WO2012006245A1 - Phloroglucinol reductase and methods of making and using the same - Google Patents

Abstract

The invention provides nucleic acids, amino acids, cells, and related methods for the biosynthetic production of dihydrophloroglucinol. In various embodiments, the invention includes an isolated or recombinant phloroglucinol reductase, which can be used in conjunction with an enzyme system for the biosynthetic production of phloroglucinol. The synthesis can be from a renewable carbon source. The dihydrophloroglucinol can be used in subsequent reactions, or can be converted into phloroglucinol that can be used in subsequent reactions.

Description

PHLOROGLUCINOL REDUCTASE

AND METHODS OF MAKING AND USING THE SAME

RELATED APPLICATIONS

[0001] This application claims priority to and the benefit of U.S. Provisional

Application Number 61/361,791, filed July 6, 2010, the entire contents of which are hereby incorporated by reference.

FIELD OF THE INVENTION

[0002] The invention relates generally to the biological synthesis of phloroglucinol, as well as its derivatives and precursors. The invention relates, more particularly, to nucleic acids, amino acids, cells, and related methods for the biosynthetic production of

phloroglucinol (e.g., in a reduced form, dihydrophloroglucinol) and resorcinol from a renewable carbon source.

BACKGROUND

[0003] Phloroglucinol (1,3,5-trihydroxybenzene) and its derivatives are widely used in commerce. Phloroglucinol and its derivatives (e.g., trimethylphloroglucinol) are used as pharmaceutical agents (e.g., as antispasmodics). Phloroglucinol is used as a starting material or intermediate in pharmaceutical, microbicide, and other organic syntheses. Phloroglucinol is also used as a stain for microscopy samples that contain lignin (e.g., wood samples) and in the manufacture of dyes (e.g., leather, textile, and hair dyes). Phloroglucinol is used in the manufacture of adhesives, as an epoxy resin curing agent, and in the preparation of explosives (e.g., the thermally- and shock-stable high explosive, l,3,4-triamino-2,4,6- trinitrobenzene or TATB). Phloroglucinol also functions as an antioxidant, stabilizer, and corrosion resistance agent, and is utilized as a coupling agent for photosensitive duplicating paper, as a substitute for silver iodide in rain-making, as a bone sample decalcifying agent, and as a floral preservative. Phloroglucinol can also be converted to resorcinol by catalytic hydrogenation.

[0004] Resorcinol (1,3-dihydroxybenzene) is a particularly useful derivative of phloroglucinol, although resorcinol is not currently produced by that route. Like

phloroglucinol, resorcinol is used in the manufacture of dyes and adhesives, and as an epoxy resin curing agent. It is also used as a starting material and intermediate in pharmaceutical and other organic syntheses. Resorcinol and its derivatives are used, either alone or with other active ingredients such as sulfur, in cosmetics and in topical skin medicaments for treatment of conditions including acne, dandruff, eczema, and psoriasis (e.g., functioning, in part, as an antiseptic and antipruritic). Resorcinol is also used as a cross-linking agent for neoprene, as a tack-enhancing agent in rubber compositions, in bonding agents for organic polymers (e.g., melamine and rubber) and in the fabrication of fibrous and other composite materials. Resorcinol can be used in the manufacture of resins and resin adhesives (e.g., both as a monomer and as a UV absorbing agent), in the manufacture of explosives (e.g., energetic compounds such as styphnic acid, 2,4,6-trinitrobenzene-l,3-diol), and heavy metal styphnates, as well as in the synthesis of diazo dyes, plasticizers, hexyl resorcinol, and p- aminosalicylic acid.

[0005] Common resorcinol-based resins include resorcinol-aldehyde and resorcinol- phenol-aldehyde resins. These resorcinol-based resins are used, for example, as resin adhesives, composite material matrices, and as starting materials for rayon and nylon production. Examples of composite materials include resorcinol-formaldehyde carbon (or other organic) particle hydrogels, aerogels, and xerogels (e.g., which can be used as matrix materials for metallic and organometallic catalysts). Resorcinol-formaldehyde resins and particulate composites are also used in dentistry as a root canal filling material.

[0006] Resorcinol-aldehyde resin adhesives can be especially useful in applications requiring high bond strength (e.g., wooden trusses, joists, barrels, and boats, and aircraft). Modified resorcinol-aldehyde resin adhesives can also used as biological wound sealant compositions both on topical wounds and on internal wounds or surgical cuts (e.g., vascular incisions). Such medical uses are common in military field medicine (e.g., to minimize environmental exposure, reduce bleeding and fluid loss, and facilitate healing). Modified resin adhesives include gelatin-resorcinol-formaldehyde and gelatin-resorcinol- glutaraldehyde compositions. In such adhesives, the aldehyde can be maintained separately from the resorcinol-gelatin composition and mixed to form the sealant when needed.

[0007] Currently, both phloroglucinol and resorcinol are commercially produced by chemical organic synthesis using caustics and high temperatures, beginning with petroleum- derived starting materials and creating environmentally problematic waste and depleting fossil fuel and petroleum reserves.

SUMMARY

[0008] The invention provides nucleic acids, amino acids, cells, and related methods for the biosynthetic production of phloroglucinol (e.g., in a reduced form, dihydrophloroglucinol) and resorcinol. In various embodiments, the invention includes an isolated or recombinant phloroglucinol reductase, which can be used in conjunction with an enzyme system for the biosynthetic production of phloroglucinol and resorcinol. The synthesis can be from a renewable carbon source (e.g., malonyl-CoA, glucose, and the like). The

dihydrophloroglucinol can be used in subsequent reactions (e.g., to produce resorcinol), or can be converted into phloroglucinol that can be used in subsequent reactions.

[0009] The direct biological synthesis of dihydrophloroglucinol (as opposed to phloroglucinol) can mitigate phloroglucinol toxicity to a fermentation culture, thus increasing product yield (e.g., by allowing higher concentrations to accumulate in the fermentation broth). The direct microbial synthesis of dihydrophloroglucinol can also facilitate the synthesis (e.g., by avoiding the cost and inconvenience of an extractive fermentation).

[0010] The one step synthesis of resorcinol from renewable dihydrophloroglucinol (as opposed to a two step synthesis from phloroglucinol) can eliminate the need for a chemical hydrogenation step in the production of resorcinol (e.g., compared to a direct microbial synthesis of phloroglucinol).

[0011] In one aspect, the invention features an isolated or recombinant nucleic acid sequence that is at least 80% homologous to SEQ ID NO. 3 and that encodes a functioning phloroglucinol reductase.

[0012] In another aspect, the invention features an isolated or recombinant amino acid sequence that is at least 50% homologous to SEQ ID NO. 4 and that encodes a functioning phloroglucinol reductase.

[0013] In still another aspect, the invention features a system for producing renewable dihydrophloroglucinol. The system includes a cell having a recombinant nucleic acid that encodes a polypeptide having phloroglucinol reductase activity.

[0014] In yet another aspect, the invention features a method for producing renewable dihydrophloroglucinol. The method includes providing a system for producing

dihydrophloroglucinol from a renewable carbon source. The system includes a cell having a recombinant nucleic acid that encodes a polypeptide having phloroglucinol reductase activity. The method also includes contacting the system and the renewable carbon source, to produce renewable dihydrophloroglucinol.

[0015] In another aspect, the invention features an isolated or recombinant nucleic acid vector including an open reading frame encoding a nucleic acid that encodes a polypeptide having phloroglucinol reductase activity. [0016] In still another aspect, the invention features a transformed or recombinant cell including a nucleic acid vector having an open reading frame encoding a nucleic acid that encodes a polypeptide having phloroglucinol reductase activity.

