WO2013041843A1

WO2013041843A1 - Cell differentiation

Info

Publication number: WO2013041843A1
Application number: PCT/GB2012/052294
Authority: WO
Inventors: Mark Coles; Bridget GLAYSHER
Original assignee: The University Of York
Priority date: 2011-09-19
Filing date: 2012-09-18
Publication date: 2013-03-28
Also published as: GB201116116D0

Abstract

This disclosure relates to a composition comprising a combination of ligands that bind and activate the cytokine receptors interleukin 4 receptor [IL4R], tumour necrosis factor receptor [TNFR] and lymphotoxin β receptor [LTβR] expressed by mesenchymal stem cells which induce differentiation to lymphoid stromal cells and uses of said lymphoid stromal cells.

Description

Cell Differentiation

Introduction This disclosure relates to a composition comprising a combination of ligands that bind and activate the cytokine receptors interleukin 4 receptor [IL4R], tumour necrosis factor receptor [TNFR] and lymphotoxin β receptor [LT3R] expressed by mesenchymal stem cells which induce differentiation to lymphoid stromal cells; methods to differentiate mesenchymal stem cells into lymphoid stromal cells and methods that use said lymphoid stromal cells in the activation of, for example, T- lymphocytes, B-lymphocytes, Dendritic Cells and Regulatory T Cells; and the use of a system comprising said stromal cells as a means to screen for immune modulators.

Background to the Invention

The term "stem cell" represents a generic group of undifferentiated cells that possess the capacity for self-renewal while retaining varying potentials to form differentiated cells and tissues. Stem cells can be pluripotent or multipotent. A pluripotent stem cell is a cell that has the ability to form all tissues found in an intact organism although the pluripotent stem cell cannot form an intact organism. A multipotent cell has a restricted ability to form differentiated cells and tissues. Typically adult stem cells are multipotent stem cells and are the precursor stem cells or lineage restricted stem cells that have the ability to form some cells or tissues and replenish senescing or damaged cells/tissues. Examples of multipotent stem cells include mesenchymal stem cells. Mesenchymal stem cells or MSCs differentiate into a variety of cell types that include osteoblasts, chondrocytes, myocytes, adipocytes and neurones. Typically MSCs are obtained from bone marrow but can originate from other sources such as adipose tissue.

The immune system is in part made up of lymphocytes which are able to recognise specific antigens. B lymphocytes recognise antigens in their native conformation through surface immunoglobulin receptors. T lymphocytes recognise protein antigens that are presented as peptides along with self molecules known as human leukocyte antigen (HLA) in humans, on the surface of antigen presenting cells. T lymphocytes may be subdivided into CD8⁺ "cytotoxic T lymphocytes", which are able to destroy target cells, and CD4⁺ "T helper lymphocytes". T helper lymphocytes have a regulatory function and are able to help B lymphocytes to produce specific antibodies, or to help macrophages to kill intracellular pathogens. A further class of immune cells are dendritic cells which function to process antigenic material and present it to T lymphocytes of the immune system. They are primarily present in tissues that are in contact with the external environment, for example, skin, nose, lungs, stomach and intestine. Once activated the dendritic cells migrate to the lymph glands and activate T cells and B cells to initiate an adaptive immune response. Thus, dendritic cells play a key role in host defences and a crucial role in putative anti-cancer immune responses. A yet further class of immune cell is the so called Regulatory T cell which are a sub-population of T cells that function to suppress activation of the immune system. These cells repress the activity of other immune cells and are involved in suppressing an immune response once it has successfully dealt with the invading agent. Regulatory T Cells are also involved in controlling the immune system's recognition of self that may result in autoimmune disease if Regulatory T Cell function is impaired. The differentiation of lymphocytes involves interaction with lymphoid stromal cells that produce an array of cytokines and monokines that promote cell differentiation.

