WO2013081206A1

WO2013081206A1 - Real-time pcr detection using stabilized probe

Info

Publication number: WO2013081206A1
Application number: PCT/KR2011/009180
Authority: WO
Inventors: 리준
Original assignee: 삼성테크윈 주식회사
Priority date: 2011-11-30
Filing date: 2011-11-30
Publication date: 2013-06-06

Abstract

Disclosed is a probe protector oligonucleotide for detecting an improved CATACLEAVE™ probe of a nucleic acid sequence from a test sample. The probe protector oligonucleotide is designed to be substantially mutually complementary to a FRET pair labeled CATACLEAVE™ oligonucleotide probe. A formation of a base pair between the probe protector oligonucleotide and a CATACLEAVE™ oligonucleotide probe that is combined to a chemical modification of a probe sequence prevents the formation of a spurious RNA:DNA hybrid during a PCR cycle, which can result in a non-specific cleavage of the oligonucleotide probe before the oligonucleotide probe is degraded by an endonuclease of an RNA sequence and before the detection of a target nucleic acid. An improved detection method is rapid and accurate and appropriate for high throughput application. Also disclosed is a kit, which is convenient, user-friendly, and reliable, for rapidly detecting a target nucleic acid sequence.

Description

Real-time PCR Detection with Stabilized Probes

Cross-Reference to the Related Application

This application claims priority based on US Provisional Patent Application 61 / 378,166, filed August 30, 2010, the contents of which are hereby incorporated by reference in their entirety.

Field

Stabilized oligonucleotide probe compositions for real time PCR detection of target nucleic acid sequences are disclosed.

The ability to measure the kinetics of PCR reactions in combination with PCR techniques will facilitate the accurate and precise measurement of target nucleic acid sequences in a sample with the required level of sensitivity. In particular, fluorescent dual-labeled hybridization probe technology, such as CATACLEAVE ™ endonuclease assay (described in detail in US Pat. No. 5,763,181; see FIGS. 1 and 2), provides PCR amplification in real time. Enables detection of. Detection of the target sequence is accomplished by including CATACLEAVE ™ probe with RNAase H in the amplification reaction. CATACLEAVE ™ probe, complementary to the target sequence in the PCR amplification product, has a chimeric structure comprising RNA and DNA sequences, and is flanked by markers detectable at the 5 'and 3' ends, eg, FRET pair labeled DNA sequences. It is ranked. Proximity to the quencher of the fluorescent label of the FRET pair prevents the fluorescence of the intact probe. However, annealing the probe into the PCR product produces an RNA: DNA duplex that can be cleaved by RNase H present in the amplification buffer. Cleavage of the double-stranded RNA sequence results in separation from the quencher of the fluorescent label and subsequent emission of fluorescence.

Probe protector oligonucleotides for improved CATACLEAVE ™ probe detection of nucleic acid sequences in test samples are described. The probe protection oligonucleotides are designed to be substantially complementary to FRET pair labeled CATACLEAVE ™ oligonucleotide probes. Base pairing between the probe protection oligonucleotide and a CATACLEAVE ™ oligonucleotide probe bound to chemical modification of the probe sequence is characterized by the endonucleolytic degradation of the RNA sequence in the oligonucleotide probe and the oligonucleotide prior to detection of the target nucleic acid sequence. Prevents formation of spurious RNA: DNA hybrids during PCR cycles that can lead to nonspecific cleavage of the probe.

In certain embodiments, the probe protector oligonucleotide has a structure of R3-X'-R4 (Formula II) that is substantially complementary to an oligonucleotide probe having a structure of R1-X-R2 (Formula I). Wherein each R 1, R 2, R 3, and R 4 are selected from nucleic acids or nucleic acid analogs and each X and X ′ are native RNA or modified RNA, and the oligonucleotide probe nucleic acid sequence is substantially complementary to the target nucleic acid sequence. Enemy

In another embodiment, the present disclosure describes a method of stabilizing an oligonucleotide probe wherein the hybridization comprises hybridizing a probe protection probe with an oligonucleotide probe, wherein the hybridization stabilizes the oligonucleotide probe.

The method may comprise storing the stabilized oligonucleotide probe.

The melting temperature, Tm, of the probe protective oligonucleotide hybridizing with the oligonucleotide probe may be lower than the melting temperature, Tm ', of the oligonucleotide probe hybridizing with the target nucleic acid sequence.

In another embodiment, the melting temperature, Tm, of the probe protective oligonucleotide hybridizing with the oligonucleotide probe may be about 10 ° C. lower than the melting temperature, Tm ', of the oligonucleotide probe hybridizing with the target nucleic acid sequence.

In one aspect, a protected probe is disclosed wherein the oligonucleotide probe is base paired with a probe protecting oligonucleotide.

In another embodiment, a method of detecting a target DNA sequence in a sample in real time, comprising: providing a sample comprising a target DNA sequence, providing a pair of forward and reverse amplification primers that can anneal to the target DNA sequence Providing a protected probe comprising a labeled oligonucleotide probe base paired with a protected probe oligonucleotide, wherein the oligonucleotide probe comprises an RNA and DNA nucleic acid sequence substantially complementary to the target DNA sequence. Wherein, in the presence of an amplification polymerase activity, an amplification buffer, and an RNaseH activity and a protected probe, the oligonucleotide probe can be dissociated from the probe protective oligonucleotide, and the RNA sequence of the oligonucleotide probe The target DNA sequence present in the PCR fragment Amplifying a PCR fragment between the forward and reverse amplification primers under conditions capable of forming an RNA: DNA heteroduplex, and detecting a real-time increase in the emission of a signal from a label on the oligonucleotide probe Wherein the increase in signal is indicative of the presence of the target DNA sequence in the sample.

In another embodiment, providing a sample comprising a target RNA sequence, providing a pair of forward and reverse amplification primers that can anneal to the target nucleic acid sequence, a label that forms a base pair with a protected probe oligonucleotide Providing a protected probe comprising an oligonucleotide probe, wherein the oligonucleotide probe comprises an RNA and DNA nucleic acid sequence substantially complementary to the target nucleic acid sequence, to generate a target cDNA sequence. Reverse transcribing the target RNA in the presence of reverse transcriptase activity and reverse amplification primers, amplification polymerase activity, amplification buffer, and RNaseH activity and protected probes, wherein the oligonucleotide probe is Can be dissociated from protected probe oligonucleotides Amplifying the PCR fragment between the forward and reverse amplification primers under conditions such that the RNA sequence of the oligonucleotide probe can form an RNA: DNA heteroduplex with a target DNA sequence present in the PCR fragment; and Detecting a real time increase in the release of the signal from the label on the oligonucleotide probe, wherein the increase in the signal indicates the presence of the target RNA sequence in the sample. This is described.

