WO2011038259A1 - Synthetic glycosyl hydrolase based on dna nanoweaves - Google Patents

Abstract

The present invention concerns the synthesis of an artificial glycosyl hydrolase enzyme, comprising an active site capable of bifunctional catalysis, which has been covalently bonded to a rigid organic matrix through the use of a tethering construct. The active site of this enzyme can comprise natural amino acids, unnatural amino acids, which include enantiomers, disastereomers, or homologues of a natural amino acid, or peptidomimetic amino acids that contain a catalytic moiety typically found on an amino acid, including carboxylic acid, hydroxyl, thiol, amine, amide, guanidinyl, imidazoyl, selenyl, or aryl. Other non-biotic groups known to participate in glycosidic bond cleavage include urea and thiourea. The rigid organic matrix of this artificial enzyme comprises a singularity or plurality of biopolymeric matrices, including deoxyribonucleic acid, ribonucleic acid, locked nucleic acid, morpholino nucleic acid, or peptide nucleic acid helices or helical bundles. The unique chemical function can comprise glycosidic bond hydrolysis using a bifunctional catalytic mechanism.

Description

SYNTHETIC G LYCOS YL HYDROLASE BASED ON DNA NANOWEAVES

TECHNICAL FIELD

[0001] The present invention concerns DNA-based nanostructures that display hydrolytic activity against oligosaccharide polymers.

BACKGROUND ART

[0002] This application is related to US provisional application 61/245,890, filed 9/25/2009; and to U.S. provisional application 61/246,020, filed 9/25/2009; and to U.S. provisional application 61/250,948, filed 10/13/2009; and to U.S. provisional application 61/250,503, filed 10/10/2009; each of which is incorporated herein by reference.

[0003] All complex carbohydrates are comprised of repeating saccharide units; the nature of these monomers, as well as their relative connectivity, determines the overall chemical stability and function of the polysaccharide or oligosaccharide. Cellulose, for example, consists exclusively of D- Glucose monomers bearing β-1,4 linkages, which render it extremely stable to environmental stresses due to the uniform hydrogen bonding network (see Fig. 1). In contrast, hemicellulose is heterogeneously comprised of glucose, mannose, and galactose, and the relative linkages between the monomer units vary considerably. This randomness renders the oligomer susceptible to hydrolysis under mild conditions. Other saccharide constructs such as pectin and glycogen vary in their monomer constitutions, connectivities, and biological functions.

[0004] The enzymatic hydrolysis of glycosidic bonds follows one of two operative mechanisms, with the amino acid residues actively involved in this process being highly conserved across all families. Situated directly above and below the anomeric carbon center of a saccharide bound in the active site, two carboxylic acid bearing amino acids, glutamic acid (Glu) or aspartic acid (Asp, see Fig. 2), have been proven to operate in concert by a general acid - nucleophile mechanism. Within this mechanism, either "inversion" or "retention" can be in operation, and these sub-mechanisms can be determined based on the relative stereochemistry of the resultant saccharide, or else based on the relative distance between the two active amino acids in the active site.

[0005] Concerning the inversion mechanism pertaining to cellulose, this refers to the fact that the cleaved product now possesses an a-anomeric stereogenic center, in contrast to the initial β-linkage (Fig. 2). Crystallographic studies have shown that the Glu/Asp pair is spaced 10A apart, with one residue existing in the protonated form, and the other as the conjugate base (Fig. 1). Initial protonation of the exocyclic oxygen affords the oxocarbenium intermediate, which is then intercepted by a partially-deprotonated exogenous water molecule to afford the inverted product. The retention mechanism is more complex, and is the product of a double-inversion event. In this case, the amino acids are 5.5A apart, and it is the conjugate base which intercepts the oxocarbenium ion. This glycosyl acetate adduct is highly susceptible to hydrolysis, and does so under a S_n2-like mechanism to afford the β-product.

[0006] The glycosidic bond is also susceptible to hydrolysis by a number of organic and mineral acids, however many of these acids lead to substrate dehydration, rearrangement or degradation, and furthermore present issues regarding recyclability. The thiourea group is related to these acids in terms of hydrogen bonding ability, and is also able to cleave glycosidic bonds in a manner similar to that of acid catalysts (Fig. 3). In particular, 1,2:5, 6-di-isopropylidene glucose can be deketalized in a 0.8M aqueous thiourea sol ution (Fig. 4). This reasonably high concentration of thiourea indicates that this reaction requires a multiplicity of thiourea molecules for hydrolysis to occur (See Majumdar and Bhattacharjya, J Org Chem 64, 5682 (1999)). A second example is put forth by Kotke and Shreiner, who were able to show the converse; namely the ketalization of free alcohols with dihydropyran (DHP) under anhydrous conditions (See Kotke and Schreiner Synthesis 5, 779 (2007)). As ketalization is an equilibrium process which is greatly affected by the presence of exogenous water, it can be assumed that the former reaction would not proceed unless water was vigorously excluded, and indeed their experimental shows the use of oven dried glassware in which the reaction was performed. It can therefore be inferred that the inclusion of water after the ketalization step would most likely affect the reverse reaction.

[0007] Nearly all biotic enzymes comprise a peptide backbone containing a multiplicity of catalytic amino acids. This linear chain of monomers will fold into a desired conformation through hydrogen bonding, entropic considerations, and post-processing enzymes or cellular structures to form the active catalyst. It is known to those in the art of enzymology that an overwhelming majority of these residues play no part in catalysis, but rather serve to create and bolster the enzyme active site. The remaining residues will display their active groups into specified areas to facilitate either substrate binding or catalysis.

[0008] Enzymes based on oligonucleotides include catalytic NA or ribozymes, which are essential for the production of proteins, and catalytic DNA, which regulates the hydrolysis of RNA.

[0009] The present invention can be constructed on a matrix comprising a multitude of biopolymeric helical bundles. These bundles are comprised of com puter designed, custom synthesized single stranded DNA molecules, which will anneal in solution according to Watson-Crick base pairing. The phenomenon of helical cross linking is well known to those in the art of DNA weaving or DNA origami, and originated with the discovery of the Holliday Junction quadruplex (See Holliday, Genet Res 5, 282 (2005)). For instance, if four single strands (one half of a double helix) of DNA with the following sequences were placed in solution, they would naturally form a cross-link between two helices: Strand 1: CCACCTTTTCAGCTCGCGCCCCAAAT

Strand 2: GGTGGAAAAGTCGATAACGAATTAAA

Strand 3: ATTTGGGGCGCGAAAGCCTCAGAGCA

Strand 4: TTTAATTCGTTATTTCGGAGTCTCGT

Because of the sequence code, strands 2 and 3 "bend" to form a cross-link between different DNA double helices (Fig. 5a, Fig. 5b). This principle contributes to Incitor's bionanolattices (See Seeman, In: Biomolecular Stereodvnamics, 269 (1981), and othemund, Nature 440, 297 (2006)). A number of researchers have already generated three dimensional structures using these techniques, ranging from stacked blocks to more complex three dimensional structures (See Chen and Seeman, Nature 350, 631 ( 1991)). Shawn Douglas and William Shih from Harvard recently published on some of the three-dimensional DNA woven structures possible, for instance (See Douglas and Shih, Nature 459, 414 (2009)).

[0010] It is believed that the presence of these helical cross links, as well as any additional inter- helical hydrogen bonds or ion coordinations, will render these matrices as more resistant to industrial stresses than traditional biotic enzymes with regards to temperature, salinity, or pH.