This disclosure relates to a combination of cytokine receptor ligands and their use in the induction of differentiation of mesenchymal stem cells into lymphoid stromal cells. The receptors are interleukin 4 receptor [IL4R], tumour necrosis factor receptor [TNFR] and lymphotoxin β receptor [LT3R] expressed typically by adipose mesenchymal stem cells. IL4 is part of the interleukin 2 (IL-2) family which also includes IL-2, I IL-7, IL-9, IL-15 and IL21 . The function of IL4 is varied but includes the stimulation of activated T lymphocyte and B lymphocyte proliferation. IL4R binds both IL4 and IL13. Tumour necrosis factors [TNF] are a large family of cytokines that are involved in apoptosis. TNF a is arguably the best known member of the TNF family which also includes lymphotoxin αβ. Other members of the TNF family which activate TNFR include CD154 [also known as CD40L], CD27L, CD30L and TRAIL. Statements of Invention

According to an aspect of the invention there is provided a composition comprising an effective amount of a combination of cytokine receptor ligands wherein said ligands bind and activate IL4 receptor, tumour necrosis factor receptor and lymphotoxin β receptor wherein said composition induces the differentiation of mesenchymal stem cells into lymphoid stromal cells. In a preferred embodiment of the invention said ligand is a polypeptide that naturally active activates said receptor. In a preferred embodiment of the invention said polypeptide is IL4 or IL13.

In a preferred embodiment of the invention said polypeptide is a TNF family member.

Preferably said TNF family member is selected from the group consisting of: TNF a, lymphotoxin αβ, CD154, CD27L, CD30L and TRAIL.

In a preferred embodiment of the invention said TNF family member is TNF a and lymphotoxin αβ. In an alternative preferred embodiment of the invention said ligand is an agonistic antibody, or active antibody binding fragment thereof, which binds and activates the cytokine receptors IL4R, LT3R and TNFR.

In a preferred embodiment of the invention said agonistic antibody is a monoclonal antibody.

In a preferred embodiment of the invention said ligand is an antibody fragment which binds and activates said cytokine receptors IL4R, LT3R and TNFR. Various fragments of antibodies are known in the art, e.g. Fab, Fab₂, F(ab')₂, Fv, Fc, Fd, scFvs, etc. A Fab fragment is a multimeric protein consisting of the immunologically active portions of an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region, covalently coupled together and capable of specifically binding to an antigen. Fab fragments are generated via proteolytic cleavage (with, for example, papain) of an intact immunoglobulin molecule. A Fab₂ fragment comprises two joined Fab fragments. When these two fragments are joined by the immunoglobulin hinge region, a F(ab')₂ fragment results. An Fv fragment is multimeric protein consisting of the immunologically active portions of an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region covalently coupled together and capable of specifically binding to an antigen. A fragment could also be a single chain polypeptide containing only one light chain variable region, or a fragment thereof that contains the three CDRs of the light chain variable region, without an associated heavy chain variable region, or a fragment thereof containing the three CDRs of the heavy chain variable region, without an associated light chain moiety; and multi specific antibodies formed from antibody fragments, this has for example been described in US patent No 6,248,516. Fv fragments or single region (domain) fragments are typically generated by expression in host cell lines of the relevant identified regions. These and other immunoglobulin or antibody fragments are within the scope of the invention and are described in standard immunology textbooks such as Paul, Fundamental Immunology or Janeway et al. Immunobiology (cited above). Molecular biology now allows direct synthesis (via expression in cells or chemically) of these fragments, as well as synthesis of combinations thereof. A fragment of an antibody or immunoglobulin can also have bispecific function as described above.

In a preferred embodiment of the invention said composition is a cell culture medium comprising said cytokine receptor ligands and additional cell culture components necessary to maintain mammalian cells in culture.

According to a further aspect of the invention there is provided a method to differentiation mesenchymal stem cells into lymphoid stromal cells comprising:

i) providing a cell culture comprising mesenchymal stem cells and a composition according to the invention; and

ii) providing cell culture conditions that differentiate said mesenchymal stem cells into one or more lymphoid stromal cells. In a preferred method of the invention differentiated lymphoid stromal cells are contacted with a preparation comprising immune cells,

Preferably said immune cells are peripheral blood mononuclear cells [PBMCs]. In a preferred method of the invention said immune cells are selected from the group consisting of: T- lymphocytes, [either or both CD8⁺ T lymphocytes or CD4⁺ T lymphocytes] B lymphocytes, Dendritic Cells, T Regulatory Cells, innate lymphoid cells or Natural Killer Cells [NK cells]. In a preferred method of the invention said mesenchymal stem cells and/or said immune cells are autologous. In an alternative method of the invention said mesenchymal stem cells and/or said immune cells are allogenic. In a still further method of the invention said mesenchymal stem cells and/or said immune cells are heterologous.