In another embodiment, a target nucleic acid sequence in a sample comprising a probe protecting oligonucleotide having the structure of R3-X'-R4 (Formula II) and an oligonucleotide probe having the structure of R1-X-R2 (Formula I). Wherein the probe protection oligonucleotide is substantially complementary to the oligonucleotide probe, wherein each R 1, R 2, R 3, and R 4 is selected from a nucleic acid or a nucleic acid analog, and each X and X ′ is Kits are provided that are native RNA or modified RNA, and wherein the oligonucleotide probe nucleic acid sequence is substantially complementary to the target nucleic acid sequence.

The kit may comprise amplification polymerase activity and / or reverse transcriptase activity such as positive internal control and negative control and / or uracil-N-glycosylase, and / or amplification buffer and / or thermostable DNA polymerase. RNase H activity, such as RNase H or enzymatic activity of hot start RNase H.

The protected probe may comprise a labeled oligonucleotide probe having a structure of R1-X-R2 (Formula I) that base-paired with a probe protection oligonucleotide having a structure of R3-X'-R4 (Formula II). Wherein each of R 1, R 2, R 3, and R 4 is selected from nucleic acids or nucleic acid analogs, each X and X ′ are native RNA or modified RNA, and the probe protection oligonucleotide is substantially linked to the oligonucleotide probe. As complementary.

The real time increase in signal release from the label on the oligonucleotide probe is derived from cleavage by RNase H of the heteroduplex formed between the oligonucleotide probe and one of the strands of the PCR fragment.

The amplifying may cause the oligonucleotide probe to be dissociated from the protected probe oligonucleotide and form an RNA: DNA heteroduplex with a target DNA sequence in which the RNA sequence of the oligonucleotide probe is present in a PCR fragment. Under conditions that can be.

The PCR fragment may be amplified by polymerase chain reaction (PCR), rolling circle amplification (RCA), nucleic acid sequence based amplification (NASBA), or strand displacement amplification (SDA).

The oligonucleotide probe may be labeled with an enzyme, an enzyme substrate, a radioactive material, a fluorescent dye, a chromophore, a chemiluminescent label, an electrochemiluminescent label, or a ligand having a binding partner.

The oligonucleotide probe may be labeled with a fluorescence resonance energy transfer (FRET) pair that includes a fluorescence donor and a fluorescence acceptor.

Fluorescence donor luminescence of the oligonucleotide is quenched by a fluorescent receptor, but cleavage of the RNA sequence of the oligonucleotide probe prevents quenching by the fluorescent receptor.

The RNase H activity may be the activity of thermostable RNase H. The RNase H activity may be hot start RNase H activity.

The PCR fragment can be bound to a solid support.

The amplification polymerase activity may be the activity of a thermostable DNA polymerase.

The nucleic acid in the sample may be pre-treated with uracil-N-glycosylase, which is inactivated prior to PCR amplification.

The amplification buffer may be a Tris-acetate buffer.

-OH at the 3'-end of the oligonucleotide probe can be blocked to prevent the oligonucleotide probe from acting as a substrate for primer extension by template-dependent nucleic acid polymerase.

The foregoing embodiments have a number of advantages, including the use of protected CATACLEAVE ™ to improve the stability of conventional CATACLEAVE ™ probes that include labile RNA ribonucleotides. The improved detection method is fast, accurate and suitable for high throughput applications. Convenient, user-friendly and reliable kits for high speed detection of target nucleic acid sequences are also described.

상세한 설명details

The practice of the embodiments described herein uses molecular biological techniques conventional within the art, unless otherwise indicated. Such techniques are well known to those skilled in the art and are fully described in the literature. See, for example, Ausubel, et al., Ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., N.Y, including all supplements. (1987-2008); Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, N.Y. (1989).

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The present specification also provides definitions of terms to support the disclosure of the present application and the interpretation of the claims. If the definition does not match the definition elsewhere, the definition specified in this application shall prevail.

As used herein, the term “nucleic acid” refers to an oligonucleotide or polynucleotide and the oligonucleotide or polynucleotide may be modified or may include a modified base. Oligonucleotides are single-stranded polymers of nucleotides containing from 2 to 60 nucleotides. Polynucleotides are polymers of nucleotides comprising two or more nucleotides. The polypolynucleotide is a double-stranded DNA comprising annealed oligonucleotides, single-stranded nucleic acid polymers including deoxythymidine, wherein the second strand is an oligonucleotide having the reverse complement sequence of the first oligonucleotide, Single-stranded RNA, double-stranded RNA, or RNA / DNA heteroduplex. Nucleic acids are obtained on or within biological samples, such as genomic DNA, cDNA, hnRNA, snRNA, mRNA, rRNA, tRNA, fragmented nucleic acid, subcellular organelles such as mitochondria or chloroplasts, and biological samples. Nucleic acids obtained from microorganisms or DNA viruses or RNA viruses that may be present in, but are not limited to. Nucleic acids can be composed of a mixture of different sugar moieties, for example one type of sugar moiety as in the case of RNA and DNA, or as in the case of RNA / DNA chimeras.

As used herein, the term “nucleic acid analog” refers to a molecule comprising one or more nucleotide analogs and / or one or more phosphate ester analogs and / or one or more pentose analogs. Examples of nucleic acid analogs are molecules in which the phosphate ester and / or sugar phosphate ester bonds are replaced with other forms of bonds, such as N- (2-aminoethyl) -glycine amide and other amide bonds. Still other examples of such nucleic acid analogs include one or more nucleotide analogs and / or one or more phosphate ester analogs and / or one or more pentose analogs, and double stranded between nucleic acids, nucleic acid analogs, and / or nucleic acids and nucleic acid analogs by hybridization. It may be a molecule forming a.

"Target DNA" or "target RNA" or "target nucleic acid," or "target nucleic acid sequence" means a nucleic acid that is targeted by DNA amplification. do. The target nucleic acid sequence serves as a template for amplification in a PCR reaction or reverse transcriptase-PCR reaction. Target nucleic acid sequences can include both natural and synthetic molecules. Representative nucleic acid sequences include, but are not limited to genomic DNA or genomic RNA.

As used herein, "label" or "detectable label" means any chemical moiety bound to a nucleotide, nucleotide polymer, or nucleic acid binding factor, wherein the binding is covalent or Or non-covalent. Preferably, the label is detectable and allows the nucleotide or nucleotide polymer to be detected by the practitioner of the invention. Detectable labels include luminescent molecules, chemiluminescent molecules, fluorochromes, fluorescent quenching agents, colored molecules, radioactive isotopes, or scintillants. Detectable labels are also useful linker molecules (eg biotin, avidin, streptavidin, HRP, protein A, protein G, antibodies or fragments thereof, Grb2, polyhistidine, Ni ²⁺ , FLAG tag, myc) Tag), heavy metals, enzymes (examples include alkali phosphatase, peroxidase, and luciferase), electron donors / receptors, acridinium esters, dyes, and colorimetric substrates. It is also contemplated that a change in mass can be considered as a detectable label, as in the case of surface plasmon resonance detection. Those skilled in the art will readily recognize useful detectable labels not described above that may be used in the practice of the present invention.