[0011] Other technologies to utilize DNA as a synthetic enzyme have been reported by Feringa (See Roelfes and Feringa, Angew Chem Int Ed 44, 3230 (2005)). By creating a ternary linker group to connect a copper ion to a chiral DNA helix, the inherent chirality of the DNA was efficiently transferred to the metal, which in turn created asymmetric induction in a metal-catalyzed Diels- Alder reaction (Fig. 6). It should be noted that this ternary complex was attached to the DNA using 9-aminoacridine intercalating group, which allowed for little control on the specific placement of th metal with respect to the DNA, and could not serve as an effective method for the present invention. Furthermore, this particular chemical transformation does not require bifunctional catalysis as would glycosyl bond hydrolysis.

[0012] Other technologies to utilize chemically modified DNA to affect the cleavage of depurinated DNA strands have been reported by Perrin (See May et al., J Am Chem Soc 126, 4145, (2004)). In thi report, peptidomimetic lysine and histidine groups were synthesized from uracil and adenosine, repectively, and incorporated into synthetic DNA using solid phase chemistry (Fig. 7). The amino an imidazole groups were found to project to an orientation that would facilitate Schiff base formation followed by subsequent elimination of the 3'-phosphate to cause a DNA chain break.

DISCLOSURE OF INVENTION

[0013] The present invention concerns the synthesis of an artificial glycosyl hydrolase enzyme, comprising an active site capable of bifunctional catalysis, which has been covalently bonded to a rigid organic matrix through the use of a tethering construct. The active site of this enzyme can comprise natural amino acids, unnatural amino acids, which incl ude enantiomers, disastereomers, or homologues of a natural amino acid, or peptidomimetic amino acids that contain a catalytic moiety typically found on an amino acid, including carboxylic acid, hydroxyl, thiol, amine, amide, guanidinyl, imidazoyl, selenyl, or aryl. Other non-biotic groups known to participate in glycosidic bond cleavage include urea and thiourea. The rigid organic matrix of this artificial enzyme comprises a singularity or plurality of biopolymeric matrices, including deoxyribonucleic acid, ribonucleic acid, locked nucleic acid, morpholino nucleic acid, or peptide nucleic acid helices or helical bundles. The unique chemical function can comprise glycosidic bond hydrolysis using a bifunctional catalytic mechanism. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The accompanying drawings, which are incorporated in and from part of the specification, illustrate the present invention and, together with the description, describe the invention. In the drawings, like elements are referred to by like numbers.

Fig. 1 shows exemplary amino acids typically found in the active sites of all glycosyl hydrolases, along with typical polysaccharide bonding motifs.

Fig. 2 shows the "inversion" and "retention" mechanisms of hydrolysis, along with requisite intermolecular distances.

Fig. 3 shows exemplary thiourea catalysts, including a chiral and resin bound variants.

Fig. 4 shows exemplary synthetic mechanisms and methods for glycosyl bond modifications using thiourea catalysis.

Fig. 5a illustrates the interaction of four semi-complementary single strands of DNA to create a "Holliday Junction" (See Holliday, Genet Res 5, 282 (2005)).

Fig. 5b illustrates a ball-and-stick model of a Holliday Junction.

Fig. 6 shows an exemplary catalytic system attached to a DNA helix using an acridine intercalator. This system was effective in the cycloaddition reaction between cyclopentadiene and chalcone (See Roelfes and Feringa, Angew Chem Int Ed 44, 3230 (2005)).

Fig. 7 shows an exemplary catalytic system wherein DNA cleavage could be affected by a chemically modified DNA strand containing a lysine and histidine peptidomimetic (See May et al., J Am Chem Soc 126, 4145, (2004)).

Fig. 8 shows an exemplary tetra-helical DNA construct, containing 6 aspartic acid pairings which are covalently attached to helices 1 and 4.

Fig. 9 shows a space-filling model of an artificial enzyme for use in the hydrolysis of glycosidic bonds. Fig. 10 shows an exemplary synthetic representation of the attachment of a multiplicity of thiourea groups onto a single modified nucleotide base using a dendrimer-like approach.

Fig. 11 shows an exemplary multihelical thiourea-based artificial enzyme. Fig. 12 shows an exemplary synthetic "click" reaction between an alkyne-containing thymidine derivative, with an azido-acid molecule to generate a peptidomimetic aspartic acid residue for use in hydrolysis.

Fig. 13 shows the synthetic route for the production of the preferred phosphoramidite base for use in solid phase DNA synthesis to produce the synthetic enzyme.

Fig. 14 shows an analytic gel electrophoresis image showing successive additions of single strands to the growing structure. The second lane from the right corresponds to the addition of all of the DNA strands, to produce a single band, with no indication of unannealed strands below it.

Fig. 15 is a schematic illustration of enzymatic hydrolysis of glycosidic bonds.

Fig. 16 is a schematic illustration of an inversion mechanism and a retention mechanism.

Fig. 17 is a schematic view of an example bionanolattice according to the present invention.

Fig. 18 is a schematic illustration of an example application of a target molecule according to the present invention.

Fig. 19 is a schematic illustration of properties of thiourea. Illustrated in Fig. 19: 1: unfunctionalized thiourea; 2: a highly-reactivity thiourea with two 3,5-bis-trifluoromethylphenyl groups; 3: a bi- functional thiourea catalyst capable of generating high levels of enantioselectivity in the Michael reaction ; 4: a thiourea catalyst bound to a polystyrene resin.

Fig. 20 is a schematic illustration of bonding properties of thiourea.

Fig. 21 is a schematic illustration of the front view of a bionanolattice according to the present invention.

Fig. 22 is a schematic illustration of the top view of a bionanolattice according to the present invention.

Fig. 23 is a schematic illustration of the use of attached thiourea moieties to serve as a binding site for glycosidic polymers containing uronic acid derivatives.

Fig. 24 is a schematic illustration of the chemical synthesis of a target compound.

Fig. 25 is a depiction of a multi-helical protein that spans the cellular membrane.

Fig. 26 is a depiction of an example six-helical DNA synthetic ion channel selective for positive ions.

The molecules in blue represent compounds capable of hydrophobic interactions, of which a few examples are shown. The central red crown ether represents the ionophilic interior to facilitate ion transport.

Fig. 27 is a depiction of an example six-helical DNA synthetic ion channel selective for negative ions. Fig. 28 is a depiction of an example of a dipole-based ion gated channel, beginning from crown ether (neutral) to a carboxylate (mono-anionic) to a phosphate (di-anionic).

Fig. 29 is a depiction of an example dipole-based ion gated channel, representing an increase in local concentrations of carboxylate residues.

Fig. 30 is a depiction of a representative monomer unit of the creation of a functional DNA bionanolattice synthetic ion pore.

[0015] BEST MODES AND IN DUSTRIAL APPLICATION OF THE INVENTION

In the present invention, an artificial glycosyl hydrolase can meet the requirement of having two carboxylic acid residues, either glutamic acid, aspartic acid, or mimic of such, at specified intermolecular distances. A distance of about 10A is required for the "inversion mechanism" of hydrolysis, allowing for both a water molecule and the substrate to be contained in the active site. An effective distance of 5.5A between these residues allows for the "retention mechanism" of hydrolysis, which is seen in other members of this enzymatic family.

[0016] In an example embodiment, the appropriate intermolecular distance between the active catalytic residues can be between 2-20A, with 5.5A the preferred distance in some embodiments.

[0017] An example of an artificial glycosyl hydrolase that is capable of this requirement comprises the utilization of a singularity or plurality of individual DNA single strands, the sequences of which have been engineered such that annealing in solution will generate a rigid construct based on Watson-Crick base pairing tenets.