[0017] In yet another aspect, the invention features a method for producing a transformed or recombinant cell including transforming a cell with a nucleic acid vector having an open reading frame encoding a nucleic acid that encodes a polypeptide having phloroglucinol reductase activity.

[0018] In another aspect, the invention features a method for producing renewable resorcinol. The method includes providing a system for producing dihydrophloroglucinol from a renewable carbon source. The system includes a cell having a recombinant nucleic acid that encodes a polypeptide having phloroglucinol reductase activity. The method also includes contacting the system and the renewable carbon source, to produce renewable dihydrophloroglucinol. Furthermore, the method includes contacting the renewable dihydrophloroglucinol and a proton source, to produce renewable resorcinol.

[0019] In still another aspect, the invention features a method for producing renewable resorcinol. The method includes providing a system for producing dihydrophloroglucinol from a renewable carbon source. The system includes a cell having a recombinant nucleic acid that encodes a polypeptide having phloroglucinol reductase activity. The method also includes contacting the system and the renewable carbon source in a culture medium, to produce renewable dihydrophloroglucinol, and removing cells and proteins from the culture medium. Furthermore, the method includes contacting the renewable dihydrophloroglucinol and an acid in the culture medium, to produce renewable resorcinol, and separating the renewable resorcinol from the culture medium.

[0020] In yet another aspect, the invention features purified renewable resorcinol.

[0021] In another aspect, the invention features purified renewable

dihydrophloroglucinol.

[0022] In other embodiments, any of the aspects above, or any composition of matter or method described herein, can include one or more of the following features.

[0023] In various embodiments, the isolated or recombinant nucleic acid sequence is at least 85% homologous to SEQ ID NO. 3. The isolated or recombinant nucleic acid sequence can be at least 90% homologous to SEQ ID NO. 3. The isolated or recombinant nucleic acid sequence can be at least 95% homologous to SEQ ID NO. 3. The isolated or recombinant nucleic acid sequence can be at least 99% homologous to SEQ ID NO. 3. In various embodiments, the isolated or recombinant nucleic acid sequence can be at least 81, 82, 83, 84, 86, 87, 88, 89, 91, 92, 93, 94, 96, 97, 98, or 100% homologous to SEQ ID NO. 3.

[0024] In some embodiments, the isolated or recombinant amino acid sequence is at least 60% homologous to SEQ ID NO. 4. The isolated or recombinant amino acid sequence can be at least 70% homologous to SEQ ID NO. 4. The isolated or recombinant amino acid sequence can be at least 80% homologous to SEQ ID NO. 4. The isolated or recombinant amino acid sequence can be at least 90% homologous to SEQ ID NO. 4. The isolated or recombinant amino acid sequence can be at least 99% homologous to SEQ ID NO. 4. In various embodiments, the isolated or recombinant amino acid sequence can be at least 55, 65, 75, 85, 91, 92, 93, 94, 96, 97, 98, or 100% homologous to SEQ ID NO. 4.

[0025] In certain embodiments, the recombinant nucleic acid or polypeptide corresponds to an isolated or recombinant nucleic acid sequence that is at least 80% homologous to SEQ ID NO. 3 and that encodes a functioning phloroglucinol reductase, or an isolated or recombinant amino acid sequence that is at least 50% homologous to SEQ ID NO. 4 and that encodes a functioning phloroglucinol reductase.

[0026] In various embodiments, the system can convert glucose to renewable dihydrophloroglucinol. The system can include a proton source for converting the dihydrophloroglucinol to renewable resorcinol. In various embodiments, the polypeptide can catalyze the conversion of phloroglucinol to dihydrophloroglucinol, thereby mitigating phloroglucinol-based cytotoxicity.

[0027] In some embodiments, the cell can express PhlD. The cell can be engineered to increase PhlD expression. In some embodiments, the cell does not express at least one of PhlA, PhlB, and PhlC. In some embodiments, the cell does not express PhlA, PhlB, or PhlC.

[0028] In certain embodiments, the renewable carbon source includes glucose.

[0029] In various embodiments, the method includes contacting the

dihydrophloroglucinol and a proton source, to produce renewable resourcinol. The method can include a non-extractive fermentation.

[0030] In some embodiments, a cell transformed with the vector can express PhlD. A cell transformed with the vector can be engineered to increase PhlD expression. A cell transformed with the vector can be engineered to increase PhlD expression. In some embodiments, a cell transformed with the vector does not express at least one of PhlA, PhlB, and PhlC. In some embodiments, a cell transformed with the vector does not express PhlA, PhlB, or PhlC. [0031] In certain embodiments, the method for producing renewable resorcinol excludes a chemical hydrogenation step. Removing cells and proteins can include at least one of microfiltration and ultrafiltration. Contacting the renewable dihydrophloroglucinol and an acid can include at least one of reducing the volume of the culture medium, providing sulfuric acid, refluxing the culture medium, and monitoring the production of renewable resorcinol by HPLC. Separating the renewable resorcinol can include at least one of extracting the renewable resorcinol into an organic solvent, evaporating the organic solvent to produce an oil, and distilling the oil to produce white crystals.

[0032] Other aspects and advantages of the invention can become apparent from the following drawings and description, all of which illustrate principles of the invention, by way of example only.

BRIEF DESCRIPTION OF DRAWINGS

[0033] The advantages of the invention described above, together with further advantages, may be better understood by referring to the following description taken in conjunction with the accompanying drawings. The drawings are not necessarily to scale, emphasis instead generally being placed upon illustrating the principles of the invention.

[0034] FIG. 1 presents Scheme 1, which illustrates literature -reported routes: (a) for acetylphloroglucinol biosynthesis without phloroglucinol as an intermediate, see M. G. Bangera & L. S. Thomashow, J Bact. 181(10):3155-63 (1999); and (c) for triacetic acid lactone biosynthesis, see S. Eckermann et al., Nature 396:387 (1998), J. M. Jez et al., Chem. Bio. 7:919 (2000); W. Zha et al., J. Am. Chem. Soc. 126:4534 (2004). Also shown are the routes (b) and (b') for acetylphloroglucinol biosynthesis with phloroglucinol as an intermediate. The correct biosynthetic pathway was later elucidated in J. Achkar et al., J. Am. Chem. Soc. 127:5332 (2005).

[0035] FIG. 2 presents Scheme 2, which illustrates: the common commercial chemical synthetic route (a, b, c) for phloroglucinol synthesis; a multi-step route (d, e, f, g) previously proposed for synthesis of phloroglucinol from glucose; a first, common commercial chemical synthetic route (i, j) for resorcinol synthesis; and a second, common commercial chemical synthetic route (k, 1) for resorcinol synthesis. Also illustrated with circled arrows are: (1) the fully biosynthetic route (indicated by a circled asterisk) for production of phloroglucinol; and (2) the chemical hydrogenation (h) of phloroglucinol to resorcinol. Specific reactions or reaction steps shown are: (a) Na₂Cr0₇, H₂S0₄; (b) Fe, HC1; (c) H₂S0₄, 108° C; (d) see W. Zha et al., J. Am. Chem. Soc. 126:4534 (2004); (e) Dowex 50 H⁺, MeOH; (f) Na, MeOH, 185° C; (g) 12 N HC1; (h) i) H₂, Rh on A1₂0₃, ii) 0.5 M H₂S0₄, reflux; (i) S0₃, H₂S0₄; (j) NaOH, 350° C; (k) HZSM-12 zeolite, propene; and (1) i) 0₂, ii) H₂0₂, iii) H⁺.

[0036] FIG. 3 presents putative reaction pathways, by which malonyl-CoA is biosynthetically converted to phloroglucinol by a phloroglucinol synthase, either via enzyme- activated 3,5-diketopimelate (3,5-diketoheptanedioate) or via enzyme-activated 3,5- diketohexanoate (3 ,5-diketocaproate).