Probe protector technology is described in the context of CATACLEAVE real-time PCR detection of target nucleic acids, including:

(1) selection of forward and reverse amplification primer sequences;

(2) selective enrichment of bacterial cells in test samples;

(3) preparation of nucleic acid templates from prokaryotic and eukaryotic cells;

(4) PCR amplification of the target nucleic acid sequence;

(5) selective reverse transcriptase-PCR amplification of RNA target nucleic acid sequences;

(6) real time PCR using CATACLEAVE ™ probes;

(7) labeling of CATACLEAVE ™ probes;

(8) binding of the CATACLEAVE ™ probe to a solid support;

(9) cleavage by RNase H of CATACLEAVE ™ probe;

(10) Probe protector oligonucleotides;

(11) CATACLEAVE ™ Real-Time PCR with Stabilized CATACLEAVE ™ Oligonucleotide Probes, and

12 kits

프라이머 서열의 선택Selection of Primer Sequences

Those skilled in the art will know how to design PCR primers that flank corresponding target nucleic acid sequences. Synthesized oligonucleotides typically have a melting temperature, Tm, of about 55 degrees and are 20 to 26 bp in length (base pair).

In certain embodiments, the primer sequences are selected based on their ability not to form primer dimers in standard PCR reactions. A "primer dimer" is a potential byproduct of PCR, consisting of primer molecules that partially hybridize with each other because of a series of complementary bases in the primers. As a result, DNA polymerase amplifies the primer dimers, resulting in competition for PCR reagents, thus potentially hindering the amplification of targeted DNA sequences for PCR amplification. In real-time PCR, primer dimers can inhibit accurate quantitation by lowering sensitivity. Thus, primer pairs are chosen based on their ability not to form primer dimers during PCR amplification. Such primers can detect a single target molecule in about 40 PCR cycles using optimal amplification conditions.

테스트 시료 중 박테리아 세포의 선택적 강화Selective enrichment of bacterial cells in test sample

Optional protocols for detecting target prokaryotic sequences include providing a food sample or surface wipe, mixing the sample or tissue with a growth medium and incubating to increase the number or population of microorganisms (" Enrichment "), disintegrating the cells (" lysis "), and performing amplification and detection of the target nucleic acid sequence on the obtained lysate. Food samples include fish such as salmon, dairy products such as milk, and meats such as eggs, poultry, fruit juice, ground pork, pork, ground beef, or beef such as beef, vegetables such as spinach or alfalfa sprouts, or processed nuts such as peanut butter. It may include, but is not limited thereto.

핵산 주형 제조Nucleic Acid Template Preparation

Procedures for the extraction and purification of nucleic acid templates from samples are well known in the art, for example, in F. Ausubel et al., Eds., Current Protocols in Molecular Biology, Wiley-Interscience, New York (1993). Chapter (DNA) and Chapter 4 (RNA).

In the case of DNA, this protocol generally involves the weak lysis of cells, including the lysis of DNA, and the substantial separation of DNA from contaminants such as proteins, RNA and other substances by enzymes or by chemical methods (ie, DNA and Lowering the concentration of these contaminants in the same solution to a level low enough for the corresponding molecular biological procedure to be performed).

RNA separation methods used liquid-liquid extraction (ie phenol-chloroform) and alcohol precipitation. Perhaps the most widely used liquid-liquid extraction method is Chomczynski and Sacchi's "acid-guanidinium-phenol" method (Chomczynski P, Sacchi N., Single - step method of R_A isolation by acid guanidinium thiocyanate - phenol - chloroform extraction , Anal Biochem 162: 156-9; US Pat. Nos. 5,945,515, 5,346,994, and 4,843,155).

More recently, various solid phase purification protocols have been developed that bind nucleic acids to solid supports and selectively elute impurities such as proteins and phospholipids.

Solid phase methods can be broadly classified into silica or ion-exchange resins, depending on the type of solid phase used for such extraction. For solid phase nucleic acid separation methods, a number of solid supports are used, including membrane filters, magnetic beads, metal oxides, and latex particles. Perhaps the most widely used solid supports are silica-based particles (eg, US Pat. No. 5,234,809 (Boom et al.); International Application WO 95/01359 (Colpan et al.); US Pat. No. 5,405,951 ( Woodard); see international application WO 95/02049 (Jones); WO 92/07863 (Qiagen GmbH). The nucleic acid binds to silica in the presence of a chaotropic agent.

A number of commercial kits for high speed nucleic acid isolation are also available (eg MagMAX ™ RNA Isolation Kits, Ambion Cat. # AM1830; Wizard® SV 96 Genomic DNA Purification System, Promega, Cat. # A6780).

In a preferred embodiment, the sample to be tested for the target nucleic acid sequence is a cell lysate that does not require further purification prior to real time PCR. Here again, a number of commercial kits are available, such as the TaqMan Gene Expression Cells-to-CT ™ Kit (Ambion, Cat. # AM1728).

The cells also contain a zwitterionic detergent at a pH of about 6 to about 9, a concentration of about 0.125% to about 2%, azide and proteinase K at a concentration of about 0.3 to about 2.5 mg / ml (about 1 mg / Lysis buffer with protease such as ml) can be used to lyse the cells. After 15 minutes of incubation at 55 ° C., proteinase K is inactivated at 95 ° C. for 10 minutes to “substantially protein free” which can be used for high efficiency PCR or reverse transcription PCR analysis. Produces a lysate.

In one embodiment, the 1 x lysis reagent is 12.5 mM Tris acetate or Tris-HCl or HEPES (4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid) (pH = 7-8), 0.25% (w / v) CHAPS, 0.3125 mg / ml sodium azide and proteinase K 1 mg / ml.

As used herein, the term “lysate” refers to a liquid phase comprising lysed cell debris and nucleic acids.

As used herein, the term "substantially protein free" means a lysate in which most proteins are inactivated by proteolytic cleavage by proteases. Proteases may include proteinase K. The addition of proteinase K during cell degradation rapidly inactivates nucleases that can degrade target nucleic acids. Lysates that are “substantially free of protein” may or may not be treated to remove inactivated protein.

For dissolution of Gram-negative bacteria such as Salmonella, Listeria and Escherichia coli, 1 mg / ml proteinase K may be added to the dissolution reagent. After incubation at 55 ° C. for 15 minutes, the proteinase is inactivated at 95 ° C. for 10 minutes to produce a substantially protein-free lysate that can be used for high efficiency PCR or reverse transcription PCR analysis.

As used herein, “zwitterionic detergent” means a detergent that exhibits zwitterionicity (eg, has no net charge, does not have conductivity and electrophoretic mobility, and Does not bind to exchangeable resins, destroys protein-protein interactions), CHAPS, CHAPSO and betaine derivatives, for example, the brand names Zwittergent® (Calbiochem, San Diego, CA) and Anzergent® (Anatrace , Inc. Maumee, OH), including but not limited to sulfobetaine.

In one embodiment, the zwitterionic detergent is CHAPS (CAS Number: 75621-03-3), which is an abbreviation of 3-[(3-colamidopropyl) dimethylammonio] -1-propanesulfonate having the structure SIGMA-ALDRICH product no.C3023-1G) (described in more detail in US Pat. No. 4,372,888):

In another embodiment, CHAPS is present at a concentration of about 0.125% to about 2% w / v (weight / volume) of the total composition. In another embodiment, CHAPS is present at a concentration of about 0.4% to about 0.7% w / v of the total composition.