[0018] An embodiment of this invention includes hairpin loops of DNA that will generate pockets into which catalytic residues can be inserted, such as in the following sequence:

AG CTGTCAG CTAXXXXXXTAG CTG ACAG CT, wherein the ends of the strand are complementary and will fold back on one another, and the "X" positions represent modified nucleobases bearing a catalytic aspartic acid, glutamic acid, or suitable peptidomimetic residue. The nature and representative syntheses of these modified residues will be discussed below.

[0019] Another embodiment of the present invention can also comprise the utilization of several semi-complementary single DNA strands, such that when annealed in solution will generate a complex three dimensional shape, drawing on techniques concerning DNA weaving or DNA origami. Cross links between DNA helices can be designed pre-synthesis through computer aided design programs, such as Tiamat. The development of three dimensional shapes can arise from helical torque phenomena, using the assumption that a full DNA helical turn requires approximately 10.5 base pairs. In this way, it is possible to design a trough-like or barrel-like design through minimal helical domains. Consider the following twelve sequences, ranging in length from 14 to 63 base pairs:

1. CGGGCGACATGGTA

2. G G CTTG CACCGCTACGTCGTTTCCG CAACTTTCCACGTAGTAG G CG CCCCCTTACATCG CCCG

3. GXGAAGCCCGCAXGGAGGCGTTGTAAGGGGGCGCCCGACCAA 4. AXTAAATTGACTXATACTACGCCTCACGACGGAGTACTTCGT

5. GXGGGGGGTCTCXCCTACGCTTGGAAAGTTGCGGACGTGCAA

6. GTTAACAGCGGTAGATATGXAAACGACGGGTTCACTATGCCTACGAGAC

7. TXCCCCTG CCG CCG ACCTTATTAG CG GTG CAAG CC

8. TACCATGACGCCTCACTCCGTCGTGAGGAGCGTAGAGGCATAGTGAACCATAAGGTTTCCCCA

9. TGGGGAAGCCATGA

10. TCAXGGCCGGCGGCAGGGGAAGTCTCGTGAGAGACCCCCCACACGAAGTCATGCGGGCTTCAC

11. GXGGTTCCAGTGXC

12. GACACTGGAACCACTTGGTCGTAAGTCAATTTAATTTGCACGTACATATCTACCGCTGTXAAC

[0020] Computational methods predict that these strands will self-assemble into a tetra-helical trough-like structure, 63 base pairs in length, with several cross-links between each adjacent helix (Fig. 8, Fig. 9). These cross links occur at multiples of seven bases, which are predicted to generate an angle of approximately 60^Q between the flanking helices and the plane of the interior helices through a molecular torquing effect. Many of the glycosyl hydrolase enzymes display their active sites on the exterior of their structures, forming a very analogous trough-like structure to the one predicted on the synthetic construct. On these sequences, twelve "X" bases containing aspartic acid mimicking functionality are anticipated to display these groups into the interior of the trough, for a total of six catalytic pairs, or six active sites. As there are multiple catalytic centers on the single construct, this represents a hypothetical improvement over the native cellulase enzymes.

[0021] An example of an artificial glycosyl hydrolase that is capable of this requirement can also comprise the use of /V-phenyl thiourea moieties, which have been covalently attached onto a multiplicity of DNA helices. As described above, it can be necessary to create a high local concentration of thiourea in order to affect glycosyl hydrolysis. This can be accomplished by the attachment of several thiourea groups onto a single modified nucleobase, in similarity to dendrimer generation growth (Fig. 10). These thioureas can also decorate the exterior of a multi-helical barrel construct, or the periphery of a single DNA duplex (Fig. 11).

[0022] There is a substantial binding event between thiourea and carboxylates, such as those groups found in the oligosaccharide monomer, pectin (Fig. 9). This interaction can serve as the binding domain, followed by sequential catalysis by proximal thiourea groups.

[0023] For the oligonucleotide-based artificial enzymes, several base modifications are available aside from thymidine (T), adenosine (A), guanidine (G), and cytosine (C), and can have profound effects on helical dimensions or helical turn rates. Such examples of modified bases include ribonucleic acids (RNA), locked nucleic acids (LNA), peptide nucleic acids (PNA), and morpholino- base nucleic acids, although for this embodiment the deoxyribonucleic acid bases (A, C, T, G) are preferred.

[0024] For the DNA-based synthetic glycosyl hydrolase the modified "X" base refers to any of the above nucleobases, which have been modified using methods known in the art of organic chemistry. The aspartic acid - like mimetic molecule can be covalently attached to any point on these nucleobases, including the phosphate, the ribose, the deoxyribose, the locked ribose bicycle, the morpholino ring positions, or the nucleobase heterocycle or other pendant groups, using etherification, esterification, amidation, amination, alkylation, cycloaddition, cross-coupling, or other appropriate reactions.

[0025] An example embodiment can include the halogenation of thymidine at the 5' position, followed by azide displacement and reduction to afford aminomethyl thymidine. The amine group can serve as a handle for subsequent manipulations. Such halogen sources include bromine, chlorine, iodine, N-bromosuccinimide, N-chlorosuccinimide, or N-iodosuccinimide, or other electrophilic halogen sources, with N-bromosuccinimide being the preferred method in some embodiments.

[0026] In another example embodiment, the halogenation of uracil is followed by Sonagashira cross- coupling with a copper acetylide to form an alkynyl uracil derivative. Such halogen sources include bromine, chlorine, iodine, N-bromosuccinimide, N-chlorosuccinimide, or N-iodosuccinimide, or other electrophilic halogen sources, with iodine being the preferred method in some embodiments.

[0027] In another example embodiment, the method includes the hydroxymethylenation of uracil with a hydroxymethylene precursor, such as formaldehyde, paraformaldehyde, or 1,3,5-trioxane, with paraformaldehyde as the preferred method in some embodiments.

[0028] In another example embodiment, the present invention would include the halogenation of adenosine, cytosine, or guanosine at positions known to be nucleophilic, by electrophilic halogen sources such as bromine, chlorine, iodine, N-bromosuccinimide, N-chlorosuccinimide, or N- iodosuccinimide, with N-bromosuccinimide being the preferred method.

[0029] In another example embodiment, the method includes attachment of the linker to the 5'- phosphate at the conclusion of solid phase DNA synthesis.

[0030] For DNA-based artificial enzymes, the tethering construct can comprise any organic chain of known length that serves to covalently attach the peptidomimetic group to the biopolymeric matrix. This chain can be designed to project the catalytic group into a specific location, and can be comprised of carbon, oxygen, sulfur or nitrogen, in combinations typically found in bioconjugate constructs, such as (poly)ethylene glycol (PEG), ketal, triazole, dithiol, phthalimide, maleimide or alkyl. [0031] In some embodiments, the preferred tethering constructs can be designed to project carboxylic acid residues such that the relative spacing between two acid residues is approximately 5.5A. These distances can also be varied to achieve distances between 2 - 20A.

[0032] The present invention can make use of a maleimide-containing molecule that is combined with a thiolized fragment through a conjugate addition reaction, to generate the polymer-tether- catalytic residue construct.

[0033] The present invention can also include a copper-catalyzed [3+2] dipolar cycloaddition between a terminal alkyne and an azide fragment to form a triazole attachment point (Fig. 12). The exemplary reactions, known to those in the art as "bioconjugate reactions" can be performed before or after the DNA synthesis or DNA weaving procedures, as these are known to involve minimal byproducts and very mild reaction conditions.

