyme treatment, high forage diet

US-C: Fresh Abo 374 (freshly prepared daily), high concentrate diet

CSIR-C: Freeze-dried Abo 374, high concentrate diet

Cat-C: Cattle-Ase (commercial enzyme), high concentrate diet

Cont-C: No enzyme treatment, high concentrate diet

All diets were fed ad lib. and refusals were weighed back daily to determine individual feed intake.

Diets were weighed out in treatment batches and transferred to a concrete mixer. Appropriate enzyme solutions (or distilled water in the control treatments) were added at a rate of 300 ml/kg air dry diet and each batch was mixed for 10 minutes. The enzyme solutions were prepared and diluted with distilled water in such a way that each enzyme treatment received the appropriate enzyme supernatant at a rate of 7.5 ml per kg diet DM.

The diets were weighed out from the respective batches and allowed to stand for 15 minutes before being offered to the lambs. Lambs were fed once daily at 08:00. All the lambs were weighed weekly to determine body weight gain.

From Figure 3 it seems clear that lambs on the high concentrate diets grew much faster than lambs on the high forage diets, which was expected. The growth pattern would appear to indicate that all three enzyme treatments of the high concentrate diet resulted in a faster weight gain than the high concentrate control diet. The effect of enzyme treatment of the high forage diet was less obvious. However, the fresh Abo 374 enzyme cocktail resulted in a faster weight gain as from seven weeks. The effect of enzyme treatment of the high concentrate diet on cumulative weight gain at different times is presented in Table 5.

Table 5. The effect of exogenous fibrolvtic enzyme treatment of high concentrate diets on cumulative weight gain in lambs

It can be seen from Table 5 that the fresh Abo 374 treatment (US-C) resulted in a significantly higher cumulative weight gain six weeks after the onset of the trial than the other treatments. This effect was carried over as a strong trend at weeks 9 and 12. The other enzyme treatments (CSIR-C and Cat-C) gave better cumulative weight gain than the control treatment, but inferior to US-C. The effects were probably not significant for all the enzyme treatments due to the small amount of animals per treatment.

The effect of enzyme treatment of the high forage diet on cumulative weight gain at different times is presented in Table 6.

Table 6. The effect of exogenous fibrolvtic enzyme treatment of high forage diets on cumulative weight gain in lambs

From Table 6 it can be seen that the fresh enzyme treatment (US-F) resulted in higher cumulative gains than the CSIR-F treatment at Weeks 6, 9 and 12, while it also resulted in higher gains than the control treatment at Week 12. The difference between the fresh and freeze dried products cannot be explained at this stage.

From the results obtained in the current trial it is clear that the Abo 374 fungal strain has great potential to improve animal performance when used as an exogenous fibrolytic enzyme. The freeze dried product showed potential in the high concentrate diets, but probably needs further fine-tuning regarding the feed processing and application method.

Example 3: A high concentrate finishing diet as substrate at feedlot level

An in vivo lamb feed trial was carried out under feedlot conditions on a farm near Swellendam in the Western Cape Province, South Africa. The purpose was to investigate the effect of the treatment of a high concentrate finishing diet (in a pelleted and unpelleted form) on lamb growth under industrial conditions with an exogenous fibrolytic enzyme cocktail produced by strain ABO374.

A total number of 120 Dδhne Merino lambs, four months of age, were used in the trial. The lambs were stratified according to initial weight and then randomly divided into 6 groups of 20 lambs per group. All the lambs received the same finishing diet and treatments involved enzyme application and pelleting of the diet. The diet contained 87% concentrate and 13% forage, and was in the form of a total mixed ration (TMR), which was either pelleted or unpelleted.

Treatments were as follows: a) CMO: Control TMR meal diet - no enzyme added to the unpelleted diet. b) CML: Enzyme L TMR meal diet - liquid enzyme added to the unpelleted diet. c) CMD: Enzyme D TMR meal diet - dry enzyme was reconstituted then added to the unpelleted diet. d) CPO: Control TMR pelleted diet - no enzyme added to the pelleted diet. e) CPL: Enzyme L TMR pelleted diet - liquid enzyme added to the pelleted diet. f) CPD: Enzyme D TMR pelleted diet - dry enzyme was reconstituted then added to the pelleted diet.