In other embodiments, the lysis buffer may comprise other non-ionic detergents such as Nonidet, Tween or Triton X-100.

As used herein, the term "lysis buffer" refers to a composition capable of effectively maintaining a pH value of 6 to 9, with a pKa of about 6 to about 9 at 25 ° C. The buffers described herein are generally physiologically compatible buffers that match the function of enzyme activity and allow biological molecules to maintain their normal physiological and biochemical functions.

Examples of buffers added to the lysis buffer include HEPES ((4- (2-hydroxyethyl) -1-piperazinethanesulfonic acid), MOPS (3- (N-morpholino) -propanesulfonic acid), N-tris ( Hydroxymethyl) methylglycine acid (Tricine), tris (hydroxymethyl) methylamine acid (Tris), piperazine-N, N'-bis (2-ethanesulfonic acid) (PIPES) and acetate or phosphate containing buffer (K ₂ HPO ₄ , KH ₂ PO ₄ , Na ₂ HPO ₄ , NaH ₂ PO ₄ ), and the like.

The term "azide" as used herein is represented by the formula -N ₃ . In one embodiment, the azide is sodium azide NaN ₃ (CAS number 26628-22-8; SIGMA-ALDRICH Product number: S2002-25G) which acts as a general bacteriocide.

As used herein, the term "protease" is an enzyme that hydrolyzes peptide bonds (with protease activity). Proteases are also referred to as, for example, peptidase, proteinase, peptide hydrolase, or proteolytic enzyme. Proteases for use according to the invention may be endo-types that act internally in the polypeptide chain (endopeptidase). In one embodiment, the protease is serine protease, proteinase K (EC 3.4.21.64; Roche Applied Sciences), recombinant proteinase K 50 U / ml (from Pichia pastoris) Cat. No. 03 115 887 001).

Proteinase K is used to degrade proteins and remove contamination from preparations of nucleic acids. The addition of proteinase K to the nucleic acid preparation rapidly inactivates nucleases that can degrade DNA or RNA during purification. The enzyme is well suited for this application because it is active in the presence of chemicals that denature the protein and can be inactivated at about 95 ° C. for about 10 minutes.

In addition to or instead of proteinase K, the dissolution reagents are trypsin, chymotrypsin, elastase, subtilisin, streptogrisine, thermitase, aqualysin, plasmin, cuckoo Cucumisin, or serine proteases such as carboxypeptidase A, D, C, or Y. In addition to serine proteases, dissolution solutions may be cysteine proteases such as papain, calpine, or clostripain; Acid proteases such as pepsin, chymosin, or cathepsin; Or metalloproteases such as pronase, thermolysin, collagenase, dispase, aminopeptidase, or carboxypeptidase A, B, E / H, M, T, or U (metalloprotease). Proteinase K is stable at a wide range of pH (pH 4.0-10.0) and stable in buffers containing zwitterionic detergents.

표적 핵산 서열의 PCR 증폭PCR amplification of the target nucleic acid sequence

Once primers are prepared, nucleic acid amplification by a variety of methods, including but not limited to polymerase chain reaction (PCR), nucleic acid sequence based amplification (NASBA), ligand chain reaction (LCR), and rolling circle amplification (RCA) This can be done. Polymerase chain reaction (PCR) is the most commonly used method for amplifying specific target DNA sequences.

"Polymerase chain reaction," or "PCR," generally refers to a method of amplifying a desired nucleotide sequence in vitro. In general, PCR methods consist of introducing a molar excess of two or more extensible oligonucleotide primers into a reaction mixture comprising a desired target nucleic acid, the primers complementing the corresponding strands of the double stranded target sequence. Enemy In the presence of DNA polymerase in the reaction mixture, a program of thermal cycling is applied, resulting in amplification of the desired target sequence flanked by DNA primers.

PCR techniques: PCR: A Practical Approach, MJ McPherson, et al., IRL Press (1991), PCR Protocols: A Guide to Methods and Applications, by Innis, et al., Academic Press (1990), and PCR Technology: Principals and Applications for DNA Amplification, HA Erlich, Stockton Press (1989). PCR is also described in US Pat. Nos. 4,683,195, each incorporated herein by reference; No. 4,683,202; No. 4,800,159; 4,965,188; 4,965,188; 4,889,818; 4,889,818; 5,075,216; 5,075,216; 5,079,352; 5,079,352; 5,104,792; 5,104,792; 5,023,171; 5,023,171; 5,091,310; 5,091,310; And US Pat. No. 5,066,584.

As used herein, the term "sample" means any substance including nucleic acids.

As used herein, the term "PCR fragment" or "reverse transcriptase-PCR fragment" or "amplicon" refers to a polynucleotide produced after amplification of a specific target nucleic acid. A molecule (or collectively, a plurality of molecules). PCR fragments, although not exclusively, are typically DNA PCR fragments. PCR fragments may be single-stranded or double-stranded, or mixtures thereof in any concentration ratio. PCR fragments or RT-PCT may be about 100 to about 500 nt in length.

A "buffer" is a compound added to an amplification reaction that adjusts the pH of the amplification reaction to modify the stability, activity, and / or lifetime of one or more components of the amplification reaction. The buffering agent of the present invention may be compatible with PCR amplification and site-specific RNase H cleavage activity. Certain buffers are well known in the art and include Tris, Tricine, MOPS (3- (N-morpholino) propanesulfonic acid), and HEPES (4- (2-hydroxyethyl) -1-piperazinethanesulfonic acid). Including but not limited to. In addition, the PCR buffer may generally comprise about 70 mM or less KCl and about 1.5 mM or more MgCl ₂ , about 50-200 μM of each of the nucleotides dATP, dCTP, dGTP and dTTP. The buffer of the present invention may include additives to optimize efficient reverse transcriptase-PCR or PCR reactions.

The term "nucleotide," as used herein, refers to a compound comprising a sugar such as ribose, arabinose, xylose, and pyranose, and a nucleotide base bound to the C-1 'carbon of the sugar analog thereof. Means. The term "nucleotide" includes ribonucleoside triphosphates such as rATP, rCTP, rGTP, or rUTP, and deoxyribonucleoside triphosphates such as dATP, dCTP, dGTP, or dTTP.

As used herein, the term “nucleoside” refers to a combination of a base and a sugar, ie, a nucleotide without a phosphate moiety. The terms "nucleoside" and "nucleotide" can be used interchangeably in the art. For example, dUTP is a deoxyribonucleoside triphosphate and, when inserted into DNA, can serve as a DNA monomer, ie dUMP or deoxyuridine monophosphate. In this case, even if the obtained DNA does not contain dUTP, it can be expressed that dUTP is inserted into DNA.