[0034] In some embodiments, the copper-catalyzed [3+2] dipolar cycloaddition is the preferred method of attachment of the carboxylic acid group; wherein the copper catalyst can include copper (II) sulfate, copper (I) iodide, copper (I) bromide, copper (I) chloride, copper (I) acetate or copper metal, with the preferred method being copper (I) bromide; wherein the preferred stabilizing ligand is TBTA, Tris[(l-benzyl-lH-l,2,3-triazol-4-yl)methyl]amine; wherein the stoichiometric oxidizing agent is ascorbic acid or any salt thereof, or atmospheric oxygen, with the preferred method being sodium ascorbate.

[0035] EXAMPLE 1

The abbreviations used in the experimental details are defined as follows:

EtOAc - Ethyl Acetate

NaHC0₃ - Sodium Bicarbonate

NH₄OH - Ammonium Hydroxide

MeOH - Methyl Alcohol

DMAP - 4-(dimethylamino)pyridine

DMTrCI - 4,4'-(dimethoxy)triphenylmethyl chloride

CH₂CI₂ - Dichloromethane

NEt₃ - Triethylamine

[0036] Representative synthesis of N-((l-(4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)-2,4- dioxo-l,2,3,4-tetrahydropyrimidin-5-yl)methyl)undec-10-ynamide:

(3-acetoxy-5-(5-(azidomethyl)-2,4-dioxo-3,4-dihydropyrimidin-l(2H)-yl)tetrahydrofuran-2-yl (methyl acetate was prepared according to literature methods (See Hong et al. J Am Chem Soc 128, 2230 (2006). The azide (0.53 g, 1.44 mmol) was dissolved in dry toluene (15 ml, 0.1M) and

dichloromethane (1.5 ml, 1.0M), and 10-undecynoic acid (0.29 g, 1.59 mmol) and triphenylphosphine (0.38 g, 1.44 mmol) were added sequentially. The reaction was heated to reflux for 72h, then cooled to ambient temperatures. The toluene was removed under vacuum, and the residual material taken up into a bi-phasic mixture of EtOAc (100ml) and 10% NaHC0₃ solution (100ml). The organic layer was washed with NaHC0₃ solution (2x), followed by brine. The organic solvent was removed, followed by chromatographic purification (0 % - 7% MeOH:EtOAc) to afford the amide, with large quantities of triphenylphosphine oxide contaminant. This material was dried over high vacuum, then dissolved in 1:1 NH₄OH:dioxane and stirred for 12 hours at ambient temperature. At this time, the volatiles were removed under vacuum, and the residual material columned by silica chromatography (5% - 15% MeOH:EtOAc) to afford the diol (0.371 g, 61% yield) as a white foam (Figure 13).

[0037] EXAMPLE 2

Representative synthesis of N-((l-(5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4- hydroxytetrahydrofuran-2-yl)-2,4-dioxo-l,2,3,4-tetrahydropyrimidin-5-yl)methyl)undec-10-ynamide: The above diol (0.126 g, 0.30 mmol), DMAP (0.005 g) and DMTrCI (0.203 g, 0.60 mmol) were dissolved in dry pyridine (8.0 ml) and stirred 16h. The volatile materials were removed under vacuum, and the residue columned directly on silica gel (0% to 5% MeOH:EtOAc) to yield the product (0.114 g, 53% yield) as an off-white foam.

[0038] EXAMPLE 3

Representative synthesis of 2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(2,4-dioxo-5-( undec- 10-ynamidomethyl)-3,4-dihydropyrimidin-l(2H)-yl)tetrahydrofuran-3-yl 2-cyanoethyl

diisopropylphosphoramidite:

The secondary alcohol (0.114 g, 0.158 mmol) from [0028] was dissolved in methylene chloride (1.6 ml, 0.1M). Hunig's base (0.055 ml, 0.315 mmol) and 0-(2-cyanoethyl)-/V,/V-diisopropyl

chlorophosphoramidite (0.046 ml, 0.205 mmol) were added sequentially, and the reaction stirred at ambient temperature for 3h. The reaction was quenched by the addition of 10% aqueous NaHC0₃. The aqueous phase was extracted with CH₂CI₂ (3x 15ml), and these fractions were pooled and dried over Na₂S0₄. The product was subjected to silica chromatography, and eluted with 79:20:1 EtOAc:Hexanes:NEt₃ to produce the amidite (0.129g, 88% yield) as a beige foam.

[0039] EXAMPLE 4

The phosphoramidite was incorporated into twelve positions labeled with an X, as shown above using an Expedite Nucleic Acid Synthesis System. At the completion of the coupling cycles, the resin was heated to 65 ^QC in concentrated NH₄OH for 15h, followed by removal of volatile components and purified by gel electrophoresis. DNA solution concentrations were quantified by absorbance analysis by a Nanodrop spectrophotomer. Equimolar DNA solutions were annealed by variable temperature step gradients, and gel electrophoresis showed the production of a single band in the appropriate lane (Figure 14).

[0042] Further Example Embodiments. The following example embodiments relate to synthesis of enzymes, and the use of enzymes, in various applications. Several representative applications are described; those skilled in the art will appreciate variations within the scope of the described invention(s), and other applications that are also within the scope of the described inventions.

[0043] Perchloroethylene and Trichloroethylene Degradation via Synthetic Enzymatic Catalytic Pathways. This example embodiment facilitates degradation of perchloroethylene and

trichloroethylene via synthetic enzymatic catalytic pathways.

[0044] Perchloroethylene (PCE) and Trichloroethylene (TCE) are two very common solvents that have been used extensively in the last 70 years. Both PCE and TCE had been found in at least 771 of the 1,430 National Priorities List sites identified by the Environmental Protection Agency (EPA), along with hundreds of thousands of PCE/TCE contaminated sites throughout the U.S. In 2003 the Air Force reported 1,400 military sites contaminated with both PCE and TCE. In 2007 the navy reported 22 bases that were heavily contaminated with both PCE and TCE. The toxicity of PCE and TCE has been studied extensively, due to their role in causing cancer, liver damage and long term damages to the central nervous system. In 2008, Senator Barack Obama proposed bill S1068, cosponsored by Hillary Clinton and others. This legislation aims to set a framework for dealing with the

consequences of PCE and TCE in soil and groundwater.

[0045] A reason why PCE and TCE pose such a prevalent problem is that they both migrate quickly through the unsaturated soil in the form of dense non-aqueous phase liquid (DNAPL) and pool on top of a confining layer. In this form, PCE and TCE serve as a long-term (hundreds of years) source for the contamination of drinking water. Due to the extremely high volatility of PCE, pooled PCE in soil will partition into the soil vapor and migrate upwards into residential facilities, degrading air quality and posing serious health hazards in large areas around where leaks had occurred.

[0046] The current technologies for treating PCE and TCE can be divided into three types: physical, chemical and biological. Physical approaches such as pump-and-treat and soil-vapor-extraction have failed in capturing the majority of the contaminated plume. In-situ chemical remediation (Ozonation, permeable reactive barrier, etc.) are usually very expensive and fail to achieve cost-effective results within a reasonable timeframe. One promising technology is biological. Biodegradation mechanisms of PCE have been studied and defined for a variety of organisms. Bacteria use specific enzymes to degrade both PCE and TCE (TCE is manufactured artificially and is also a daughter product of PCE). However, bacteria that can degrade PCE and TCE are highly susceptible to environmental conditions such as O P, DO, pH, electron donors and acceptors, nutrients, bacteria scavengers, etc. Also, the large size of the bacteria prevents it from accessing many of the small pores that are saturated with PCE in the soil, hence compromising the activity of this technology. Another disadvantage of the biological process is that vinyl chloride (VC), a potent toxic molecule, is produced as part of the degradation pathway. If for any reason the biological degradation pathway is not complete, water and air quality will be reduced even further.