[0037] FIG. 4 illustrates a variety of exemplary pathways for utilization of different carbon sources in a process for anabolic phloroglucinol synthesis. Dashed arrows show possible alternative carbon source utilization routes; square brackets enclose intermediates that can be absent in some pathways.

[0038] FIG. 5 illustrates a cell capable of producing dihydrophloroglucinol.

[0039] FIG. 6 illustrates the time progression of a fermentation culture producing dihydrophloroglucinol.

[0040] FIG. 7 illustrates an NMR spectrum of a fermentation culture medium including dihydrophloroglucinol.

[0041] FIG. 8A-C illustrates HPLC traces of a dehydration of dihydrophloroglucinol reaction.

[0042] FIG. 9A and B illustrate NMR spectra of isolated resorcinol.

[0043] FIG. 10A-B show the Pseudomonas fluorescens strain Pf-5 phlD nucleic acid

SEQ ID No: 1

[0044] FIG. 11 A-B show the Pseudomonas fluorescens strain Pf-5 PhlD amino acid SEQ ID No: 2

[0045] FIG. 12A and B shows phloroglucinol reductase nucleotide sequence SEQ ID NO. 3 and amino acid sequence SEQ ID No. 4 from Eubacterium oxidoreducens.

DETAILED DESCRIPTION

[0046] The invention provides nucleic acids, amino acids, cells, and related methods for synthesizing renewable phloroglucinol, dihydrophloroglucinol, and resorcinol (e.g., "green" or plant, as opposed to fossil-fuel or petroleum, based).

[0047] The invention includes a phloroglucinol reductase enzyme. Examples of such enzymes include all of the functioning phloroglucinol reducatases corresponding to the nucleic acid sequence of phloroglucinol reductase from Eubacterium oxidoreducens is shown as SEQ ID NO. 3. Examples of such enzymes also include all of the functioning

phloroglucinol reducatase corresponding to the amino acid sequence of phloroglucinol reductase from Eubacterium oxidoreducens is shown as SEQ ID NO. 4. These examples include sequences that are homologous to SEQ ID NO. 3 and SEQ ID NO. 4 and that correspond to a functioning phloroglucinol reductase.

[0048] The invention also includes systems (e.g., cell and enzyme systems) for synthesizing dihydrophloroglucinol and, thus phloroglucinol and resorcinol. For example, such systems include cells having a recombinant nucleic acid that encodes a polypeptide having phloroglucinol reductase activity. Such systems also include transformed or recombinant cells having a nucleic acid vector with an open reading frame encoding a nucleic acid that encodes a polypeptide having phloroglucinol reductase activity.

[0049] Further, the invention includes isolated or recombinant nucleic acid vectors having an open reading frame encoding a nucleic acid that encodes a polypeptide having phloroglucinol reductase activity. Such vectors can be used in methods for producing a transformed or recombinant cell having an open reading frame encoding a nucleic acid that encodes a polypeptide having phloroglucinol reductase activity.

[0050] Furthermore, the invention includes methods for producing

dihydrophloroglucinol and resorcinol. The methods include providing a system for producing dihydrophloroglucinol from a renewable carbon source and contacting the system and the carbon source, to produce renewable dihydrophloroglucinol. The methods can also include contacting the renewable dihydrophloroglucinol and a proton source, to produce renewable resorcinol.

[0051] The dihydrophloroglucinol can be used in subsequent reactions, or can be converted into phloroglucinol that can be used in subsequent reactions. For example, the phloroglucinol and resorcinol can be used in or to prepare medicaments, cosmetics, dyes, polymer resins, rubbers, adhesives, sealants, coatings, propellants, explosives, composite materials, and laminated or bonded materials.

[0052] The direct microbial synthesis of dihydrophloroglucinol can eliminate the need for a chemical hydrogenation step in the production of resorcinol (e.g., compared to a direct microbial synthesis of phloroglucinol). Additionally, the direct biological synthesis of dihydrophloroglucinol (as opposed to phloroglucinol) can also mitigate toxicity to a fermentation culture, thus increasing product yield (e.g., by allowing higher concentrations to accumulate in the fermentation broth). Therefore, the direct microbial synthesis of dihydrophloroglucinol can facilitate the synthesis (e.g., by avoiding the cost and

inconvenience of extractive fermentation). Sequence Homology

[0053] In various embodiments, the invention includes an isolated or recombinant nucleic acid sequence that is at least 80% homologous to SEQ ID NO. 3 and that encodes a functioning phloroglucinol reductase. For example, the sequence can be at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 92, 94, 95, 96, 97, 98, 99, or 100% homologous to SEQ ID NO. 3. In some embodiments, the sequence can be less than 80% homologous to SEQ ID NO. 3, provided that it encodes a functioning phloroglucinol reductase.

[0054] In various embodiments, the invention includes an isolated or recombinant amino acid sequence that is at least 50% homologous to SEQ ID NO. 4 and that encodes a functioning phloroglucinol reductase. For example, the sequence can be at least 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 92, 94, 95, 96, 97, 98, 99, or 100 % homologous to SEQ ID NO. 4. In some embodiments, the sequence can be less than 50% homologous to SEQ ID NO. 3, provided that it encodes a functioning phloroglucinol reductase.

[0055] Sequence homology can refer to the degree of identity between two sequences of amino acid residues, or between two sequences of nucleobases. Homology can be determined by visual comparison of two sequences, or by use of bioinformatic algorithms that align sequences for comparison or that determine percent homology among compared sequences. Automated algorithms are available, for example, in the GAP, BESTFIT, FASTA, and TFASTA computer software modules of the Wisconsin Genetics Software Package (available from Genetics Computer Group, Madison, Wis., USA). The alignment algorithms automated in these modules include the Needleman & Wunsch, the Pearson & Lipman, and the Smith & Waterman sequence alignment algorithms. Other useful algorithms for sequence alignment and homology determination are automated in software including: FASTP, BLAST, BLAST2, PSIBLAST, and CLUSTAL V. See, e.g., N. P. Brown et al., Bioinformatics: Applications Note, 1998, 14:380-81; the U.S. National Center for

Biotechnology Information at http://www.ncbi.nlm.nih.gov/Tools/index.html; and U.S. Pat. No. 6,790,639, Brown et al., issued Sep. 14, 2004, which provides software parameter settings useful for homology determination.

[0056] The sequence homology exhibited by nucleobase polymers, such as nucleic acids and nucleic acid analogs, can be determined by hybridization assays between a first sequence and the complement of a second sequence. Any of the well known hybridization assays can be used for this purpose, and examples of these include those described in U.S. Pat. No. 6,767,744, Koffas et al., issued Jul. 27, 2004, and U.S. Pat. No. 6,783,758, Wands et al., issued Aug. 31, 2004.