The enzyme cocktail obtained from the fermentation of ABO374 was diluted and prepared as follows before applied to the diets: a.) CMO Treatment: For every 30 kg batch of the unpelleted TMR, 3 litres of water was sprayed onto the feed and mixed with a shovel. The feed was allowed to air dry before feeding out. b.) CML Treatment: For every 30 kg batch of the unpelleted TMR, 150 ml_ of the liquid enzyme was mixed with 3 litres of water, sprayed onto the feed and mixed with a shovel. The feed was allowed to air dry before feeding out. c.) CMD Treatment: For every 30 kg batch of the unpelleted TMR, 150 g of the enzyme powder was mixed with 3 litres of water, sprayed onto the feed and mixed with a shovel. The feed was allowed to air dry before feeding out. d.) CPO Treatment: For every 100 kg batch of TMR, 10 litres of water was added to the TMR in the feed mixer. It was mixed well before being pelleted. The pellets were allowed to air dry before feeding out to the lambs, e.) CPL Treatment: For every 100 kg batch of TMR, 500 mL of the liquid enzyme was mixed with 10 litres of water and added to the TMR in the feed mixer. It was mixed well before being pelleted. The pellets were allowed to air dry before feeding out to the lambs, f.) CPD Treatment: For every 100 kg batch of TMR, 500 g of the enzyme powder was mixed with 10 litres of water. The mixture was allowed to stand for 30 minutes and decanted carefully into a separate container. The decanted liquid was then added to the TMR in the feed mixer and mixed well before being pelleted. The pellets were allowed to air dry before feeding out to the lambs.

The lambs were fed ad libitum at 07:00 in the mornings and fresh water was always available. Ten lambs in each group were chosen to be weighed once a week after an over-night fasting period. Weight data were subjected to a main effects ANOVA with the aid of Statistica 7.1. The main effects were treatment and block. Least square means were separated with a Scheffe test and significance was declared at P<0.05.

The effect of enzyme treatment of the pelleted and unpelleted diets on bi-weekly weight gains are presented in Figures 4A and B.

Treatment effects on final weight and cumulative weight gain after six weeks are indicated in Tables 7 and 8. Table 7. Effect of enzyme treatment of pelleted diets on weight gain of Dόhπe Merino lambs.

It is clear from Table 7 that treatment had a highly significant effect on final weights and weight gains of lambs receiving pelleted diets. The liguid enzyme treatment of the pelleted diet resulted in the highest final weights and cumulative gains after six weeks. The dry enzyme treatment did not differ significantly from the control. The improvement in weight gain of the liguid enzyme treatment was 18.5% above that of the control.

Table 8. Effect of enzyme treatment of un-pelleted (meal) diets on weight gain of Dohne Merino lambs.

After two weeks, the lambs on the liquid enzyme treatment started to grow at a faster rate than those on the other pelleted diets and manifested a final weight gain of 18,5% higher than the control treatment. The dry enzyme treatment of the pelleted diet had no effect on the growth pattern of the lambs and did not differ from the control pelleted treatment. However, adsorption of the enzyme onto the stationary phase (Celite or maize meal) resulted in a several fold dilution factor, which might explain why no effect was observed. Enzyme treatment of the unpelleted (meal) diets did not have a clear effect on weight gains, although after four weeks it appeared as if lambs on the control diet started to fall behind the other treatments. As far as the unpelleted diet is concerned, treatment had no significant effect on final weight or weight gain. Although the control treatment appeared to have been inferior to the enzyme treatments, differences were not significant, possibly due variation between animals and low numbers. More animals per treatment might have shown differences.