[0047] The present example embodiments can provide a novel, cost-effective nanotechnology for treating both PCE and TCE in situ. Rapid degradation of PCE and TCE to Ethylene, a non-toxic organic compound, can be achieved by immobilizing two enzymes (tetrachloroethene reductive dehydrogenase and trichloroethene reductive dehydrogenase) onto a well-defined nanostructure. Once nanostructure concept has been established, a completely synthetic version of it can be built, utilizing only the active sites mechanisms from both enzymes. This synthetic enzymatic catalytic pathway can degrade PCE and TCE efficiently, while avoiding all of the problems that are associated with bacteria, including the production of VC.

[0048] In an example embodiment, bi-functional chemical linkers can be attached to the two enzymes, and the enzymes linked to the nanostructure. The degradation rates of PCE and TCE as the starting substrate can be determined, and compared to the literature.

[0049] In an example embodiment, the enzymatic active sites can be replaced with computer modeled synthetic counterparts, either both at once, or one at a time. Displaying high structural rigidity, this complex structure can show enhanced durability as compared to the multi-enzyme counterpart.

Generation of Substituted Phenols from Lignin via Synthetic Enzymes. This example embodiment involves a metal-based synthetic enzyme for the generation of substituted phenols from lignin.

[0050] Lignin comprises approximately 20% of the world's biomass, though its practical application towards the fuel or specialty chemicals industry has been limited due to its unusual chemical bonding motifs. Depolymerization of this material using enzymatic methods has proven difficult, though 48-60% of the cross-linking bonds are benzylic ethers. Irreversible cleavage of this bond can be affected through transfer hydrogenation with formic acid, however this requires exceptionally high temperatures. State of the art organic methods typically utilize palladium, either on charcoal or substituted with ligands, as a catalyst for the cleavage of this bond such that it can be run at ambient temperatures. This example embodiment generates a synthetic enzyme in which palladium has been immobilized by surface displayed thiourea ligands. The recovery of this enzyme will be facile, and leaching of palladium into solution can be minimal. In addition, this synthetic enzyme can be robust concerning pH, salinity, and temperature in comparison to known lignases. [0051] In an example embodiment, palladium, an appropriate hydrogen source (pressurized hydrogen gas, formic acid, cyclohexa-l,4-diene) and crude lignin, in solution, are reacted in a polar solvent. This reaction can be monitored by GC-MS to observe the formation of phenol products. The reaction rates at ambient temperatures in this catalytic system can be compared to the non-catalytic literature reaction.

[0052] In an example embodiment, a synthetic enzyme can be constructed such that thiourea ligands are displayed on the surface in a square formation. This structure can be incubated with palladium to introduce the metal cofactor onto the solid support. In analogy to the first example embodiment, the same reaction can be run with the synthetic enzyme to determine catalytic efficiency.

[0053] Hydrogen Gas from Cellobiose via Synthetic Enzymatic Catalytic Pathways. This example embodiment provides a synthetic enzyme catalytic pathway for the production of hydrogen from cellulosic materials.

[0054] Hydrogen Gas from Cellobiose via Synthetic Enzymatic Catalytic Pathways. This example embodiment provides a synthetic enzyme catalytic pathway for the production of hydrogen from cellulosic materials.

[0055] The chemical generation of hydrogen from renewable sources represents an attractive means to meet the growing energy needs of our country. It has been demonstrated that the enzymatic conversion of glucose and other carbohydrates to hydrogen and carbon dioxide is feasible, with yields approaching the theoretical maximum of 12 moles of H2 per mole of glucose. The complete catalytic pathway for the generation of hydrogen from cellobiose requires 13 enzymatic transformations, though initial enzyme cost and recovery from the fermentation mixtures represent the major challenges towards future development.

[0056] An effect of this example is the immobilization of this array of enzymes onto a well-defined nanostructure, to create a supramolecular multi-enzyme. Covalently linking these enzymes to a matrix will aid in their recovery from fermentation mixtures, and allow for their reuse. This multi- enzyme can be applicable to a wide range of cellulosic sources, and its efficiency of hydrogen production can be compared to those found in literature sources.

[0057] In an example embodiment, bi-functional chemical linkers are attached to the necessary enzymes, and these are linked to the nanostructure. The yield of evolved hydrogen based on the digestion of cellobiose as the starting substrate can be determined, and yield and rate compared to the literature source.

[0058] In an example embodiment, the enzymatic active sites can be replaced with computer modeled synthetic counterparts, either both at once, or one at a time. Displaying high structural rigidity, this complex structure can provide enhanced durability as compared to the multi-enzyme counterpart.

[0059] Further Example Embodiments. The enzymatic hydrolysis of glycosidic bonds follows one of two operative mechanisms, with the amino acid residues actively involved in this process being highly conserved across all families. Situated directly above and below the anomeric carbon center, two carboxylic acid bearing amino acids, glutamic acid (Glu) or aspartic acid (Asp, Fig. 15), have been proven to operate in concert by a general acid - nucleophile/base mechanism. Within this mechanism, either "inversion" or "retention" can be in operation, and these sub-mechanisms can be determined based on the relative stereochemistry of the resultant saccharide, or else based on the relative distance between the two active amino acids in the active site.

[0060] Concerning the inversion mechanism pertaining to cellulose, this refers to the fact that the cleaved product now possesses a a-anomeric stereogenic center, in contrast to the initial β-linkage (Fig. 15). Crystallographic studies have shown that the Glu/Asp pair is spaced 10A apart, with one residue existing in the protonated form, and the other as the conjugate base (Fig. 16). Initial protonation of the exocyclic oxygen affords the oxocarbenium intermediate, which is then intercepted by a partially-deprotonated exogenous water molecule to afford the inverted product. The retention mechanism is more complex, and is the product of a double-inversion event. In this case, the amino acids are 5.5A apart, and it is the conjugate base which intercepts the oxocarbenium ion. This glycosyl acetate adduct is highly susceptible to hydrolysis, and does so under a S_n2-like mechanism to afford the β-product.

[0061] The present examples contemplate mimicking the function of glycosyl hydrolase enzymes by incorporating peptidomimetic constructs onto multi-helical DNA bionanolattices. These glutamic acid / aspartic acid surrogates can be positioned to a high degree of precision in space through linkages to modified thymidine derivatives comprising the DNA helical backbone of the lattice. These DNA helices can be ~63 base pairs in length, and assuming 10.5 base pairs per turn, up to 6 active sites can be displayed per tetrameric bionanolattice (Fig. 17).

[0062] Using molecular modeling to calculate bond lengths, the target molecule in Fig. 18 contains the necessary covalent linker to position two carboxylic acid units approximately 5.5A apart, when placed in the opposed 1 and 4 helices. These calculations are based on the fact that both the effective trough distance and the width of a DNA helix will be 30A. By placing these surrogates at this distance, the present examples can provide the ability to mimic the function of the retention mechanism. The present examples also contemplate a molecule containing spaces to separate two carboxylic acid groups at 10A, thus simulating the inversion mechanism. Disproportionation into a carboxylic acid - conjugate base pair on the lattice can be accomplished by adjusting the solution pH to approximately 5.5.

[0063] This monomer can be divided into three subsections: the nucleobase (green), the linker (red), and the amino acid surrogate (blue). The chemical synthesis of this compound can take advantage of disconnections between the amide bonds. The green and red retrons shown in Fig. 18 can be covalently linked via standard peptide coupling conditions (EDCI, HOBt), and the red and blue retrons can be condensed under ambient conditions owing to the reactivity of succinic anhydride (blue). Using a PEG (poly-ethylene glycol) linker (red) was chosen due to ease of synthesis and ubiquity in the literature, though other covalent linkers containing other atoms would be amenable.