Conservative Substitutions

[0057] In addition, conservative amino acid substitutions can be found in a polypeptide according to the invention. The term conservative amino acid substitution can indicate any amino acid substitution for a given amino acid residue, where the substitute residue is so chemically similar to that of the given residue that no substantial decrease in polypeptide function (e.g., enzymatic activity) results. Conservative amino acid substitutions are well known (see, e.g., U.S. Pat. No. 6,790,639, Brown et al., issued Sep. 14, 2004; U.S. Pat. No. 6,774,107, Strittmatter et al., issued Aug. 10, 2004; U.S. Pat. No. 6, 194,167, Browse et al., issued Feb. 27, 2001 ; or U.S. Pat. No. 5,350,576, Payne et al, issued Sep. 27, 1994). In one embodiment, a conservative amino acid substitution can be any one that occurs within one of the following six groups:

1. Small aliphatic, substantially non-polar residues: Ala, Gly, Pro, Ser, and Thr;

2. Large aliphatic, non-polar residues: He, Leu, Met and Val;

3. Polar, negatively charged residues and their amides: Asp and Glu;

4. Amides of polar, negatively charged residues: Asn, His and Gin;

5. Polar, positively charged residues: Arg, His and Lys; and

6. Large aromatic residues: Trp, Phe and Tyr.

[0058] In one embodiment, a conservative amino acid substitution can be any one of the following, which are listed as Native Residue (Conservative Substitutions) pairs: Ala (Ser); Arg (Lys); Asn (Gin; His); Asp (Glu); Gin (Asn); Glu (Asp); Gly (Pro); His (Asn; Gin); He (Leu; Val); Leu (He; Val); Lys (Arg; Gin; Glu); Met (Leu; He); Phe (Met; Leu; Tyr); Ser (Thr); Thr (Ser); Trp (Tyr); Tyr (Trp; Phe); and Val (He; Leu).

[0059] Just as a polypeptide can contain conservative amino acid substitution(s), a polynucleotide can contain conservative codon substitution(s). A codon substitution is considered conservative if, when expressed, it produces a conservative amino acid substitution. Degenerate codon substitution, which results in no amino acid substitution, are also possible. For example, a polynucleotide encoding a selected polypeptide can be mutated by degenerate codon substitution in order to approximate the codon usage frequency exhibited by an expression host cell, or to otherwise improve the expression. Biosynthetic pathway of Phloroglucinol

[0060] As illustrated in FIG. 3, the mechanism by which phloroglucinol synthase catalyzes phloroglucinol synthesis proceeds according to the following series of steps, or via an alternative mechanism in which the first malonyl-CoA providing the group that is transferred to form the illustrated thioester (— SR) linkage, provides a malonyl, rather than an acetyl group:

1. Acetyl Activation— The first step involves activation of an acetyl group. This occurs by decarboxylation of malonyl-CoA to transfer an acetyl group to the enzyme, thus forming an enzyme-activated acetyl thioester (R in FIG. 3 represents the enzyme or a moiety attached thereto); in an alternative embodiment, the first step involves activation of an entire malonyl group to form an enzyme-activated malonyl thioester;

2. Chain Extension— The next phase involves two successive malonyl-CoA decarboxylations to transfer further acetyl groups to form an enzyme-activated 3- ketobutanoate thioester and then an enzyme-activated 3,5-diketohexanoate thioester; in an alternate embodiment, successive transfers form enzyme-activated: 3-ketoglutarate thioester and 3,5-diketopimelate thioester; and

3. Cyclization— The final step involves cyclization of the 3,5-diketohexanoate thioester intermediate to form phloroglucinol; in an alternative embodiment, a

decarboxylation of 3,5-diketopimelate takes place to permit cyclization to phloroglucinol. All three steps are catalyzed by phloroglucinol synthase.

All three steps are catalyzed by phloroglucinol synthase.

Biosynthesis of Dihydropholorglucinol

[0061] As discussed above, a system according to the invention includes at least one phloroglucinol reductase enzyme. Examples of such enzymes include all of the functioning phloroglucinol reducatases corresponding to the nucleic acid sequence of phloroglucinol reductase from Eubacterium oxidoreducens is shown as SEQ ID NO. 3. Examples of such enzymes also include all of the functioning phloroglucinol reducatase corresponding to the amino acid sequence of phloroglucinol reductase from Eubacterium oxidoreducens is shown as SEQ ID NO. 4. These examples include sequences that are homologous to SEQ ID NO. 3 and SEQ ID NO. 4 and that correspond to a functioning phloroglucinol reducatase.

[0062] In various embodiments (e.g., where the system is capable of producing phloroglucinol from a simple carbon source), the system can also include at least one phloroglucinol synthase. The phloroglucinol synthase can be obtained from a Pseudomonad, for example, a member of the genus Pseudomonas such as a member of the species P.

fluorescens (e.g., P. fluorescens Pf-5). The amino acid sequence of the P. fluorescens Pf-5 phloroglucinol synthase is shown in SEQ ID NO. 2, and its native coding sequence is shown in SEQ ID NO. 1.

[0063] In one embodiment, an enzyme system can also include at least one enzyme capable, either solely or jointly with other enzyme(s), of catalyzing the formation of malonyl- CoA. Malonyl-CoA can be biosynthetically produced (e.g., from acetyl-CoA by a malonyl- CoA synthesis enzyme). Example include the malonyl-CoA synthetase (MatB) from

Rhizobium leguminosarum (see GenBank Accession AAC83455 [gi:3982573]), which converts malonate to malonyl-CoA; the malonyl-CoA decarboxylase (MatA) from Rhizobium leguminosarum (see GenBank Accession AAC83456 [gi:3982574]), which converts malonic semialdehyde to malonyl-CoA; and the transcarboxylase activity of acetyl-CoA carboxylase (EC 6.4.1.2), which carboxylates acetyl-CoA to form malonyl-CoA. The malonic acid, malonic semialdehyde, or acetyl-CoA starting material can be biosynthetic. For example, the acetyl-CoA can be biosynthetically derived from a biological source such as glucose, photosynthetic 3-phosphoglycerate, and the like.

[0064] A system according to the invention can be in vitro or in vivo. Where a malonyl-CoA synthesis enzyme is not provided, malonyl-CoA can be supplied to the medium in contact with the cells and/or enzymes. In one embodiment, a phloroglucinol synthase- encoding nucleic acid can be transformed into a cell of an organism capable of synthesizing malonyl CoA. Examples of organisms synthesizing malonyl CoA include plants, algae, animals, and humans. In vitro systems include batch enzyme suspensions, (adsorbed or covalently) immobilized enzyme bioreactors, and the like. In vivo systems include immobilized cell bioreactors, continuous fermentations, batch fermentations, and the like. Fermentation can indicate cultured cell growth under any effective conditions and is not limited to anaerobic conditions or anaerobic metabolism. A source of malonyl-CoA can be provided to the phloroglucinol synthase, whether or not that source is added (e.g., exogenous) malonyl-CoA or in situ biosynthesized (e.g., endogenous).

[0065] Recombinant cells according to the invention can express at least one

phloroglucinol synthase and, optionally, at least one malonyl-CoA synthesis enzyme.

However, the cells expressing a phloroglucinol synthase should not express an entire phlABCD operon or all three oiphlA, phlB, and phlC genes involved in the microbial acetylphloroglucinol pathway, e.g., phlABCDEF. In one embodiment, the recombinant cell can be a walled cell. Examples of walled cells include plant (including avascular plants such as moss), yeast, fungal, bacterial, and Archaea cells, as well as some protists (e.g., algae). In one embodiment, the recombinant cell can be a microbe (e.g., a bacterial cell, proteobacterial cell, and the like). The recombinant cell can lack the ability to express functional enzymes from phlABC, phlE, and phlF genes. The cell can be a phlABC, phlK, and phlF cell.

Recombinant host cells can contain at least one nucleic acid encoding a phloroglucinol synthase. The nucleic acid can be in the form of a vector, such as a plasmid or transposon.

[0066] In one embodiment, a cell that is both phlD⁺ as well as phlA⁺, phlB⁺, and/or phlC⁺, can be made phlA^~, phlB^', and/or phlC by any gene inactivation or knockout techniques generally known in the art (e.g., any gene excision or mutation technique that results in the cell's inability to make the functioning expression product encoded by the wild- type or pre-knocked-out gene). In one embodiment, all of the phlA, phlB, and phlC genes in the cell are inactivated or knocked out. The resulting cell can retain its phlD⁺ phenotype. Optionally, phlE and/or phlF genes present in the cell can also be knocked out. In one embodiment, a phlABCD⁺ cell can be made into a phlABC cell. In one embodiment, a cell that is both phlD^' and phlA^', phlB^', and/or phlC can be made phlD⁺ by inserting an expressible PhlD-encoding nucleic acid into the cell (e.g., into the genomic DNA and/or as part of an extrachromosomal unit such as a plasmid). In one embodiment, a phlABCD^' cell can be made into a phlD⁺ cell.