The term nucleotide also encompasses nucleotide analogs. The sugar may be substituted or unsubstituted. Substituted ribose sugars are substituted with one or more identical or different Cl, F, -R, -OR, -NR ₂ or halogen groups in which one or more carbon atoms, for example a 2'-carbon atom, is substituted for each R Ribose, which is H, C1-C6 alkyl or C5-C14 aryl. Representative riboses include, but are not limited to: 2 '-(C1-C6) alkoxyribose, 2'-(C5-C14) aryloxyribose, 2 ', 3'-didehydroribose, 2 '-Deoxy-3'-haloriose, 2'-deoxy-3'-fluororibose, 2'-deoxy-3'-chlororibose, 2'-deoxy-3'-aminoribose, 2'- Deoxy-3 '-(C1-C6) alkylribose, 2'-deoxy-3'-(C1-C6) alkoxyribose and 2'-deoxy-3 '-(C5-C14) aryloxyribose, 2 '-Deoxyribose, 2', 3'-dideoxyribose, 2'-haloribose, 2'-fluororibose, 2'-chlororibose, and 2'-alkylribose, such as 2'-O- Methyl, 4'-α-anomeric nucleotides, 1'-α-anomeric nucleotides, 2'-4'- and 3'-4'-bindings and other "locked" or "LNA" , Bicyclic sugar modifications (eg, PCT publications WO 98/22489, WO 98/39352, and WO 99/14226; and US Pat. No. 6,268,490). And 6,794,499).

An additive is a compound added to a composition that modifies the stability, activity, and / or life of one or more components of the composition. In certain embodiments, the composition is an amplification reaction composition. In certain embodiments, the additive inactivates contaminating enzymes, stabilizes protein folding, and / or reduces aggregation. Representative additives that may be included in the amplification reaction are betaine, formamide, KCl, CaCl ₂ , MgOAc, MgCl ₂ , NaCl, NH ₄ OAc, NaI, Na (CO ₃ ) ₂ , LiCl, MnOAc, NMP, trehalose , Dimethyl sulfoxide ("DMSO"), glycerol, ethylene glycol, dithiothreitol ("DTT"), pyrophosphatase (pyrophosphatase) (including but not limited to Thermoplasma acidophilum inorganic pyrophosphatase (TAP)) , Bovine serum albumin ("BSA"), propylene glycol, glycineamide, CHES, PercollTM, aurintricarboxylic acid, Tween 20, Tween 21, Tween 40, Tween 60, Tween 85, Brij 30, NP-40 , Triton X-100, CHAPS, CHAPSO, Mackernium, LDAO (N-dodecyl-N, N-dimethylamine-N-oxide), Zwittergent 3-10, Xwittergent 3-14, Xwittergent SB 3-16, Empigen, NDSB-20, T4G32, E. Coli SSB, RecA, nicking endonuclease, 7-deazaG, dUTP, UNG, anionic detergent, cationic detergent, nonionic detergent, Zwittergent, steols, osmolytes, cations, and other chemicals, proteins, or cofactors that can alter the efficiency of amplification. In certain embodiments, two or more additives are included in the amplification reaction. According to the invention, if an additive does not inhibit the activity of RNase H, it can be added to improve the selectivity of primer annealing.

As used herein, the term “thermostable,” applied to an enzyme, maintains its biological activity at an elevated temperature (eg, above 55 ° C.), or after repeated cycles of heating and cooling It means an enzyme that maintains biological activity. Thermostable polynucleotide polymerases have a special use in PCR amplification reactions.

As used herein, “amplifying polymerase activity” refers to an enzyme activity that catalyzes the polymerization of deoxyribonucleotides. Generally, the enzyme will initiate synthesis at the 3'-end of the primer annealed to the nucleic acid template sequence and will proceed towards the 5 'end of the template strand. In certain embodiments, “amplification polymerase activity” is a thermostable DNA polymerase.

As used herein, thermostable polymerases are enzymes that are relatively stable to heat and eliminate the need to add an enzyme before each PCR cycle.

Non-limiting examples of thermostable DNA polymerases include the thermophilic bacterium Thermos Aquaticus.Thermus aquaticus(Taq polymerase), Thermos Thermophilus (Thermus thermophilus(Tth polymerase), Thermococcus litoralis (Thermococcus litoralis) (Tli or VENT ™ polymerase), Pyrococcus Puriosus (Pyrococcus furiosus) (Pfu or DEEPVENT ™ polymerase), Pyrococcose Wuxi (Pyrococcus woosii(Pwo polymerase) and other pyrococcus species, Bacillus steareromophilus (Bacillus stearothermophilus(Bst polymerase), sulfolobus acido caldarius (Sulfolobus acidocaldarius(Sac polymerase), thermoplasma Axi do Phil Room (Thermoplasma acidophilum(Tac polymerase), Thermos louver (Thermus rubber(Tru polymerase), Thermos Brockchianus (Thermus brockianus(DYNAZYME ™ Polymerase) (Tne Polymerase), Thermomotoga Marittima (Thermotoga maritima(Tma) and other species of the genus Thermomotoga (Tsp polymerase), and Metanobacterium termoautotrophicum (Methanobacterium thermoautotrophicumPolymerase isolated from (Mth polymerase), but is not limited thereto. PCR reactions may include two or more thermostable polymerase enzymes with complementary properties that result in more efficient amplification of the target sequence. For example, a nucleotide polymerase with high processivity (the ability to copy large nucleotide segments) is another nucleotide polymer with proofreading ability (the ability to correct errors during stretching of the target nucleic acid sequence). Complemented with an aze, one can generate PCR reactions that can copy long target sequences with high fidelity. Thermostable polymerases can be used in wild-type form. Alternatively, the polymerase may be modified to include fragments of the enzyme or to include mutations that provide useful properties to facilitate the PCR reaction. In one embodiment, the thermostable polymerase may be Taq polymerase. Many variants of Taq polymerases with improved properties are known and include, but are not limited to, AmpliTaq ™, AmpliTaq ™, Stoffel fragments, SuperTaq ™, SuperTaq ™ plus, LA Taq ™, LApro Taq ™, and EX Taq ™. It is not limited. In another embodiment, the thermostable polymerase used in the multiple decay reactions of the present invention is an AmpliTaq Stoffel fragment.

The nucleic acid polymerase may have a concentration of at least 0.1 unit / μl in the reaction mixture. For example, the concentration of the nucleic acid polymerase in the reaction mixture may range from 0.1 to 10 unit / μl, 0.1 to 5 unit / μl, 0.1 to 2.5 unit / μl, or 0.1 to about 1 unit / μl.