[0064] Further Example Embodiments. Every naturally occurring cellulase operates via a general acid / nucleophilic mechanism. In this first step, the exocyclic glycosidic oxygen atom is protonated by a glutamic or aspartic acid, thus weakening the C-0 bond and facilitating cleavage. The two major mechanisms, termed "inversion" and "retention," diverge after this step, but both involve interception of the oxocarbenium intermediate by a proximal aspartate or glutamate residue and subsequent hydrolysis to produce a shortened cellulose polymer. The present examples provide a non-peptidomimetic approach to cellulose hydrolysis using thiourea catalysis.

[0065] The field of thiourea organocatalysis has received a great deal of attention in the last 10 years due to the remarkable properties exhibited by this molecule (Fig. 19). Thiourea is completely non-metallic, so it can avoid issues regarding cost and disposal of toxic d- or f-block metals. It can interact with oxygen atoms through a bidentate hydrogen bonding interaction between the two N-H bonds and the two lone electron pairs on the oxygen, thus creating a thermodynamically stable six- membered intermediate (Fig. 20). As a new way to decrease electron density around an oxygen center without the use of metals, thiourea catalysis has been applied successfully to a wide variety of carbon-carbon bond forming chemical transformations. In processes requiring asymmetric induction or very high turnover rates, the attachment of various functional groups to the nitrogen atoms have been investigated with success. Electron-withdrawing aryl groups, such as in compound 2 (Fig. 19), have been shown to dramatically increase reaction rates by improving the hydrogen bonding ability of the catalyst. Chiral catalyst 3 incorporates a Lewis-basic dimethylamino group to create enantiotopic discrimination in the addition of nucleophiles to enone systems. In addition, thiourea catalysts have been attached to polystyrene solid supports, allowing for facile recovery from solution.

[0066] While most publications concerning thiourea catalysis concern the lowering of LUMO energy for oxygen-containing carbonyl and nitro compounds, there have been two examples which are relevant to the manipulation of ketal / glycoside bonds. Majumdar and Bhattacharjya have demonstrated the deprotection of a variety of ketalized products, including 1,2:5, 6-di-isopropylidene glucose, in a 0.8M thiourea aqueous solution (Fig. 20). This particular substrate is known to be stable in 75% aqueous acetic acid, making this an extremely mild and effective method for cleaving such bonds. Mechanistically, it can be inferred that the thiourea will complex with the more sterically accessible glycosidic oxygen, which is very much akin to the initial general acid protonation step seen in natural cellulase enzymes.

[0067] A second example is put forth by Kotke and Shreiner, who were able to show the converse; namely the ketalization of free alcohols with dihydropyran (DHP) under anhydrous conditions. As ketalization is an equilibrium process which is greatly affected by the presence of exogenous water, it can be assumed that the former reaction would not proceed unless water was vigorously excluded, and indeed their experimental shows the use of oven dried glassware in which the reaction was performed. It can also be inferred that the inclusion of water after the ketalization step would most likely affect the reverse reaction.

[0068] The present examples can provide the ability to mimic the function of traditional aspartate- based glycosyl hydrolase enzymes by incorporating thiourea catalysts onto DNA bionanolattices (Fig. 21 and Fig. 22). The manipulation of DNA into various two and three dimensional shapes has been pioneered by the work of Seeman and Shih, though the application of these constructs towards practical purposes has yet to be disclosed. The present examples can use multi-helical bundles which are capable of creating clefts or pockets in which catalytic activity could take place, in analogy to enzymatic active sites. These helices can be interlocked using shorter "staple strands" of DNA, in analogy to the "DNA Origami" approach by otheman. By attaching catalytic residues at precise locations along the DNA structure, it is possible to place said molecules to sub-nanometer precisions. The present examples can use a chemically modified thymidine derivative for this purpose, although the other four DNA bases (cytosine, adenine, guanine, and uracil) can be used for this purpose.

[0069] In the example above (Majumdar and Bhattacharjya), the reaction requires a highly concentrated 0.8 M solution of thiourea (61 g/L) to affect the desired transformation. The present examples provide at least two advantages. First, by attaching the catalyst to a solid support, removal from solution can be facile. This particular solid support, a DNA bionanolattice, is also expected to display a high degree of thermal stability due to its massive hydrogen bonding network. Therefore it is expected that a nanostructure according to the present invention will continue to function at high temperatures, in the case of recalcitrant ketals / glycosides seen in cellulose polymers. Second, by placing a high density of thiourea catalysts on the periphery of the DNA bionanolattice, the present examples can emulate local concentrations around the lattice close to 0.8 M, though the overall average solution molarity of thiourea would be substantially less. This can further be enhanced through the use of dendrimer-type branching, where several catalytic residues would share a single anchor point onto the lattice (Fig. 22).

[0070] While not peptidomimetic, thiourea shares some similarity to arginine in its effectiveness for complexing carboxylic acid salts (carboxylates). The polygalactonurase family of hydrolases makes use of an arginine residue in their active site, which is believed to function as a molecular recognition factor for binding with the free carboxylate of galactonuric acid. Aside from cleaving glycosidic bonds, the present examples can use the attached thiourea moieties to serve as a binding site for glycosidic polymers containing uronic acid derivatives (Fig. 23).

[0071] Regarding the attachment of a thiourea catalyst to the DNA helical backbone, a derivatized nucleobase in this case will be thymidine, although this can be extended to the other four DNA bases (guanine, cytosine, adenine, uracil, Fig. 24). The linking chain can be altered to accommodate any physical length, and can be comprised of (poly)ether, amide, ester, sulfide, or any related connection of atoms generally found in organic molecules. The nature of the R group on the thiourea can include H, but preferably any electron-deficient aromatic group, where said electron-deficient groups include trifluoromethyl, carbonyl (amide, ester, ketone), nitro or nitrile located on the o, m, or p positions of the ring. The chemical synthesis of the target compound in Fig. 24 can take advantage of the shown disconnections, involving an amide coupling between the green and blue fragments, a reduction of the terminal azide, and a condensation between the resultant amine and the red aryl thioisocyanate derivative.

[0072] Further Example Embodiments. Proteins that span cellular membranes and serve as conduits for ion transport between the cytosol and the environment have been a source of intense study. While the function of such channels is well understood, their isolation and crystallization in non- membrane environments has met with great difficulty. In order to gain a better understanding of their natural conformations, synthetic variants of these structures have been synthesized and assayed, employing two key structural elements: an ionophoric interior to facilitate ion transport, and a hydrophobic exterior to allow for incorporation into the cellular membrane.

[0073] Molecular modeling of the primary sequence of these proteins has indicated the existence of multiple trans-membrane spanning domains, either as a-helices or β-sheets, which are connected by short non-functional strands. These domains can assemble into a macromolecular barrel, much in the way a piece of paper can be curled into a cylinder. The models seems to support the above hypothesis; namely the projection of aryl or aliphatic residues around the periphery of the barrel, and the projection of heteroatomic (carboxyl, hydroxyl, amino) residues into the central cavity.

[0074] Single point mutations on these proteins can lead to a variety of conditions, most notably Cystic Fibrosis, which is an aberration of the chloride transport protein. Bacteria have capitalized on this phenomenon in the production of the natural antibiotics Gramicidin and Amphotericin, which will self-assemble into amphiphilic synthetic pores and rapidly depolarize the cellular ion gradient of target organisms. Though a good starting point for synthetic design, it is the end goal of this field to create a true "gated" channel which will not simply act as a non-selective pore, but can rather respond to external stimuli or gradient concentrations.