[0067] In some embodiments, a native or recombinant cell that is PhlD⁺ can be supplemented with one or more additional phlD genes (e.g., by transformation with nucleic acid comprising one or more expressible open reading frames encoding a phloroglucinol synthase). The PhlD⁺ cell can be a PhlA^", PhlB^", and/or PhlC^" cell (e.g., a phlA^~, phlB^~, and/or phlC, or a phlABC cell), or it may be a PhlA⁺, PhlB⁺, and/or PhlC⁺ cell, such as a phlA⁺, phlB⁺ , and/or phlC⁺ cell (e.g., a phlABCD⁺ cell). The resulting recombinant cell, which is capable of expressing the additional phlD gene(s), can exhibit enhanced phloroglucinol synthesis capability.

[0068] Similar to recombinant cells, isolated or recombinant enzyme systems according to the invention can include at least one phloroglucinol synthase and, optionally, at least one malonyl-CoA synthesis enzyme or enzyme set. In one embodiment, an enzyme systems including at least one phloroglucinol synthase does not also include all three of PhlA, PhlB, and PhlC enzymes. An enzyme systems including at least one phloroglucinol synthase can include none of PhlA, PhlB, and PhlC enzymes.

[0069] It is generally known that stepwise acetylation of phloroglucinol performed by PhlABC leads to monoacetylphloroglucinol (MAPG) and 2,4-DAPG, respectively. The level of produced DAPG is regulated mainly by degradation through the specific hydrolase PhlG, which converts DAPG into MAPG, and by the regulatory proteins PhlF and PhlH. PhlF represses the expression of the phlABCD operon by binding to two conserved sites in the phlA leader region. DAPG itself is able to dissociate the repressor PhlF from the phlA promotor, hence acting as an autoinducer of it own biosynthesis. PhlH, the second pathway- associated transcriptional regulator, is hypothesized to antagonize the repressive effect of PhlF. In addition, PhlE regulates the efflux of DAPG.

[0070] U.S. Publication No. 2007/0178571, now U.S. Patent No. 7,943,362, which is incorporated by reference, includes additional examples and background regarding phloroglucinol biosynthesis.

[0071] It should be understood that according to generally accepted gene/protein nomenclature guidelines, gene symbols are italicized, whereas protein designations are not italicized and the first letter is in upper case. "+" and "-" signs indicate the presence and absence, respectively, of a functional gene or protein. For example, "phlD" represents the phloroglucinol synthase gene, "PhlD" represents the phloroglucinol synthase protein, "p/z/D⁺" indicates that the gene is present and functional, and "phlD^~" indicates that the gene is inactive or knocked out.

Whole-Cell Fermentation Modes

[0072] Whole cell fermentations of recombinant cells can be performed in any culture mode, for example, in a batch, fed-batch, or continuous (or semi-continuous, e.g., reseeding) mode. However, phloroglucinol can exert toxicity against the cultured cells after it reaches as threshold concentration in a process called end-product inhibition. In some embodiments, phloroglucinol-containing spent medium can be processed to extract phloroglucinol (e.g., an extractive fermentation). However, unlike phloroglucinol, dihydrophloroglucinol exerts relatively little or no toxicity against the fermentation culture cells. Therefore, extractive fermentation (and the associated cost and inconvenience) is generally not necessary where dihydrophloroglucinol (as opposed to phloroglucinol) is the accumulative product.

Whole-Cell Fermentation Conditions

[0073] Cultures of whole cells producing dihydrophloroglucinol can utilize conditions that are supportive of both cell growth and anabolic dihydrophloroglucinol production. In some methods, a phloroglucinol synthase can be expressed throughout the cell culture period (e.g., constitutively). In other methods, phloroglucinol synthase can be expressed only/predominantly near the end of the exponential growth phase (EGP). Where a later expression is desired, a phloroglucinol synthase coding sequence that is under the control of a regulated promoter generally can be activated or derepressed when about 70 to 100%, about 70 to 90%, or about 70 to 80% of EGP has elapsed. Examples of promoters useful for this purpose include the tac, T5, and T7 promoters (e.g., Pn). Induction can be made using lactose or a gratuitous inducer such as IPTG (isopropyl-beta-D-thiogalactopyranoside).

[0074] In some embodiments, a recombinant microbial cell, such as a recombinant bacterial host cell can be used as a whole cell biocatalyst. Bacterial host cells can include Proteobacteria (e.g., the gamma proteobacteria, such as enterobacteria and pseudomonads), Escherichia (e.g., E. coli), and Pseudomonas (e.g., P. fluorescens). Host cells can lack, or be treated to decrease or eliminate, protease activity that can degrade a phloroglucinol reductase, phloroglucinol synthase, and/or malonyl-CoA synthesis enzymes. In bacteria, Lon and OmpT are two such proteases that can be absent or otherwise decrease or eliminated (e.g., by mutation). E. coli strains BL21 and W31 10 are examples of phlABCD⁺ cells for insertion of phlD gene(s). P. fluorescens strain Pf-5 is an example of a phlABCD⁺ cell for inactivation of phlA, phlB, and/or phlC, with or without insertion of further phlD gene(s), or for inactivation of phlABCD, with insertion of further phlD gene(s), or for supplementation with additional phlD gene(s). E. coli strain BL21 can be obtained as: BL21 STAR (DE3) ONE SHOT (Invitrogen Corp., Carlsbad, Calif, USA) or ULTRA BL21 (DE3) (Edge BioSystems, Gaithersburg, Md., USA). E. coli strain W31 10 can be obtained as ATCC No. 27325 (American Type Culture Collection, Manassas, Va., USA). P. fluorescens strain Pf-5 can be obtained as ATCC No. BAA-477.

[0075] In the case of E. coli, fermentation temperatures can be from about 20 to about 37° C, about 25 to about 37° C, or about 30 to about 37° C. In anabolic phloroglucinol synthesis, a combination of a higher temperature during EGP or during the pre-induction portion of EGP, and a lower temperature during at least part of the remaining culture period (e.g., throughout all or part of the post-induction or all or part of the maintenance phase) can facilitate phloroglucinol production. Thus, recombinant E. coli cells can be grown at about 35-37° C, about 36-37° C, or about 36° C during EGP or during pre -induced EGP, and at about 30-34° C, about 30-33° C, about 33° C, or about 30° C during maintenance phase or during post-induction.

[0076] In some embodiments, the switch to a lower temperature can occur well into the maintenance phase (e.g., up to about 15 hours after EGP ends). Thus, in the case of a cell culture in which EGR ends at about 15 hours from the start of culturing (e.g., E. coli), the switch from a higher to a lower temperature for a two-temperature fermentation profile can occur at about 1 1 or about 12 hours (e.g., at approximately the same time as a 70% or 80% EGR induction point), or at about 15 hours, or even up to about 30 hours from the start of culturing. In the case of P. fluorescens, temperatures can be from about 20 to about 30° C, with the higher temperatures being from about 27 to about 30° C and the lower temperatures being from about 24 to about 27°C.

Carbon Sources

[0077] The systems and methods for producing phloroglucinol according to the invention can utilize a wide variety of carbon sources including carbohydrates (C6), celluloses (C5), and glycerides. For example, a carbon source can include one or more of glucose, xylose, arabinose, glycerol, a starch, a cellulose, a hemicellulose, and a plant oil.