The amplification may be performed using, for example, an amplification method selected from the group consisting of PCR, rolling circle amplification (RCA), nucleic acid sequence based amplification (NASBA), and strand displacement amplification (SDA). Hybridization refers to the formation of a duplex by binding two strands of nucleic acid strands to each other by complementary binding. The hybridization can be accomplished by methods known in the art. For example, the hybridization can be performed by heating the primer and / or target sequences to separate the double strands into single strands and lowering the temperature so that two complementary strands can bind. If the target sequence is single stranded, primers and / or stranding of the target sequence may not be necessary. The hybridization may be performed using a buffer having an appropriate buffer, for example, an appropriate salt concentration and an appropriate pH, depending on the type of primer and / or target sequence selected. Extensions are known in the art. The extension can be performed using, for example, DNA polymerase, RNA polymerase, or reverse transcriptase. The nucleic acid polymerase may be thermostable, and may maintain its activity when exposed to a temperature of, for example, 95 ° C or higher. Thermostable DNA polymerase may be an enzyme isolated from thermophilic bacteria as defined herein. For example, the thermostable DNA polymerase may be Taq polymerase with optimal activity at a temperature of about 70 ° C.

RNA 표적 핵산 서열의 역전사효소-PCR 증폭Reverse Transcriptase-PCR Amplification of RNA Target Nucleic Acid Sequences

One of the most widely used techniques for studying gene expression uses first strand cDNA for mRNA sequences as a template for amplification by PCR.

The terms "reverse transcriptase activity" and "reverse transcription" refer to RNA-dependent DNA polymerases capable of synthesizing DNA strands (ie, complementary DNA, cDNA) using RNA strands as templates. It means the enzymatic activity of the polymerase of the kind classified as.

The "reverse transcriptase-PCR" of "RNA-PCR" is first used before the multiple cycles of DNA-dependent DNA polymerase primer extension using RNA templates and reverse transcriptase, or enzymes with reverse transcriptase activity. It is a PCR reaction that produces stranded DNA molecules. Multiplex PCR (Multiplex PCR) refers to a PCR reaction that produces two or more amplification products in a single reaction, typically by including more than two types of primers in a single reaction.

Representative reverse transcriptases are mutant forms of M-MLV-RT lacking RNase H activity as described in US Pat. No. 4,943,531, M-MLV (M-MLV) RT, US Pat. No. 5,405,776, bovine leukemia virus) RT, Roussarcoma virus (RSV) RT, Avian Myeloblastosis Virus (AMV) RT, and reverse transcriptases disclosed in US Pat. No. 7,883,871.

The reverse transcriptase-PCR method, performed by end-point analysis or real time analysis, involves two separate molecular synthesis: (i) synthesis of cDNA from an RNA template; And (ii) replication of the newly synthesized cDNA via PCR amplification. In order to solve the technical problems associated with reverse transcriptase-PCR, a number of protocols have been developed taking into account the three basic steps of the method: (a) denaturation of RNA and hybridization of reverse primers; (b) synthesis of cDNA; And (c) PCR amplification. In the so-called "uncoupled" reverse transcriptase-PCR method (e.g., two stage reverse transcriptase-PCR), reverse transcription is performed in an independent step using optimal buffer conditions for reverse transcriptase activity. After cDNA synthesis, the reaction solution is diluted to reduce the MgCl ₂ and deoxyribonucleoside triphosphate (dNTP) concentrations to conditions optimal for Taq DNA polymerase activity and PCR is performed according to standard conditions (US Patents 4,683,195 and 4,683,202). In contrast, the "coupled" RT PCR method utilizes one common or compromised buffer for reverse transcriptase and DNA Taq polymerase activity. In one version, the annealing of the reverse primer is a separate step followed by the addition of the enzyme, after which the enzyme is added to a single reaction vessel. In another version, reverse transcriptase activity is a component of Tth DNA polymerase. Annealing and cDNA synthesis are carried out in the presence of Mn ²⁺ , followed by removal of Mn ²⁺ by chelating agent and PCR in the presence of Mg ²⁺ . Finally, a “continuous” method (eg, one step reverse transcriptase-PCR) integrates three reverse transcriptase-PCR steps into a single continuous reaction, without opening the reaction vessel for component or enzyme addition. do. Continuous reverse transcriptase-PCR is a single enzyme system utilizing the reverse transcriptase activity of thermostable Taq DNA polymerase and Tth polymerase, and AMV RT and Taq DNA polymers, where the first 65 ° C. RNA denaturation step can be omitted. It has been described as a two enzymatic system using an aze.

Stage 1 reverse transcriptase-PCR offers several advantages over isolated reverse transcriptase-PCR. One-stage reverse transcriptase-PCR requires less handling of reaction mixture reagents and nucleic acid products than isolated reverse transcriptase-PCR (e.g., reaction tubes for the addition of components or enzymes between two reaction steps) Opening, thus reducing labor-intensive and required person hours. One-stage reverse transcriptase-PCR requires fewer samples and lowers the risk of contamination. The sensitivity and specificity of one-step reverse transcriptase-PCR has proven to be suitable for the study of expression levels of one to several genes in a given sample or for detection of pathogenic DNA. Typically, this method has been limited to the use of gene-specific primers to initiate cDNA synthesis.

* The ability to measure the kinetics of PCR reactions by on-line detection in combination with this reverse transcriptase-PCR technique enabled accurate and precise measurement of RNA sequences with high sensitivity. This can be accomplished using fluorescent dual-labeled hybridization probes, such as the 5 'fluorogenic nuclease assay ("TaqMan ™") technique or endonuclease assay (see below). It was made possible by detecting reverse transcriptase-PCR products through fluorescence monitoring and measurement of PCR products during the amplification process by "CATACLEAVE ™".

CATACLEAVE™ 프로브를 이용한 실시간 PCR Real-Time PCR with CATACLEAVE ™ Probes

Amplicon detection after amplification may be difficult and time consuming. Real-time methods have been developed to monitor amplification during the PCR process. These methods typically use fluorescently labeled probes that anneal to newly synthesized DNA or dyes that increase fluorescence when intercalated to double stranded DNA.

Probes are generally designed such that donor emission is quenched in the absence of a target by fluorescence resonance energy transfer (FRET) between two chromophores. When a pair of donor chromosome and receptor chromosome are located adjacent, a donor chromophore, in an excited state, can transfer energy to the receptor chromophore. This transfer is always non-radiative and can occur through dipole-dipole coupling. If the distance between the chromophores is sufficiently increased, the FRET efficiency is lowered and donor chromophore emission can be detected radially. Examples of donor chromosomes include 6-carboxyfluorescein (FAM), TAMRA, VIC, JOE, Cy3, Cy5 and Texas Red. The excitation spectrum of the receptor chromosome is chosen to overlap the emission spectrum of the donor chromosome. An example of such a pair is FAM-TAMRA. There is also a non fluorescent acceptor that quenches a wide range of donors. Other examples of donor-receptor FRET pairs are known in the art.

General examples of FRET probes that can be used for real-time detection of PCR include molecular beacons (eg US Pat. No. 5,925,517), TaqMan ™ probes (eg US Pat. Nos. 5,210,015 and 5,487,972). ), And CATACLEAVE ™ probe probes (eg, US Pat. No. 5,763,181). The molecular beacon is a single stranded oligonucleotide designed to form a secondary structure in which the probe in the unbound state is adjacent to the donor chromosome and the acceptor chromosome and the donor luminescence is reduced. At a suitable reaction temperature, the beacons are unfolded and bind specifically to the amplicons. Once unfolded, the distance between the donor chromophore and the acceptor chromophore increases so that the FRET is reversed and donor luminescence can be monitored using specialized devices. TaqMan ™ and CATACLEAVE ™ technology differs from molecular beacons in that the FRET probes used are cleaved so that the donor chromosome and the receptor chromosome are sufficiently separated to reverse the FRET.