In a preferred embodiment of the invention said mesenchymal stem cells are derived from adipose tissue.

In a preferred method of the invention said cell culture comprises or consists essentially of a collagen based cell support.

In a preferred method of the invention said collagen based cell support is Matrigel®.

Alternative cell support matrices to grow cells in 3D include calcium alginate or other hydrogels or using other extracellular matrix components such as laminin or combinations of laminin and collagen. According to a further aspect of the invention there is provided a method for the expansion of activated immune cells comprising:

i) providing a culture of differentiated lymphoid stromal cells formed according to the method of the invention;

ii) contacting said differentiated stromal cells with an isolated preparation of immune cells isolated from a subject; and

iii) expanding said activated immune cells.

In a preferred method of the invention said immune cells are activated CD8⁺ T lymphocytes and/or activated CD4⁺ T lymphocytes.

In an alternative method of the invention said immune cells are activated B lymphocytes.

In a further method of the invention said immune cells are activated T Regulatory Cells, Dendritic Cells or NK Cells. In a preferred method of the invention said method includes two or more cells selected from the group consisting of: activated CD8⁺ T lymphocytes, activated CD4⁺ lymphocytes, T Regulatory Cells, Dendritic cells, innate lymphoid cells and NK Cells. In a preferred method of the invention said subject is a human cancer subject.

As used herein, the term "cancer" refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term "cancer" includes malignancies of the various organ systems, such as those affecting, for example, lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumours, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. The term "carcinoma" is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term "carcinoma" also includes carcinosarcomas, e.g., which include malignant tumours composed of carcinomatous and sarcomatous tissues. An "adenocarcinoma" refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term "sarcoma" is art recognized and refers to malignant tumors of mesenchymal derivation.

In a preferred method of the invention said cancer is melanoma. In an alternative preferred method of the invention said cancer is prostate cancer.

In a further preferred method of the invention said expanded immune cells are autologous or allogenic and are administered to a subject in need of treatment. In a preferred method of the invention said cell culture comprises or consists essentially of a collagen based cell support. In a preferred method of the invention said collagen based cell support is Matrigel®.

According to a further aspect of the invention there is provided a method to produce human antibodies comprising:

ii) contacting said differentiated stromal cells with an isolated preparation of activated B lymphocytes isolated from a subject;

iii) culturing said culture in ii) to allow said activated B lymphocytes to secrete said human antibodies; and optionally

iv) selecting a human antibody by affinity to a selected antigen.

In a preferred method of the invention said human antibodies or selected antibody is administered to a human subject.

In a preferred method of the invention said subject is a human cancer subject.

According to an aspect of the invention there is provided a method for the production of a hybridoma cell line comprising:

i) providing a preparation comprising differentiated lymphoid stromal cells formed according to the method of the invention and activated human B lymphocytes;

ii) contacting said preparation with myeloma cells to form a combined culture wherein the activated human B lymphocytes and myeloma cells fuse to produce hybridoma cells; optionally

iii) cloning said hybridoma cells from said culture; and

iv) culturing the hybridoma cells in ii) or iii) to proliferate and/or secrete antibodies or monoclonal antibodies; and

v) recovering said antibodies or monoclonal antibodies from the culture supernatant. The production of monoclonal antibodies using hybridoma cells is well-known in the art. The methods used to produce monoclonal antibodies are disclosed by Kohler and Milstein in Nature 256, 495-497 (1975) and also by Donillard and Hoffman, "Basic Facts about Hybridomas" in Compendium of Immunology V.ll ed. by Schwartz, 1981 , which are incorporated by reference.

In a preferred method of the invention said preparation comprises or consists essentially of a collagen based cell support.

According to a further aspect of the invention there is provided a method to screen for immune regulatory agents comprising:

i) providing a cell culture comprising differentiated lymphoid stromal cells according to the invention, immune cells and at least one agent to be tested;

ii) monitoring the effect of said one or more agents on the function of said lymphoid stromal cells and/or said immune cells.