[0078] In various embodiments, a carbon source can be a simple carbon source. Simple carbon sources can contain from 0% to about 5%, 0% to about 2%, 0% to about 1%, 0% to about 0.5%, or about 0% by weight secondary metabolites and larger or complex organics. In other example, simple carbon sources can be free or substantially free of secondary metabolites and larger/complex organics. In some embodiments, a simple carbon source can include primary metabolite -type compound(s). Examples of primary metabolite-type compounds include saccharides (e.g., mono- and/or di-saccharides) and polyols (e.g., glycerol). Useful monosaccharides include glucose, xylose, and arabinose. In one embodiment, glucose, xylose, and/or arabinose can be used as the carbon source (e.g., as the carbon source throughout both the exponential growth phase and the maintenance phase of the cell culture). In one embodiment a combination of a monosaccharides (e.g., glucose, xylose, and/or arabinose) and glycerol can be used (e.g., at a 1 : 1 or 2: 1 weight ratio). Such a combination can be used during the maintenance phase, with monosaccharides (without glycerol) being used during the exponential growth phase.

[0079] FIG. 4 illustrates a number of representative routes for anabolic synthesis of phloroglucinol from carbon sources (e.g., malonyl-CoA or a malonyl-CoA precursor).

Suitable carbon sources can include biomolecules that can be catabolized by the system as well as simpler organic molecules that can be fixed by the system (see FIG. 4 and U.S.

Publication No. 2007/0178571). Renewable dihydrophloroglucinol

[0080] The biosynthesized dihydrophloroglucinol includes carbon from the atmospheric carbon dioxide incorporated by plants (e.g., from a carbon source such as glucose, malonyl- CoA, or malonyl-CoA precursor). Therefore, the biosynthesized dihydrophloroglucinol includes renewable carbon rather than fossil fuel-based or petroleum-based carbon.

Accordingly, the biosynthetic dihydrophloroglucinol and associated products will have a less of an environmental impact than similar compositions produced by conventional methods because they do not deplete fossil fuel or petroleum reserves and because they do not increase the amount of carbon in the carbon cycle (e.g., increase greenhouse gases). Additionally, the biosynthetic dihydrophloroglucinol and associated products will have a less of an

environmental impact because the biosynthesis does not require the toxic chemicals required by conventional synthetic methods.

[0081] The biosynthetic dihydrophloroglucinol can be distinguished from similar compounds produced from a fossil fuel or petrochemical carbon source by dual carbon- isotopic finger printing. This method can distinguish chemically-identical materials, and apportions carbon in the copolymer by source (and possibly year) of growth of the biospheric (plant) component using the information contained in the ¹⁴C and ¹³C isotope ratios. The radiocarbon dating isotope (¹⁴C), with its nuclear half life of 5730 years, allows one to apportion specimen carbon between fossil (dead) and biospheric (alive) feedstocks (See Currie, L. A. "Source Apportionment of Atmospheric Particles," Characterization of Environmental Particles, J. Buffle and H. P. van Leeuwen, Eds., 1 of Vol. I of the IUPAC Environmental Analytical Chemistry Series (Lewis Publishers, Inc) (1992) 3-74). The basic assumption in radiocarbon dating is that the constancy of ¹⁴C concentration in the atmosphere leads to the constancy of ¹⁴C in living organisms.

[0082] When dealing with an isolated sample, the age of a sample can be deduced approximately by the relationship t = (-5730/0.693)ln(A/A_o) where t = age, 5730 years is the half-life of radiocarbon, and A and A₀ are the specific ¹⁴C activity of the sample and of the modern standard, respectively (Hsieh, Y., Soil ScL Soc. Am J., 56, 460, (1992)). However, because of atmospheric nuclear testing since 1950 and the burning of fossil fuel since 1850, ¹⁴C has acquired a second, geochemical time characteristic. Its concentration in atmospheric CO₂, and hence in the living biosphere, approximately doubled at the peak of nuclear testing, in the mid-1960s. It has since been gradually returning to the steady-state cosmogenic (atmospheric) baseline isotope rate (¹⁴C/¹²C) of ca. 1.2 x 10^"12, with an approximate relaxation half-life of 7-10 years. (This latter half-life must not be taken literally; rather, one must use the detailed atmospheric nuclear input/decay function to trace the variation of atmospheric and biospheric ¹⁴C since the onset of the nuclear age.) It is this latter biospheric ¹⁴C time characteristic that holds out the promise of annual dating of recent biospheric carbon. ¹⁴C can be measured by accelerator mass spectrometry (AMS), with results given in units of fraction of modern carbon (ΪΜ). ΪΜ is defined by National Institute of Standards and Technology (NIST) Standard Reference Materials (SRMs) 4990B and 4990C, known as oxalic acids standards HOxI and HOxII, respectively. The fundamental definition relates to 0.95 times the ¹⁴C/¹²C isotope ratio HOxI (referenced to AD 1950). This is roughly equivalent to decay-corrected pre-lndustrial Revolution wood. For the current living biosphere (plant material), f_M « 1.1.

[0083] The stable carbon isotope ratio (¹³C/¹²C) provides a complementary route to source discrimination and apportionment. The ¹³C/¹²C ratio in a given biosourced material is a consequence of the ¹³C/¹²C ratio in atmospheric carbon dioxide at the time the carbon dioxide is fixed and also reflects the precise metabolic pathway. Regional variations also occur. Petroleum, C₃ plants (the broadleaf), C₄ plants (the grasses), and marine carbonates all show significant differences in ¹³C/¹²C and the corresponding δ ¹³C values. Furthermore, lipid matter of C3 and C₄ plants analyze differently than materials derived from the carbohydrate components of the same plants as a consequence of the metabolic pathway. Within the precision of measurement, ¹³C shows large variations due to isotopic fractionation effects, the most significant of which for the instant invention is the photosynthetic mechanism. The major cause of differences in the carbon isotope ratio in plants is closely associated with differences in the pathway of photosynthetic carbon metabolism in the plants, particularly the reaction occurring during the primary carboxylation (e.g., the initial fixation of atmospheric CO2). Two large classes of vegetation are those that incorporate the C₃ (or Calvin-Benson) photosynthetic cycle and those that incorporate the C₄ (or Hatch-Slack) photosynthetic cycle. C₃ plants, such as hardwoods and conifers, are dominant in the temperate climate zones. In C₃ plants, the primary CO2 fixation or carboxylation reaction involves the enzyme ribulose-l,5-diphosphate carboxylase and the first stable product is a 3- carbon compound. C₄ plants, on the other hand, include such plants as tropical grasses, corn and sugar cane. In C₄ plants, an additional carboxylation reaction involving another enzyme, phosphoenol-pyruvate carboxylase, is the primary carboxylation reaction. The first stable carbon compound is a 4-carbon acid, which is subsequently decarboxylated. The CO2 thus released is refixed by the C₃ cycle. [0084] Both C₄ and C3 plants exhibit a range of CI C isotopic ratios, but typical values are ca. -10 to -14 per mil (C₄) and -21 to -26 per mil (C₃) (Weber et al., J. Aqric. Food Chem., 45, 2942 (1997)). Coal and petroleum fall generally in this latter range. The ¹³C measurement scale was originally defined by a zero set by PeeDee belemnite (PDB) limestone, where values are given in parts per thousand deviations from this material. The 5¹³C values are in parts per thousand (per mil), abbreviated %₀, and are calculated as follows: 5¹³C≡ (¹³C/¹²C)sample - (¹³C/¹²C)standard / (¹³C/¹²C)standard x 1000%_o

Since the PDB reference material (RM) has been exhausted, a series of alternative RMs have been developed in cooperation with the IAEA, USGS, NIST, and other selected international isotope laboratories. Notations for the per mil deviations from PDB is 5¹³C. Measurements are made on CO₂ by high precision stable ratio mass spectrometry (IRMS) on molecular ions of masses 44, 45 and 46.