Previous lamb trials in this project indicated that the treatment of forages with ABO374 resulted in increased weight gains when lambs received diets containing between 8% and 40% concentrates. Although exogenous fibrolytic enzymes are expected to increase forage digestibility, it has been indicated in the literature, as well as in our own trials, that positive results may be obtained with diets that contain relatively high amounts of concentrates, supposedly due to synergetic effects between the enzymes and rumen microbes. The purpose of the current trial was to investigate the effect of ABO374 when applied to a lamb finishing diet that contained 87% concentrate and only 13% forage. At the onset of the trial, it was thought that the high energy diet would result in maximum lamb growth and that enzyme application might not result in improved gains. The fact that the liquid enzyme cocktail resulted in significantly improved weight gains in the pelleted diet was surprising, especially under farm conditions. It also appeared as if lambs receiving the unpelleted enzyme treated diets started to outperform the control lambs after four weeks, but the effect was not significant due to considerable variation and low lamb numbers.

The results have indicated that the enzymes produced by ABO374 improve the lambs' ability to gain weight - and in addition, prevent them from losing weight in times of severe stress. Furthermore, the enzyme composition from ABO374 is comparable to products which are commercially available. Specific findings show that the candidate feed additive is more effective in concentrated feeds than in forage feeds. The ABO374 fungus strain thus has potential to be used for exogenous application in animal feeds and could be a valuable commodity in the animal feed industry, both in low grade animal forage action and high grade feed concentrate. The enzyme composition from the fungus strain is simple to produce, making it an economical and simple alternative to existing feed treatments.

Further experiments will be conducted to test the effect of adding enzymes from ABO374 to chicken and fish feeds. Enzyme addition to chicken feeds has shown a clear advantage, considering chickens are monogastric animals not capable of degrading cellulosics, as found for ruminants that can degrade cellulosic materials. It is expected that the addition of enzymes from ABO374 to fish feeds, especially those that contain plant materials (such as those used in Tilapia and abalone aquaculturing), will also produce positive results.

A sample of Aspergillus carneus (van Tiegham) Blockwitz has been deposited by the applicant in terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for the Purposes of Patent Procedure at the Centraalbureau voor Schimmelcultures (CBS 116150).

While the invention has been described in detail with respect to specific embodiments thereof, it will be appreciated by those skilled in the art that various alterations, modifications and other changes may be made to the invention without departing from the spirit and scope of the present invention. It is therefore intended that the claims cover or encompass all such modifications, alterations and/or changes.

References

Beauchemin, K. A., Rode, L. M. & Sewalt, V. J. H., 1995. Fibrolytic enzymes increase fiber digestibility and growth rate of steers fed dry forages. Can. J. Anim. Sci. 75, 641-644.

Beauchemin K.A., Colombatto D., Morgavi D. P., & Yang W.Z., 2003. Use of exogenous fibrolytic enzymes to Improve feed utilization by ruminants. J. Anim. Sci. 81 ,37-47

Beauchemin, K.A., Colombatto, D. & Morgavi, D. R., 2004. A rationale for the development of feed enzyme products for ruminants. Can J. Anim. Sci. 84, 24-36. Columbatto, D., Mould, F. L., Bhat, M. K., Morgavi, D. P., Beauchemin, K. A. & Owen, E., 2003. J. Anim.

Sci. 81 , 1040-1050. Cruywagen, C. W., 1999. Latest developments in measuring and monitoring feed quality for high- producing ruminants. In: Recent advances in ruminant nutrition research and development. Proc. 6^th Biennial Symp. Ruminant Nutr. ARC-Animal Nutrition and Animal Products Institute (Irene). Pretoria.

Domsch, K. H., Gams, W. and Anderson, T. H. 1980. Compendium of soil fungi. VoM . Academic Press, London.

Feng, P., Hunt, C. W., Pritchard, G. T. & Julien, W. E., 1996. Effect of enzyme preparations on in situ and in vitro degradation and in vivo digestive characteristics of mature cool-season grass forage in beef steers. J. Anim Sci. 74, 1349-1357.

Klich, M. A. 2002. Identification of common Aspergillus species. Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands.