In a preferred method of the invention said screening method includes the steps of: collating the activity data in (ii) above; converting the collated data into a data analysable form; and optionally providing an output for the analysed data. A number of methods are known which image and extract information concerning the spatial and temporal changes occurring in cells expressing, for example fluorescent molecules and other markers of gene expression. Moreover, US5, 989,835 and US09/031 ,271 , both of which are incorporated by reference, disclose optical systems for determining the distribution or activity of fluorescent reporter molecules in cells for screening large numbers of agents for biological activity. The systems disclosed in the above patents also describe a computerised method for processing, storing and displaying the data generated. The screening of large numbers of agents requires preparing arrays of cells for the handling of cells and the administration of agents. Assay devices, for example, include standard multiwell microtitre plates with formats such as 6, 12, 48, 96 and 384 wells which are typically used for compatibility with automated loading and robotic handling systems. Typically, high throughput screens use homogeneous mixtures of agents with an indicator compound which is either converted or modified resulting in the production of a signal. The signal is measured by suitable means (for example detection of fluorescence emission, optical density, or radioactivity) followed by integration of the signals from each well containing the cells, agent and indicator compound. The term "agent" includes any small molecule, antibody, polypeptide, peptide, aptamer, antisense or small inhibitory RNA. These can be an agonist or an antagonist. "Agents" are typically molecular immune modulators that for example act as adjuvants. In a preferred method of the invention said cell culture comprises or consists essentially of a collagen based cell support.

In a preferred method of the invention said collagen based cell support is Matrigel®. According to a further aspect of the invention there is provided a cell culture vessel comprising differentiation lymphoid stromal cells formed by the method according to the invention.

In a preferred embodiment of the invention said cell culture vessel further comprises immune cells.

In a preferred embodiment of the invention said cell culture comprises or consists essentially of a collagen based cell support. In a preferred embodiment of the invention said collagen based cell support is Matrigel®.

"Vessel" is defined as any means suitable to contain the above described cell culture. Typically, examples of such a vessel is a petri dish; cell culture bottle or flask; multiwell culture dishes.

In addition "vessel" includes bioreactors for large scale culture of cells. Bioreactors are known in the art and provide means for the large scale production of cells. For example, Chen et al (Stem Cells (2006) 24(9): 2052-2059) describes a rotary bioreactor adapted for the expansion of human mesenchymal stem cells. Commercially available rotary bioreactors can be purchased from http://www.synthecon.com. Microfluidic devices are also within the scope of the invention for the analysis of differentiation and immune cell function.

We have developed an in vitro cell culture method which provides cell culture conditions that allows mesenchymal cells to form differentiated lymphoid stromal cells which closely resemble lymphoid stromal cells found in vivo. The method relies on a combination cytokine ligands and a suitable cell culture medium which allows the mesenchymal cells to proliferate, differentiate and form a 3-D lymphoid stroma which modulates immune cell function. The 3-D system is able to support growth and activity of immune cells hereindisclosed to provide a structure which reflects the in vivo state. The system is invaluable for the study of immune cell function. It will provide a tool for use in the identification of agents effective at promoting or inhibiting the function of immune cells.

Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of the words, for example "comprising" and "comprises", means "including but not limited to", and is not intended to (and does not) exclude other moieties, additives, components, integers or steps.

Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.

An embodiment of the invention will now be described by example only and with reference to the following figures:

Figure 1 : Expression of lymphoid stromal cell markers ICAM-1 , VCAM-1 and podoplanin in ADSC treated with various combinations of cytokines. (MFI, mean fluorescence intensity); Figure 2: Expression of lymphoid stromal cell markers ICAM-1 and VCAM-1 in ADSC treated with various combinations of cytokines. (MFI, mean fluorescence intensity);

Figure 3: ADSC were co-cultured with either mature B or T lymphocytes leading to distinct chemokine expression patterns. (RQ, relative quantity);

Figure 4: Expression of ICAM-1 , VCAM-1 and chemokines in cell line HS.5 and Resto15 (RQ, relative quantity); Figure 5: Chemokine expression in ADSC treated with cytokines, co-cultured with lymphocytes or both treated and co-cultured. (RQ, relative quantity);

Figure 6: Expression of markers associated with a T cell 'exhaustion' phenotype in T cells activated in the presence or absence of ADSC (MFI, mean fluorescence intensity); and

Figure 7: ADSC in 3D culture (left) and in 3D co-culture with B cells (right). Cells stained with anti-human ICAM-1 (green), Phalloidin (red) and DAPI (blue). Materials and methods

Cells

Human adipose-derived stem cells (ADSC) were purchased from Invitrogen (Paisley, UK). Human lymphocytes were isolated from peripheral blood apheresis cones (NHS Blood and Transplant, Leeds, UK) using RosetteSep human B or T cell enrichment cocktails (StemCell Technologies, Manchester, UK). Murine ADSC were derived from collagenase digested fat pads.