TaqMan ™ technology utilizes single stranded oligonucleotide probes labeled with a donor chromosome at the 5 'end and a receptor chromosome at the 3' end. DNA polymerase used for amplification should include 5 '→ 3' exonuclease activity. TaqMan ™ probes bind to one strand of the amplicon at the same time the primers bind. As the DNA polymerase extends the primer, the polymerase will ultimately meet the bound TaqMan ™ probe. At this time, the exonuclease activity of the polymerase will degrade the TaqMan ™ probe sequentially starting at the 5 'end. As the probe is digested, the mononucleotide containing the probe is released into the reaction buffer. The donor diffuses away from the receptor and the FRET is reversed. Luminescence from the donor is monitored to confirm probe cleavage. Because of the way TaqMan ™ works, certain amplicons can only be detected once every cycle of PCR. Extension of the primer through the TaqMan ™ target site produces a double stranded product that prevents further binding of the TaqMan ™ probe until the Amplicon denatures in the next PCR cycle.

US Pat. No. 5,763,181, the contents of which are incorporated herein by reference, describes another real-time detection method (referred to as "CATACLEAVE ™"). CATACLEAVE ™ technology differs from TaqMan ™ in that the cleavage of the probe is by a second enzyme that does not have polymerase activity. CATACLEAVE ™ probes have a sequence in the molecule that is the target of an endonuclease, eg, a restriction enzyme or an RNase. In one example, the CATACLEAVE ™ probe has a chimeric structure wherein the 5 'and 3' ends of the probe consist of DNA and the cleavage site comprises RNA.

For example, the probe may have a structure represented by Formula I:

R1-X-R2 (Formula I)

Wherein R 1 and R 2 are each selected from the group consisting of nucleic acids and nucleic acid analogs, and X may be the first RNA. For example, R1 and R2 may both be DNA, R1 may be DNA and R2 may be RNA, R1 may be RNA and R2 may be DNA, or R1 and R2 may both be RNA. The nucleic acid or nucleic acid analog of R1 and R2 may be a protected nucleic acid. For example, the nucleic acid and nucleic acid analog can be methylated and thus can be resistant to degradation by RNA specific degradation enzymes (eg, RNase H). The length of the probe may vary depending on the target nucleic acid and PCR conditions. The annealing temperature (Tm) of the probe may be about 60 ° C or more, about 70 ° C or more, or about 80 ° C or more.

The probe can be modified. For example, bases in the probe may be partially or wholly methylated. Modification of these bases can protect the probe from degradation by enzymes, chemical factors, or other factors. Also, in the probe, the 5 'end or 3' end -OH group may be blocked. The OH group at the 3 ′ end of the probe nucleic acid may be blocked such that the probe cannot be a substrate for primer extension by template dependent nucleic acid polymerase.

The DNA sequence portion of the probe may be labeled by FRET pair either at the end or inside. The PCR reaction includes an RNase H enzyme that will specifically cleave the RNA sequence portion of the RNA-DNA duplex. After cleavage, the two half fragments of the probe dissociate from the target amplicon at the reaction temperature and diffuse into the reaction buffer. As the donor and acceptor are separated, FRET can be reversed and donor luminescence can be monitored in the same manner as in the TaqMan ™ probe. Cleavage and dissociation regenerate sites for further CATACLEAVE ™ binding. This allows a single amplicon to serve as a target of multiple probe cleavage until the primer extends past the CATACLEAVE ™ probe binding site.

CATACLEAVE 프로브의 표지화Labeling of CATACLEAVE Probes

The term “probe” (also referred to as “olinonucleotide probe” or “CATACLEAVE ™ probe”) refers to a specific portion designed to hybridize in a sequence-specific manner with a specific nucleic acid sequence, eg, a complementary region of a target nucleic acid sequence. Include. The length of the probe may be, for example, in the range of about 10 to about 200 nt, about 15 to about 200 nt, or about 15 to about 60 nt, more preferably about 18 to about 30 nt. The exact sequence and length of the oligonucleotides of the invention depend in part on the nature of the target polynucleotide to which the probe binds. Bonding locations and lengths may be varied to achieve suitable annealing and melting properties for certain embodiments. Guidance for such design choices is described by TaqMan ™ assay or CATACLEAVE ™, as described in US Pat. Nos. 5,763,181, 6,787,304, and 7,112,422, the contents of which are incorporated herein by reference. It can be found in a number of references.

In certain embodiments, the probe is "substantially complementary" to the target nucleic acid sequence.

As used herein, the term "substantially complementary" refers to two nucleic acid strands having sufficient complementarity of the sequence to anneal and form a stable duplex. Complementarity need not be perfect; For example, there may be a base pair mismatch between two nucleic acids. However, if the number of mismatches is so great that hybridization cannot occur even under the least stringent hybridization conditions, the sequence is not a substantially complementary sequence. When two sequences are referred to herein as being "substantially complementary" it is meant that the sequences have sufficient complementarity to hybridize to each other under the selected reaction conditions. The relationship between nucleic acid complementarity and stringency of hybridization sufficient to achieve specificity is well known in the art. The two substantially complementary strands may be perfectly complementary, for example, or the hybridization conditions may be sufficient to distinguish a pairing sequence from a non-pairing sequence. One to many mismatches can be included. Thus, a "substantially complementary" sequence can mean a sequence having a base pair complementarity of up to 100, 95, 90, 80, 75, 70, 60, 50 percent, or between, in the double-stranded region. .

As used herein, "label" or "detectable label" of a CATACLEAVE probe means a moiety detectable using spectroscopic, photochemical, biochemical, immunochemical, or chemical methods. The detectable label may be an enzyme, an enzyme substrate, a radioactive substance, a fluorescent dye, a chromophore, a chemiluminescent label, an electrochemiluminescent label, a ligand having a specific binding partner, and a ligand that interacts with each other to increase, change or decrease the signal. It may be selected from the group consisting of other markers. The detectable label can survive the thermocycling process of PCR.

The detectable label can be a fluorescence resonance energy transfer (FRET) pair. The detectable label is a FRET pair, the fluorescence donor and the fluorescence receptor are spaced at appropriate intervals so that luminescence of the fluorescence donor is suppressed and luminescence of the fluorescence donor is activated by dissociation caused by cleavage. It may be. That is, in the probe, when the probe is not cleaved, the emission of the fluorescent donor is the emission acceptor emission of the fluorescent receptor by fluorescence resonance energy transfer (FRET) between two chromophores. Quenched by When a donor chromophore is located adjacent to an acceptor chromophore, the donor chromophore, which is in an excited state, can transfer energy to the acceptor chromophore. This transfer is always non-radiative and can occur through dipole-dipole coupling. If the distance between the chromophores is sufficiently increased, the FRET efficiency is lowered and donor chromophore emission can be detected radially.