[0085] Therefore, the biosynthesized dihydrophloroglucinol and compositions including biosynthesized dihydrophloroglucinol can be distinguished from their fossil-fuel and petrochemical derived counterparts on the basis of 14C (fJVI) and dual carbon-isotopic fingerprinting, indicating new compositions of matter (e.g., U.S. Patent Nos. 7, 169,588, 7,531,593, and 6,428,767). The ability to distinguish these products is beneficial in tracking these materials in commerce. For example, products comprising both new and old carbon isotope profiles may be distinguished from products made only of old materials. Hence, the biosynthetic dihydrophloroglucinol and derivative materials can be followed in commerce on the basis of their unique profile.

EXAMPLES

Example 1 - Cloning and Expression of Phloroglucinol Reductase

[0086] DNA encoding phloroglucinol reductase (pgr) was amplified from Eubacterium oxidoreducens G41 genomic DNA using

GGGAATTCCATATGATGGTGCCGTGTAACAAAGAG (SEQ ID NO: 5) and

CTGCAGTGCTCGAGTTTATCTCTCCTATCATTTTG (SEQ ID NO:6) as the primer pair. Plasmid pJJ10.043 was constructed by inserting the phloroglucinol reductase gene under a T7 promoter into Ndel and Xhol sites of pET22b vector.

[0087] E. coli BL21 (DE3) was transformed with plasmid pJJl 0.043 and colonies were selected on LB/Amp plates. A single colony of the transformed cells was selected and used to inoculate a shakeflask of liquid LB/Amp medium which incubated at 37 °C overnight. The next day, a fresh LB/Ap liquid medium was inoculated from the overnight culture (1:200 dilution) and ths new shakeflask was incubated at 37 °C. At the OD600 reached 0.6, the culture was induced with 0.5 mM IPTG and heterologous expression of phloroglucinol reductase was performed for 4 h at room temperature. A cell-free lysate of

BL21(DE3)/pJJ10.043 exhibited 100 μmol/min/mg specific activity of phloroglucinol reductase.

Example 2 - Preparation of a Dihydrophloroglucinol Producing Cell

[0088] Plasmid pKIT9.041 was digested with Ndel and Xhol restriction endonucleases and the remaining linearlized vector pACYCDuet-l-phlD*-serA was purified by agarose gel electrophoresis. Phloroglucinol reductase that was amplified from Eubacterium

oxidoreducens G41 genomic DNA and was cloned under a T7 promoter into Ndel and Xhol sites of pACYCDuet-l-phlD*-serA vector, which afforded the new pPhlD*-PGR plasmid. The E. coli host PG1 was transformed with the pPhlD*-PGR plasmid using standard electroporation protocol and colonies were selected on M9/Glucose plates.

Example 3 - Batch Fermentation of Dihydrophloroglucinol

[0089] E. coli PG l/pPhlD*-PGR was cultivated in a 2L fermentor under fed-batch, glucose-limited fermentor-controlled conditions at pH 7.0, dissolved oxygen level at 10% and initial temperature at 36 °C. Dissolved oxygen concentration was initially controlled by increasing the agitation from 50 to 1000 rpm. When the agitation reached the maximum level, DO was then controlled by increasing airflow from 0.06 to 1.0 slpm. At the end of the DO control cascade the initial glucose was depleted and culture was switched to glucose- limited conditions, where the dissolved oxygen level was controlled by adjusting glucose addition using the PID controller. The culture continued to grow under glucose-limited conditions until the the cell density was between 40 and 50 OD₆oo- A temperature shift from 36 °C to 33 °C was then performed over a period of 30 minutes, after which

dihydrophloroglucinol synthesis was initiated at 33 °C by the addition of 3mL of 0.1 M IPTG.

D-glucose phloroglucinol d ihydrophloroglucinol

[0090] FIG. 7 illustrates an NMR spectrum of a fermentation culture medium including dihydrophloroglucinol.

Example 4 - Dehydration of Dihydrophloroglucionl

[0091] The dehydration of dihydophloroglucinol included (i) removing cells and proteins from the culture medium (e.g., a culture medium produced according to Example 3); (ii) contacting the renewable dihydrophloroglucinol and an acid in the culture medium, to produce renewable resorcinol; and (iii) separating the renewable resorcinol from the culture medium. Dehydration proceeds according to the following reaction:

dihydrophloroglucinol resorcinol

[0092] Removal of cells was achieved by hollow fiber microfiltration and removal of proteins was achieved by SARTOCON® ultrafiltration using a lOkD membrane. 1L of culture medium was recovered after filtration. Next, the 1L of cell-free, protein- free medium was reduced to 50 mL under reduced pressure. 3 mL of cone. H2SO4 was mixed with the 50 mL solution and the mixture was refluxed for 1 h while being monitored by HPLC.

[0093] FIG. 8A-C illustrates HPLC traces of a dehydration of dihydrophloroglucinol reaction. FIG. 8A shows a trace of a mixture of resorcinol (peak at about 6.75 min) and pyrogallol (peak at about 4.8 min). FIG. 8B shows a trace of the reaction mixture at t = 0 min (essentially no resorcinol product present). FIG. 8C shows a trace of the reaction mixture at t = 30 min (resorcinol product present).

[0094] After reacting the mixture for 1 h, the resorcinol product was extracted into diethyl ether, which was then evaporated down to an oil. The oil was then Kugelrohr distilled under vacuum at 120 °C, to obtain white crystals (isolated resorcinol). FIG. 9 A illustrates a 'H-NMR spectra of isolated resorcinol. FIG. 9A illustrates a ¹³C-NMR spectra of isolated resorcinol.

[0095] The citation of references does not constitute an admission that any references are prior art or have any particular relevance to the patentability of the invention. All references cited in the Description section of this specification are hereby incorporated by reference in their entirety.

[0096] While the invention has been particularly shown and described with reference to specific embodiments, it should be understood by those skilled in the art that various changes in form and detail may be made without departing from the spirit and scope of the invention as defined by the appended claims.

Claims

CLAIMS What is claimed is:

1. An isolated or recombinant nucleic acid sequence that is at least 80% homologous to SEQ ID NO. 3,

wherein the nucleic acid sequence encodes a functioning phloroglucinol reductase.

2. The isolated or recombinant nucleic acid sequence of claim I, wherein the nucleic acid sequence is at least 85% homologous to SEQ ID NO. 3.

3. The isolated or recombinant nucleic acid sequence of claim 1, wherein the nucleic acid sequence is at least 90% homologous to SEQ ID NO. 3.

4. The isolated or recombinant nucleic acid sequence of claim 1, wherein the nucleic acid sequence is at least 95% homologous to SEQ ID NO. 3.

5. The isolated or recombinant nucleic acid sequence of claim 1, wherein the nucleic acid sequence is at least 99% homologous to SEQ ID NO. 3.

6. An isolated or recombinant amino acid sequence that is at least 50% homologous to SEQ ID NO. 4,

wherein the amino acid sequence encodes a functioning phloroglucinol reductase.

7. The isolated or recombinant amino acid sequence of claim 6, wherein the amino acid sequence is at least 60% homologous to SEQ ID NO. 4.

8. The isolated or recombinant amino acid sequence of claim 6, wherein the amino acid sequence is at least 70% homologous to SEQ ID NO. 4.

9. The isolated or recombinant amino acid sequence of claim 6, wherein the amino acid sequence is at least 80% homologous to SEQ ID NO. 4.

10. The isolated or recombinant amino acid sequence of claim 6, wherein the amino acid sequence is at least 90% homologous to SEQ ID NO. 4.