Treatments and co-culture

ADSC were treated with recombinant TNFa (10 ng/ml; Peprotech, London, UK), IL-4 (50ng/ml; Peprotech) and lymphotoxin αιβ₂ (100ng/ml R&D Systems, Abingdon, UK) and left for 3 days. Treated cells were retreated and co-cultured with either B-lymphocytes or T-lymphocytes for 7 days. ADSC were subcultured and retreated every 3-4 days during this time. T-lymphocytes were activated using anti-CD3 and anti-CD28 conjugated to microbeads (Invitrogen). T cells and beads were cultured in a 1 :1 ratio in the presence of IL-2 (50ng/ml; Peprotech). Preparation of Collagen Based Cell Support.

Collagen I was extracted from rats tail tendons by teasing apart the tendons, dissolving them in 0.5 M acetic acid, stirring slowly for 26-36 hours, then spinning down at 20000 g, 4 ^<C for 60 min. The supernatant was retained and stored at 4 °C. This was then lyophilised for at least three days using a Lyotrap lyophiliser (LTE, Oldham, UK), giving a dry white solid which was stored at room temperature. Collagen stock solutions were prepared by dissolving specific mass fractions of collagen solid in 0.02 M acetic acid. Collagen stock was diluted in DMEM (Sigma-Aldrich, Gillingham, UK), to create a working solution of 3mg/ml collagen. The pH was neutralised with 1 M NaOH. Varying numbers of ADSC and/or lymphocytes were spun down and resuspended in collagen working solution. This was then either put into the wells of a chambered coverslip (pretreated with 0.1 % glutaraldehyde for 30 mins to prevent collagen contraction) or dotted onto the surface of a petri dish. After gellation of the collagen (1 hr at 15^QC) cell culture medium was added and cultures were left for varying amounts of time 9up to 21 days) with the medium being changed at 3-4 day intervals.

3D culture

ADSC treated with cytokines for 3 days. They were then placed in 0.6mg/ml collagen gel and allowed to spread out overnight. B cells were then added to the top of the gel. After 3 days of co-culture cells were fixed with 4% PFA and stained with anti-human ICAM-1 (eBioscience, Hatfield, UK), DAPI and phalloidin. Images were taken using an LSM 710 confocal microscope (Zeiss, Jena, Germany).

Flow cytometry

Cells were stained with anti-human ICAM-1 (eBioscience, Hatfield, UK), VCAM-1 (Abeam, Cambridge, UK),podoplanin (Cambridge Bioscience, Cambridge, UK), PD-1 (eBioscience) and CD27 (eBioscience).. Secondary antibodies used were anti-mouse IgG conjugated to Alexa 488 dye and streptavidin conjugated Alexa 647 dye (both Invitrogen, UK).

Quantitative PCR

mRNA was extracted from cells using RNeasy kit (Qiagen, Crawley, UK) and converted to cDNA using EZ First strand kit (Geneflow, Fradley, UK) following the instructions provided with each kit. cDNA was analysed by quantitative real-time PCR using SYBR Green (Applied Biosystems, Carlsbad, CA, USA). Results were normalised to GAPDH expression and analysed using ABI7000 software (Applied Biosystems). Primers used were as follows:

CXCL13 F 5'AGGGTCCACACCACACAAT; R 5'CCTCCAGACAGAATGAAGTT

CCL19 F 5' TGCAGCCATCCTTGAT; R 5'AGCCTGCTGGTTCTCTG

CCL21 F 5' GT AC AG C C AAAG G AAG ATT C ; R 5' GGGGATGGTGTCTTGTC

BAFF F 5' AGCTGTCACCGCGGGACTGA; R 5' TCACTGTCTGCAATCAGTTGCAAGC CD40 F 5' G C AAC AG G C AG G C AC AAAC AAG AC ; 5' GATGGGGATCACCACCAGGGCT GAPDH F 5' TG C AC C AC C AACT G CTT AG C ; R 5' GGCATGGACTGTGGTCATGAG