Kung, L., Treacher, R. J., Nauman, G. A., Smagala, A. M., Endres, K. M. & Cohen, M. A., 2000. The effect of treating forages with fibrolytic enzymes on its nutritive value and lactation performance of dairy cows. J. Dairy Sci. 83, 115-122. McAllister, T. A., Oosting, S. J., Popp, J. D., Mir, Z., Yanke, L J., Hristov, A. N., Treacher, R. J. & Cheng, K. J., 1999. Effect of endogenous enzymes on digestibility of barley silage and growth performance of feedlot cattle. Can. J. Anim. Sci. 79, 353-360.

Pinos-Rodriguez, J. M., Gonzalez, S. S., Mendoza, G. D., Barcena, R., Cobos, M. A., Hernandez, A. & Ortega, M. E., 2002. Effect of exogenous fibrolytic enzyme on ruminal fermentation and digestibility of alfalfa and rye-grass hay fed to lambs. J. Anim. Sci. 80, 3016-3020. Raeder, U. and P. Broda. 1985. Rapid preparation of DNA from filamentous fungi. Letters in Applied

Microbiology 1 : 17 - 20.

Rose, S.H. & van ZyI, W.H. 2002. Constitutive expression of the Trlchoderma reesel β-1 ,4-xylanase gene (xyn2) and the β-1 ,4-endoglucanase gene (eg/) in Aspergillus nlger in molasses and defined glucose media. Appl. Microbiol. Biotechnol. 58, 461 - 468. Samson, A. R., Pitt, J.I. 2000. Integration of Modem Taxanomic Methods for Penicillium and Aspergillus

Classification. Harwood academic publishers, Singapore.

Thorn, C. and Raper, K. B. 1951. Manual of the Aspergilli. Waverly Press, Inc., U.S.A. Van Soest, P. J., 1994. Nutritional ecology of the ruminant, 2^nd edition. Cornell Univ. Press., Ithaca, NY. Vazquez, B.I., Fente, C, Franco, CM., Quinto, E., Cepeda, A., Prognon, P.. Letters in Applied

Micorbiology 1997, 24, 397 - 400.

Wallace, R. J., Wallace, S. J. A., McKain, N., Nsereko, V. L. & Hartnell, G. F., 2001. Influence of supplementary fibrolytic enzymes on the fermentation of corn and grass silages by mixed ruminal microorganisms in vitro. J. Anim. Sci. 79, 1905-1916.

White, TJ. , Bruns, T., Lee, S. and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. Yang, W. Z. Beauchemin, K. A. & Rode, L. M., 1999. Effects of an enzyme feed additive on extent of digestion and milk production of lactating dairy cows. J. Dairy Sd. 82, 391-403. (http://www. aquarestoration.com/html/mold_types.htm)

Claims

CLAIMS:

1. An isolated Aspergillus carneus fungus strain, designated Aspergillus carneus (van Tiegham) Blockwitz (CBS Accession Number 116150).

2. A fungus strain according to claim 1 , which produces a plurality of exogenous fibrolytic enzymes.

3. A fungus strain according to claim 2, wherein the fibrolytic enzymes are selected from the group consisting of β-xylanase, β-endoglucanase, β- mannanase, β-glucosidase, α-arabinofuranosidase, β-xylosidase and feruloyl esterase.

4. A fungus strain according to claim 2 or 3, wherein the enzymes are capable of increasing digestibility of an animal feed.

5. A fungus strain according to claim 4, wherein the animal feed is wheat straw.

6. A fungus strain according to claim 4, wherein the animal feed is a feed for ruminants.

7. A fungus strain according to claim 4, wherein the animal feed is a feed for fish.

8. A fungus strain according to claim 4, wherein the animal feed is a feed for poultry.

9. A culture supernatant obtained by culturing the fungus strain having CBS Accession Number 116150.

10. A culture supernatant according to claim 9, which includes a plurality of exogenous fibrolytic enzymes.

11. A culture supernatant according to claim 10, wherein the fibrolytic enzymes are selected from the group consisting of β-xylanase, β-endoglucanase, β- mannanase, β-glucosidase, α-arabinofuranosidase, β-xylosidase and feruloyl esterase.