11. The isolated or recombinant amino acid sequence of claim 6, wherein the amino acid sequence is at least 99% homologous to SEQ ID NO. 4.

12. A system for producing renewable dihydrophloroglucinol comprising:

a cell comprising a recombinant nucleic acid that encodes a polypeptide having phloroglucinol reductase activity.

13. The system of claim 12, wherein the recombinant nucleic acid or polypeptide corresponds to the nucleic acid sequence that is at least 80% homologous to SEQ ID NO. 3, wherein the nucleic acid sequence encodes a functioning phloroglucinol reductase or the amino acid sequence that is at least 50% homologous to SEQ ID NO. 4, wherein the amino acid sequence encodes a functioning phloroglucinol reductase.

14. The system of claim 12, wherein the system can convert glucose to renewable dihydrophloroglucinol.

15. The system of claim 12, further comprising a proton source for converting the dihydrophloroglucinol to renewable resorcinol.

16. The system of claim 12, wherein the polypeptide catalyzes the conversion of phloroglucinol to dihydrophloroglucinol, thereby mitigating phloroglucinol-based cytotoxicity.

17. The system of claim 12, wherein the cell expresses PhlD.

18. The system of claim 12, wherein the cell is engineered to increase PhlD expression.

19. The system of claim 12, wherein the cell does not express at least one of PhlA, PhlB, and PhlC.

20. The system of claim 12, wherein the cell does not express PhlA, PhlB, or PhlC.

21. A method for producing renewable dihydrophloroglucinol comprising: providing a system for producing dihydrophloroglucinol from a renewable carbon source, wherein the system comprises a cell comprising a recombinant nucleic acid that encodes a polypeptide having phloroglucinol reductase activity; and

contacting the system and the renewable carbon source, to produce renewable dihydrophloroglucinol.

22. The method of claim 21, wherein the recombinant nucleic acid or polypeptide corresponds to a nucleic acid sequence that is at least 80% homologous to SEQ ID NO. 3, wherein the nucleic acid sequence encodes a functioning phloroglucinol reductase , or to an amino acid sequence that is at least 50% homologous to SEQ ID NO. 4, wherein the amino acid sequence encodes a functioning phloroglucinol reductase.

23. The method of claim 21, wherein the renewable carbon source comprises glucose.

24. The method of claim 21, further comprising contacting the dihydrophloroglucinol and a proton source, to produce renewable resourcinol.

25. The method of claim 21, further comprising a non-extractive fermentation.

26. The method of claim 21, wherein the polypeptide catalyzes the conversion of phloroglucinol to dihydrophloroglucinol, thereby mitigating phloroglucinol-based cytotoxicity.

27. The method of claim 21, wherein the cell expresses PhlD.

28. The method of claim 21, wherein the cell is engineered to increase PhlD expression.

29. The method of claim 21, wherein the cell does not express at least one of PhlA, PhlB, and PhlC.

30. The method of claim 21, wherein the cell does not express PhlA, PhlB, or PhlC.

31. An isolated or recombinant nucleic acid vector comprising an open reading frame encoding a nucleic acid that encodes a polypeptide having phloroglucinol reductase activity.

32. The nucleic acid vector of claim 31, wherein the recombinant nucleic acid or polypeptide corresponds to a nucleic acid sequence that is at least 80% homologous to SEQ ID NO. 3, wherein the nucleic acid sequence encodes a functioning phloroglucinol reductase , or to an amino acid sequence that is at least 50% homologous to SEQ ID NO. 4, wherein the amino acid sequence encodes a functioning phloroglucinol reductase.

33. The nucleic acid vector of claim 31, wherein a cell transformed with the vector can express PhlD.

34. The nucleic acid vector of claim 31 , wherein a cell transformed with the vector is engineered to increase PhlD expression.

35. The nucleic acid vector of claim 31, wherein a cell transformed with the vector does not express at least one of PhlA, PhlB, and PhlC.

36. The nucleic acid vector of claim 31, wherein a cell transformed with the vector does not express PhlA, PhlB, or PhlC.

37. A transformed or recombinant cell comprising a nucleic acid vector comprising an open reading frame encoding a nucleic acid that encodes a polypeptide having phloroglucinol reductase activity.

38. The cell of claim 37, wherein the recombinant nucleic acid or polypeptide

corresponds to a nucleic acid sequence that is at least 80% homologous to SEQ ID NO. 3, wherein the nucleic acid sequence encodes a functioning phloroglucinol reductase , or to an amino acid sequence that is at least 50% homologous to SEQ ID NO. 4, wherein the amino acid sequence encodes a functioning phloroglucinol reductase.

39. The cell of claim 37, wherein the cell can express PhlD.

40. The cell of claim 37, wherein the cell is engineered to increase PhlD expression.

41. The cell of claim 37, wherein the cell does not express at least one of PhlA, PhlB, and PhlC.

42. The cell of claim 37, wherein the cell does not express PhlA, PhlB, or PhlC.

43. A method for producing a transformed or recombinant cell comprising transforming a cell with a nucleic acid vector comprising an open reading frame encoding a nucleic acid that encodes a polypeptide having phloroglucinol reductase activity.

44. The method of claim 43, wherein the recombinant nucleic acid or polypeptide corresponds a nucleic acid sequence that is at least 80% homologous to SEQ ID NO. 3, wherein the nucleic acid sequence encodes a functioning phloroglucinol reductase , or to an amino acid sequence that is at least 50% homologous to SEQ ID NO. 4, wherein the amino acid sequence encodes a functioning phloroglucinol reductase.

45. The method of claim 43, wherein the cell can express PhlD.

46. The method of claim 43, wherein the cell is engineered to increase PhlD expression.

47. The method of claim 43, wherein the cell does not express at least one of PhlA, PhlB, and PhlC.

48. The method of claim 43, wherein the cell does not express PhlA, PhlB, or PhlC.

49. A method for producing renewable resorcinol comprising:

providing a system for producing dihydrophloroglucinol from a renewable carbon source, wherein the system comprises a cell comprising a recombinant nucleic acid that encodes a polypeptide having phloroglucinol reductase activity;

contacting the system and the renewable carbon source, to produce renewable dihydrophloroglucinol; and

contacting the renewable dihydrophloroglucinol and a proton source, to produce renewable resorcinol.

50. The method of claim 49, wherein the method excludes a chemical hydrogenation step.

51. A method for producing renewable resorcinol comprising:

providing a system for producing dihydrophloroglucinol from a renewable carbon source, wherein the system comprises a cell comprising a recombinant nucleic acid that encodes a polypeptide having phloroglucinol reductase activity;

contacting the system and the renewable carbon source in a culture medium, to produce renewable dihydrophloroglucinol;

removing cells and proteins from the culture medium;

contacting the renewable dihydrophloroglucinol and an acid in the culture medium, to produce renewable resorcinol; and

separating the renewable resorcinol from the culture medium.

52. The method of claim 51, wherein removing cells and proteins comprises at least one of microfiltration and ultrafiltration.

53. The method of claim 51, wherein contacting the renewable dihydrophloroglucinol and an acid comprises at least one of reducing the volume of the culture medium, providing sulfuric acid, refluxing the culture medium, and monitoring the production of renewable resorcinol by HPLC.

54. The method of claim 51, wherein separating the renewable resorcinol comprises at least one of extracting the renewable resorcinol into an organic solvent, evaporating the organic solvent to produce an oil, and distilling the oil to produce white crystals.

55. Purified renewable resorcinol prepared according to the method of claim 49.

56. Purified renewable resorcinol prepared according to the method of claim 51.

57. Purified renewable dihydrophloroglucinol prepared according to the method of claim 21.