PCR conditions are:

1 . 50C, 2.00min, 1 repetition

2. 95C, ^"l O.OOmin, 1 repetition

3. 95C, 15sec, followed by 60C, 1 min; 40 repetitions

Example 1

Treatment of ADSC with TNF, IL-4 and lymphotoxin

After 3 days of treatment with TNF, IL-4 and lymphotoxin, ADSCs showed an increase in the expression of lymph node stromal markers ICAM-1 , VCAM-1 and podoplanin (Fig 1 ). Using IL-13 in place of IL-4 had a similar effect (Fig 2).

Example 2

Co-culture of treated ADSC with lymphocytes

ADSC which had been treated with TNF, IL-4 and lymphotoxin for three days were co- cultured with either B-lymphocytes or T-lymphocytes for an additional 7 days. ADSC co- cultured with B- lymphocytes showed an increase in the expression of CXCL13 and a decrease in both CCL19 and CCL21 expression (Fig 3). Conversely, ADSC co-cultured with T-lymphocytes showed a decrease in CXCL13 expression and an increase in both CCL19 and CCL21 expression (Fig 3).

Example 3 Treatment of stromal cell lines

Human bone marrow stromal cell line HS-5 and human tonsil stromal cell line Resto15 were treated with TNF, IL-4 and lymphotoxin for three days and then co-cultured with either B-lymphocytes or T-lymphocytes for an additional 7 days. There was no up- regulation of ICAM-1 or VCAM-1 in response to the cytokine treatment nor was there a pattern of chemokine expression follow that found when ADSC were used (Fig 4). This demonstrates that the lymphoid stromal phenotype cannot be induced in stromal cell lines.

Example 4

Requirement for both cytokines and lymphocytes

ADSC were treated with TNF, IL-4 and lymphotoxin for 10d. Chemokine mRNA levels from these cells were compared with mRNA from ADSC which had been treated with TNF, IL-4 and lymphotoxin for three days were co-cultured with either B-lymphocytes or T-lymphocytes for 7 days. High levels of chemokine expression were found only in ADSC which had been both treated and co-cultured. Treatment or lymphocyte co- culture alone was not sufficient to induce high levels of chemokine expression (Fig 5).

Example 5

Co-culture with ADSC rescues 'exhaustion' of in vitro activated T cells

T cells were activated in the presence or absence of treated ADSC. Expression of CD27 decreases and PD-1 increases with 'exhaustion'. T cells activated in the presence of ADSC were found to have higher CD27 and lower PD-1 expression when compared to T cells activated in the absence of ADSC (Fig 6).

Example 6 3D co-cultures

ADSC were co-cultured with B cells in collagen gels for 3 days. The ADSC spread out to form a 3D network and the B cells migrated into the gels and formed clusters around the ADSC (Fig 7).

Claims

1 A composition comprising an effective amount of a combination of cytokine receptor ligands wherein said ligands bind and activate IL4 receptor, tumour necrosis factor receptor and lymphotoxin β receptor wherein said composition induces the differentiation of mesenchymal stem cells into lymphoid stromal cells.

2 The composition according to claim 1 wherein said ligand is a polypeptide that naturally active activates said receptor.

3 The composition according to claim 2 wherein said polypeptide is IL4 or IL13.

4 The composition according to claim 2 wherein said polypeptide is a TNF family member.

5. The composition according to claim 4 wherein said TNF family member is selected from the group consisting of: TNF a, lymphotoxin αβ, CD154, CD27L, CD30L and TRAIL.

6. The composition according to claim 5 wherein said TNF family member is TNF a.

7. The composition according to claim 5 wherein said TNF family member is lymphotoxin αβ.

8. The composition according to claim 1 comprising IL4, TNF a and lymphotoxin αβ.

9. The composition according to claim 1 wherein said ligand is an agonistic antibody, or active antibody binding fragment thereof, which binds and activates the cytokine receptors IL4R, LT&R and TNFR.