12. An extract of a culture supernatant obtained by culturing the fungus strain having CBS Accession Number 116150, the extract including a plurality of exogenous fibrolytic enzymes.

13. An extract according to claim 12, wherein the fibrolytic enzymes are selected from the group consisting of β-xylanase, β-endoglucanase, β-mannanase, β- glucosidase, α-arabinofuranosidase, β-xylosidase and feruloyl esterase.

14. An animal feed additive which includes the fungus strain having CBS Accession Number 116150 and/or a plurality of exogenous fibrolytic enzymes produced by the fungus strain.

15. A feed additive according to claim 14, which is for use on a feed for ruminants.

16. A feed additive according to claim 14, which is for use on a feed for poultry.

17. A feed additive according to claim 14, which is for use on a feed for fish.

18. A feed additive according to any one of claims 14 to 17, which is in a liquid form.

19. A feed additive according to any one of claims 14 to 17, which is in a powdered form.

20. An animal feed that has been treated with a feed additive of any one of claims 14 to 19.

21. An animal feed according to claim 20, which is a feed for ruminants.

22. An animal feed according to claim 20, which is a feed for poultry.

23. An animal feed according to claim 20, which is a feed for fish.

24. An animal feed according to claim 21 , which is a forage feed.

25. An animal feed according to claim 24, wherein the forage feed is wheat straw.

26. An animal feed according to any one of claims 20 to 23, which is a concentrated feed.

27. An animal feed according to any one of claims 20 to 23, which is a pelleted feed.

28. An animal feed according to claim 27, which is treated with the feed additive prior to pelleting.

29. An animal feed according to any one of claims 20 to 28, which includes the feed additive in an amount of from about 1 ml of feed additive/kg of animal feed to about 20 ml/kg.

30. An animal feed according to any one of claims 20 to 28, which includes the feed additive in an amount of from about 5 ml of feed additive/kg of animal feed to about 10 ml/kg.

31. An animal feed according to any one of claims 20 to 28, which includes the feed additive in an amount of about 7.5 ml of feed additive/kg of animal feed.

32. A method of improving digestibility of an animal feed, the method including the step of treating the animal feed with the fungus strain having CBS Accession Number 116150, a culture supernatant of any one of claims 9 to 11 , an extract of either of claims 12 or 13 or a feed additive of any one of claims 14 to 19.

33. A method according to claim 32, wherein the fungus strain and/or its enzymes degrade the cell walls of the animal feed.

34. A method according to claim 32 or 33, wherein the fungus strain, culture supernatant, extract or feed additive is applied to the animal feed in an amount ranging from about 1 ml/kg of animal feed to about 20 ml/kg.

35. A method according to claim 32 or 33, wherein the fungus strain, culture supernatant, extract or feed additive is applied to the animal feed in an amount ranging from about 5 ml/kg of animal feed to about 10 ml/kg.

36. A method according to claim 32 or 33, wherein the fungus strain, culture supernatant, extract or feed additive is applied to the animal feed in an amount of about 7.5 ml/kg of animal feed.

37. A method according to any one of claims 32 to 36, wherein the animal feed is treated with the fungus strain, culture supernatant, extract or feed additive prior to the feed being pelleted.

38. A method according to any one of claims 32 to 37, wherein the animal feed is treated with the fungus strain, culture supernatant, extract or feed additive about 6 to about 24 hours prior to it being fed to an animal.

39. A method according to any one of claims 32 to 38, wherein the animal feed is treated with the fungus strain, culture supernatant, extract or feed additive about 18 hours prior to it being fed to an animal.

40. A method of increasing weight gain in an animal, the method comprising the step of treating an animal feed with the fungus strain having CBS Accession Number 116150, a culture supernatant of any one of claims 9 to 11 , an extract of either of claims 12 or 13 or a feed additive of any one of claims 14 to 19.