[0075] The present examples apply DNA bionanolattice technology to the creation of synthetic ion channels, through the covalent attachment of both hydrophobic and hydrophilic residues to the exterior and interior of the lattice, respectively. The manipulation of DNA into various two and three dimensional shapes has been pioneered by the work of Seeman and Shih, though the application of these constructs towards practical purposes has yet to be disclosed. The present examples can use multi-helical bundles, which are capable of creating clefts or pockets in which catalytic activity could take place, in analogy to enzymatic active sites, or in this case a centralized pore which has been lined with hydrophilic moieties. These helices can be interlocked using shorter "staple strands" of DNA, in analogy to the "DNA Origami" approach by otheman. By attaching peptidomimetic residues at precise locations along the DNA structure, it is possible to place said molecules to sub- nanometer precisions. The present examples can use a chemically modified thymidine derivative for this purpose; the other four DNA bases (cytosine, adenine, guanine, and uracil) can also be used for this purpose.

[0076] The present examples interconnect several helices using the "staple strand" approach to generate a construct of at least 10 nanometers in length to ensure a complete span of the cellular membrane. Varying the number of helices (n > 2) will affect the internal diameter of the synthetic channel, for example the use of n = 6 for the purpose of facilitating ion transport. The present examples can connect hydrophobic compounds to the perimeter of the lattice through covalent linkages to modified thymidine derivatives. These compounds include saturated or unsaturated aliphatic chains, phenyl, naphthyl, indoyl, or other aromatic groups, or any steroidal compound (Fig. 26). On the interior, the present examples can attach different functional groups, depending on the nature of the ion to be transported. For positively charged ions, cyclic polyethers (crown ethers) can be attached to the DNA weave as amine or catechol derivatives, though the present examples can also utilize carboxylate and hydroxyalkyl moieties for the same function. The present examples can also use tetraalkyl ammonium derivatives for negatively charged ions.

[0077] The ability to control with precision the placement of functional groups within a DNA-based ion channel pore makes this approach very amenable to the production of a voltage-gated channel. Taking advantage of dipole moments, the present examples accommodate two methods involving charge gradients for the transport of cations. First, it can be possible to position negatively charged moieties in an ascending fashion, according to their overall charge, i.e. neutral -> mono-anionic -> di-anionic, which will affect the movement of positively charged ions (Fig. 28). This approach is based on a report by Kobuke wherein a voltage gradient based on multiply-anionic residues was created.

[0078] The second method is based on a report by Fyles, and makes use only of carboxylate residues; however, the relative charge per m3 is varied along the length of the pore. By using carboxylate (mono-anionic) and succinate (two carboxylates, di-anionic), a gradient is developed for the shuttling of cationic atoms. The present examples can create a charge gradient by increasing the concentration of carboxylate residues along the interior of the DNA bionanolattice to create a gradual gradient from one end to the other (Fig. 29).

[0079] As these authors are only able to attach these functional groups onto the ends of their reported synthetic pores, the present examples can provide the advantage in the ability to place these charged groups at all positions in the interior of the pore. Accordingly, the present examples can facilitate ion transfer through the remainder of the pore, as the two previous examples contained charge-neutral groups along the interior.

[0080] The monomers needed to create both the ionophilic and hydrophobic residues will be based on a thymidine - linker - functional group motif, with covalent linkages being created either before or after DNA solid phase synthesis. As shown below (Fig. 30), and R' represent a covalent linkage between the thymidine base and the linking molecule, or the linking molecule and the functional group, respectively, and can include triazole, amide, ether, sulfide, disulfide or alkene linkage; R" represents the active functional group. For hydrophobic groups, this can encompass any of the "R" groups shown in blue displayed in Fig. 26 and Fig. 27. For hydrophilic or ionophilic groups for use on the interior of the pore, any carboxylate, phosphate, succinate, hydroxyalkyl, tetraalkyl-ammonium or (aza)-crown ether can be incorporated.

[0081] Incorporation by reference. Any and all references cited in the text of this patent application, including any U.S. or foreign patents or published patent applications, International patent applications, as well as, any non-patent literature reference are hereby expressly incorporated by reference. The following publications can facilitate understanding of the present invention, and each of them is incorporated herein by reference.

Chen J, Seeman NC. The Synthesis from DNA of a Molecule with the Connectivity of a Cube, Nature 1991; 350:631-633.

Douglas SM, Dietz H, Liedl T, Hogberg B, Graf F, Shih WM. Self-assembly of DNA into nanoscale three-dimensional shapes, Nature, 2009:459;414-418. Rothemund PWK. DNA Origami: Folding DNA to create nanoscale shapes and patterns, Nature, 2006;440:297-302.

Voyer N, Robitaille M. A Novel Functional Artificial Ion Channel. J Am Chem Soc, 1995;117:6599- 6600.

Goto C, Yamamura M, Satake A, Kobuke Y. Artificial ion channels showing rectified current behavior. J Am Chem Soc, 2001; 123:12152-12159.

Fyles TM, Loock D, Zhou X. A voltage-gated ion channel based on a bis-macrocyclic bolaamphiphile. J Am Chem Soc, 1998; 120:2997-3003.

Okino T, Hoashi Y, Fukukawa T, Xu X, Takemoto Y. Enantioselective Michael Reaction of Malonates to

Nitroolefins Catalyzed by Bifunctional Organocatalysts. J. Am. Chem. Soc, 2003;125:12672-12673.

Kotke M, Schreiner PR. Generally Applicable Organocatalytic Tetrahydropyranylation of Hydroxy

Functionalities with Very Low Catalyst Loading, Synthesis, 2007;5:779-790.

Majumdar S, Bhattacharjya A. Thiourea: A Novel Cleaving Agent for 1,3-dioxolanes, J. Org. Chem

1999;64:5682-5685.

Adams, M. W.; Stiefel, E. I. Biological Hydrogen Production: Not So Elementary. Science 282, pp. 1842-1843, 1998.

Ye, X.; Wang, Y., et al. Spontaneous High-Yield Production of Hydrogen from Cellulosic Materials and Water Catalyzed by Enzyme Cocktails. ChemSusChem. 2, pp. 149-152, 2009.

Rothemund, P. W., Folding DNA to create nanoscale shapes and patterns, Nature, 440, pp. 297-302, 2006.

Klienert, M.; Barth, T. Phenols from Lignin. Chem. Eng. Technol. 31, pp.73-745, 2008.

Zhang, T. Y.; Allen, M. J. Catalyst for Suzuki Cross-Coupling Reactions. Tetrahedron Lett. 40, pp. 5813-

5816, 1999.

De Munno, G.; Gabriele, B.; Salerno, G. X-ray Structure of Palladium(ll) Tetrakis-Thiourea Iodide, a Catalyst for Carbonylation Reactions. Inorg. Chim. Acta 234, pp. 181-183, 1995.

"Toxicological Profile for Tetrachloroethene". Agency for Toxic Substances and Disease Registry. 1997. http://www.atsdr.cdc.gov/toxprofiles/tpl8.html.

Doherty, R.E. (2000). "A History of the Production and Use of Carbon Tetrachloride,

Tetrachloroethylene, Trichloroethylene and 1,1,1-Trichloroethane in the United States: Part 1 - Historical Background; Carbon Tetrachloride and Tetrachloroethylene". Journal of Environmental Forensics 1: 69-81. doi:10.1006/enfo.2000.0010.