10 The composition according to claim 9 wherein said agonistic antibody is a monoclonal antibody. 1 1 . The composition according to claim 9 wherein said ligand is an antibody fragment which binds and activates said cytokine receptors IL4R, LT3 and TNFR. 12 A method to differentiation mesenchymal stem cells into lymphoid stromal cells comprising:

ii) providing cell culture conditions that differentiate said mesenchymal stem cells into one or more lymphoid stromal cells.

13 The method according to claim 12 wherein said differentiated lymphoid stromal cells are contacted with a preparation comprising immune cells.

14 The method according to claim 13 wherein said immune cells are peripheral blood mononuclear cells [PBMCs].

15. The method according to claim 13 or 14 wherein said immune cells are selected from the group consisting of: T- lymphocytes, [either or both CD8⁺ T lymphocytes or CD4⁺ T lymphocytes] B lymphocytes, Dendritic Cells, T Regulatory Cells, innate lymphoid cells or Natural Killer Cells. 16. The method according to any one of claims 12-15 wherein said mesenchymal stem cells and/or said immune cells are autologous.

17. The method according to any one of claims 12-15 wherein said mesenchymal stem cells and/or said immune cells are allogenic.

18. The method according to any one of claims 12-15 wherein said mesenchymal stem cells and/or said immune cells are heterologous.

19. The method according to any one of claims 12-15 wherein said mesenchymal stem cells are derived from adipose tissue.

20. Use of differentiated lymphoid stromal cells formed by the method of claim 12 in the differentiation of immune cells. 21 A method for the expansion of activated immune cells comprising:

i) providing a culture of differentiated lymphoid stromal cells formed according to claim 12;

ii) contacting said differentiated stromal cells with an isolated preparation of immune cells isolated from a subject; and iii) expanding said activated immune cells.

22 The method according to claim 21 wherein said immune cells are active CD8⁺ T lymphocytes and/or activated CD4⁺ T lymphocytes.

23 The method according to claim 21 wherein said immune cells are activated B lymphocytes.

24 The method according to claim 21 wherein said immune cells are activated T Regulatory Cells, Dendritic Cells, innate lymphoid cells or NK Cells.

25 The method according to any one of claims 21 -24 wherein said subject is a human cancer subject. 26 The method according to claim 25 wherein said cancer is melanoma.

27. The method according to claim 25 wherein said cancer is prostate cancer.

28. The method according to any one of claims 21 -27 wherein said expanded immune cells are autologous or allogenic.

29 The method according to any one of claims 21 -28 wherein said immune cells are administered to a subject in need of treatment. 30. A method to produce human antibodies comprising:

contacting said differentiated stromal cells with an isolated preparation of activated B lymphocytes isolated from a subject; culturing said culture in ii) to allow said activated B lymphocytes to secrete said human antibodies; and optionally

selecting a human antibody by affinity to a selected antigen.

31 The method according to claim 30 wherein said human antibodies or selected antibody is administered to a human subject. 32 The method according to claim 30 or 31 wherein said subject is a human cancer subject.

A method for the production of a hybridoma cell line comprising:

iii) cloning said hybridoma cells from said culture; and

v) recovering said antibodies or monoclonal antibodies from the culture supernatant.

A method to screen for immune regulatory agents comprising:

i) providing a cell culture comprising differentiated lymphoid stromal cells formed according to claim 12, immune cells and at least one agent to be tested;

35 The method according to claim 34 wherein said screening method includes the steps of: collating the activity data in (ii) above; converting the collated data into a data analysable form; and optionally providing an output for the analysed data. 36 The method or use according to any one of claims 12-35 wherein said cell culture or cell preparation comprises or consists essentially of a collagen based cell support.

37 The method according to claim 36 wherein said collagen based cell support is Matrigel®. 38. A cell culture vessel comprising differentiation lymphoid stromal cells formed by the method according to claim 12.

39. The cell culture according to claim 38 wherein said cell culture vessel further comprises immune cells.

40 The cell culture vessel according to claim 38 or 39 wherein said vessel is selected from the group: petri dish, cell culture bottle or flask, multi-well culture dishes, a rotary bioreactor or microfluidic device. 41 . The method according to any one of claims 38-40 wherein said cell culture comprises a collagen based cell support.

42. The method according to claim 41 wherein said collagen based cell support is Matrigel®.