ATSDR Case Studies in Environmental Medicine: Tetrachloroethylene Toxicity U.S. Department of Health and Human Services. U.S. Environmental Protection Agency (USEPA). 2001. Trichloroethylene Health Risk Assessment: Synthesis and Characterization (External Review Draft)

U.S. National Academy of Sciences (NAS). 2006. Assessing Human Health Risks of Trichloroethylene - Key Scientific Issues. Committee on Human Health Risks of Trichloroethylene, National Research Council.

U.S. National Toxicology Program (NTP). 2005. Trichloroethylene, in the 11th Annual Report of Carcinogens.

Maymo-Gatell X, Chien Y, Gossett JM, Zinder SH. Isolation of a bacterium that reductively dechlorinates tetrachloroethene to ethene. Science. 1997 Jun 6;276(5318):1568-71. PMID: 9171062.

[0042] The present invention has been described in connection with various example embodiments. It will be understood that the above description is merely illustrative of the applications of the principles of the present invention, the scope of which is to be determined by the claims viewed in light of the specification. Other variants and modifications of the invention will be apparent to those of skill in the art.

Claims

What is claimed is:

1) An artificial glycosyl hydrolase enzyme, comprising a rigid organic matrix with an active site capable of bifunctional catalysis covalently bonded thereto with a tethering construct.

2) An artificial glycosyl hydrolase enzyme as in claim 1, wherein the active site comprises one or more of: natural amino acids, unnatural amino acids, enantiomers, disastereomers, homologues of a natural amino acid, peptidomimetic amino acids that contain a catalytic moiety typically found on an amino acid, carboxylic acid, hydroxyl, thiol, amine, amide, guanidinyl, imidazoyl, selenyl, and aryl.

3) An artificial glycosyl hydrolase enzyme as in claim 1, wherein the active site comprises urea or thiourea groups.

4) An artificial glycosyl hydrolase enzyme as in claim 1, wherein the rigid organic matrix comprises a singularity or plurality of biolpolymeric matrices, including one or more of: deoxyribonucleic acid, ribonucleic acid, locked nucleic acid, morpholino nucleic acid, peptide nucleic acid helices, and peptide nucleic acid helical bundles.

5) A method of glycosidic bond hydrolysis using a bifunctional catalytic mechanism, comprising providing an artificial glycosyl hydrolase enzyme as in claim 1.

6) An artificial glycosyl hydrolase enzyme as in claim 1, comprising two or more active catalytic residues, wherein the intermolecular distance between the active catalytic residues is greater than 2 A and less than 20A.

7) An artificial glycosyl hydrolase enzyme as in claim 1, wherein the rigid organic matrix comprises hairpin loops of DNA that define pockets into which catalytic residues can be inserted. (0018)

8) An artificial glycosyl hydrolase enzyme as in claim 1, wherein the rigid organic matrix comprises a plurality of semi-complementary single DNA strands, that when annealed in solution generate a complex three-dimensional shape.

9) An artificial glycosyl hydrolase enzyme as in claim 8, wherein the strands self-assemble into a tetra-helical trough-like structure.

10) An artificial glycosyl hydrolase enzyme as in claim 8, wherein the strands self-assemble into a hexa-helical barrel-like structure.

11) An artificial glycosyl hydrolase enzyme as in claim 8, wherein there is an angle of approximately 60° between the flanking helices and the plane of the interior helices.

12) An artificial glycosyl hydrolase enzyme as in claim 1, comprising a plurality of /V-phenyl thiourea moieties covalently attached onto a plurality of DNA helices. 13) An artificial glycosyl hydrolase enzyme as in claim 12, comprising a plurality of /V-phenyl thiourea moieties attached onto a single modified nucleobase.

14) An artificial glycosyl hydrolase enzyme as in claim 12, comprising a plurality of /V-phenyl thiourea moieties bound to the periphery of a single DNA duplex.

15) An artificial glycosyl hydrolase enzyme as in claim 12, wherein the /V-phenyl urea is configured to bind with carboxylates such as those groups found in the oligosaccharide monomer, pectin.

16) An artificial glycosyl hydrolase enzyme as in claim 1, comprising a plurality of individual

monomers chosen from the group consisting of: deoxyribonucleic acids, ribonucleic acids, locked nucleic acids, peptide nucleic acids, and morpholino nucleic acids.

17) An artificial glycosyl hydrolase enzyme as in claim 17, wherein at least one of the individual monomers is deoxyribonucleic acid.

18) A method of producing an artificial glycosyl hydrolase enzyme, comprising covalently attaching natural, unnatural or peptidomimetic amino acids to one or more points on a modified nucleobase.

19) A method of producing an artificial glycosyl hydrolase enzyme as in claim 18, wherein the

attachment point includes the phosphate, the ribose, the deoxyribose, the locked ribose bicycle, the morpholino ring positions, or the nucleobase heterocycle or another pendant group on the modified nucleobase.

20) A method of producing an artificial glycosyl hydrolase enzyme as in claim 18, wherein the

attachment comprises etherification, esterification, amidation, amination, alkylation, cycloaddition, or cross-coupling.

21) A method of producing an artificial glycosyl hydrolase enzyme as in claim 18, comprising

providing a modified nucleobase by halogenation of thymidine at the 5' position, followed by azide displacement and reduction to afford aminomethyl thymidine.

22) A method of producing an artificial glycosyl hydrolase enzyme as in claim 18, comprising

providing a modified nucleobase by the halogenation of uracil, followed by Sonagashiri cross- coupling with a copper acetylide to form an alkynyl uracil derivative.

23) A method of producing an artificial glycosyl hydrolase enzyme as in claim 18, wherein the

modified nucleobase includes the hydroxymethylenation of uracil.

24) A method of producing an artificial glycosyl hydrolase enzyme as in claim 18, where the modified nucleobase includes a halogenated derivative of adenosine, cytosine, or guanosine.

25) An artificial glycosyl hydrolase enzyme as in claim 1, wherein the tethering construct comprises an organic chain that projects a catalytic group into a specific location. 26) An artificial glycosyl hydrolase enzyme as in claim 25, wherein the tether comprises carbon, oxygen, sulfur, or nitrogen, in combinations typically found in bioconjugate constructs such as (poly)ethylene glycol (PEG), ketal, triazole, dithiol, phthalimide, maleimide or alkyl.

27) An artificial glycosyl hydrolase enzyme as in claim 25, wherein the tethering construct projects carboxylic acid residues such that the relative spacing between the two acid residues is between 2-20A.

28) An artificial glycosyl hydrolase enzyme as in claim 25, wherein a mode of attachment comprises a copper-catalyzed [3+2] dipolar cycloaddition between a terminal alkyne and an azide fragment.

29) An artificial glycosyl hydrolase enzyme as in claim 25, wherein the tethering construct comprises copper (I) bromide.

30) An artificial glycosyl hydrolase enzyme as in claim 25, wherein the tethering construct comprises TBTA, Tris[(l-benzyl-lH-l,2,3-triazol-4-yl)methyl]amine.

31) An artificial glycosyl hydrolase enzyme as in claim 25, wherein the tethering construct comprises sodium ascorbate.

32) An artificial glycosyl hydrolase enzyme as in claim 6, wherein the intermolecular distance

between the active catalytic residues is about 5.5A.

33) A method as in claim 21, wherein the halogen source is /V-bromosuccinimide.

34) An artificial glycosyl hydrolase enzyme as in claim 27, wherein the tethering construct projects carboxylic acid residues such that the relative spacing between the two acid residues is about 5.5A.