In one embodiment, the detectable label can be a fluorescent dye compound bound to the probe by covalent or non-covalent bonds.

As used herein, “fluorochrome” refers to a fluorescent compound that emits light when excited by light of a shorter wavelength than emitted light. The term "fluorescent donor or fluorescence donor" means a fluorescent dye that emits light as measured in the assay described in the present invention. More specifically, the fluorescent donor provides the energy absorbed by the fluorescent receptor. The term “fluorescent acceptor or fluorescence acceptor” refers to a second fluorescent dye or quenching molecule that absorbs light emitted from a fluorescent donor. The second fluorescent dye absorbs light emitted from the fluorescent donor and emits light of a longer wavelength than light emitted by the fluorescent donor. The quenching molecule absorbs light emitted by the fluorescent donor.

Any luminescent material, preferably fluorescent and / or fluorescent quenchers such as Alexa Fluor ™ 350, Alexa Fluor ™ 430, Alexa Fluor ™ 488, Alexa Fluor ™ 532, Alexa Fluor ™ 546, Alexa Fluor ™ 568, Alexa Fluor ™ 594, Alexa Fluor ™ 633, Alexa Fluor ™ 647, Alexa Fluor ™ 660, Alexa Fluor ™ 680, 7-diethylaminocoumarin-3-carboxylic acid, Fluorescein, Oregon Green (Oregon Green) 488, Oregon Green 514, Tetramethylhodamine, Rhodamine X, Texas Red Dye, QSY 7, QSY33, Dabcyl, BODIPY FL, BODIPY 630/650, BODIPY 6501665, BODIPY TMR -X, BODIPY TR-X, Dialkylaminocoumarin, Cy5.5, Cy5, Cy3.5, Cy3, DTPA (Eu ³⁺ ) -AMCA and TTHA (Eu ³⁺ ) AMCA can be used in the practice of the present invention have.

In one embodiment, the 3 'terminal nucleotide of the oligonucleotide probe is blocked or impossible to extend by nucleic acid polymerase. Such blocking is conveniently performed by the binding of the reporter or quencher molecule to the 3 'position of the probe.

In one embodiment, the reporter molecule is a derivatized fluorescent organic dye for binding to the 3 'end or 5' end of the probe via a linking moiety. Preferably, the quencher molecule is also an organic dye, which may or may not be fluorescent, in accordance with embodiments of the present invention. For example, in a preferred embodiment of the invention, the quencher molecule is fluorescent. In general, regardless of whether a quencher molecule is fluorescent or emits energy delivered from a reporter by non-radiative decay, the absorption band of the quencher is substantially equivalent to the fluorescence emission band of the reporter molecule. Should be nested into. Non-fluorescent quencher molecules that absorb energy from excited reporter molecules, but do not radiate energy, are referred to herein as chromogenic molecules.

Representative reporter-quencher pairs can be selected from xanthene dyes, including fluorescein and rhodamine dyes. Many suitable forms of these compounds having substituents or their phenyl moieties that can be used as bonding functionality for attachment to a binding site or oligonucleotide are widely commercially available. Another group of fluorescent compounds is naphthylamine, having amino groups in the alpha or beta position. Such naphthylamino compounds include 1-dimethylaminonaphthyl-5-sulfonate, 1-anilino-8-naphthalene sulfonate and 2-p-toudinyl6-naphthalene sulfonate. Other dyes include acridine, such as 3-phenyl-7-isocyanatocoumarin, 9-isothiocyanatoacridine and acridine orange, N- (p- (2-benzoxazolyl) phenyl) maleimide Benzoxadiazoles, stilbenes, pyrenes and the like.

In one embodiment, the reporter and quencher molecules are selected from fluorescein and rhodamine dyes.

As illustrated in the following references, there are a number of linking moieties and methods for binding reporter or quencher molecules to the 5 'or 3' end of an oligonucleotide: Eckstein, editor, Oligonucleotides and Analogues: A Practical Approach (IRL Press, Oxford, 1991); Zuckerman et al., Nucleic Acids Research, 15: 5305-5321 (1987) (3 'thiol groups on oligonucleotides); Sharma et al., Nucleic Acids Research, 19: 3019 (1991) (3 'sulfhydryl); Giusti et al., PCR Methods and Applications, 2: 223-227 (1993) and Fung et al., U.S. Pat. No. 4,757,141 (5 'phosphoamino group via aminolink) TM. II available from Applied Biosystems, Foster City, Calif.) Stabinsky, U.S. Pat. No. 4,739,044 (3 'aminoalkylphosphoryl group); Agrawal et al., Tetrahedron Letters, 31: 1543-1546 (1990) (attachment via phosphoramidate binding); Sproat et al., Nucleic Acids Research, 15: 4837 (1987) (5 'mercapto group); Nelson et al., Nucleic Acids Research, 17: 7187-7194 (1989) (3 ′ amino group); Etc.

Rhodamine and fluorescein dyes may also be conveniently bound to the 5 'hydroxy of the oligonucleotide at the end of solid phase synthesis by a dye derivatized with a phosphoramidite moiety. For example, Woo et al., U.S. Pat. No. 5,231,191; And Hobbs, Jr., U.S. Pat. No. See 4,997,928.

Binding of CATACLEAVE ™ Probes to Solid Supports

In one embodiment, the oligonucleotide probe may be in free form in solution or bound to a solid support. Different probes can be bound to the solid support and used to simultaneously detect different target sequences in the sample. Reporter molecules with different fluorescence wavelengths can be used for different probes to allow hybridization to different probes to be detected individually.

Examples of preferred types of solid supports for immobilization of oligonucleotide probes include controlled pore glass, glass plate, polystyrene, avidin coated polystyrene beads, cellulose, nylon, acrylamide gels and activated dextran, CPG, Glass plates and high cross-linked polystyrene. These solid supports are preferred for hybridization and diagnostic studies because of their chemical stability, ease of functionalization, and well defined surface area. Solid supports such as CPG (500 GPa, 1000 GPa) and non-swelling high crosslinking polystyrene (1000 GPa) are particularly preferred when considering compatibility with oligonucleotide synthesis.

The oligonucleotide probe can be bound to the solid support in a variety of ways. For example, the probe can be bound to the solid support by binding the probe's 3 'or 5' terminal nucleotides to the solid support. However, the probe may be bound to the solid support by a linker that serves to separate the probe from the solid support. The linker is most preferably a length of 30 atoms, more preferably a length of 50 atoms.

Hybridization of probes immobilized on a solid support generally requires that the probe be separated from the solid support by at least 30 atoms, more preferably at least 50 atoms. To achieve this separation, the linker generally comprises a spacer located between the linker and the 3 ′ nucleoside. For oligonucleotide synthesis, a linker arm typically binds to the 3'-OH of the 3 'nucleoside by an ester bond that can be cleaved by a basic reagent to release the oligonucleotide from the solid support. do.

A wide variety of linkers are known in the art that can be used to bind the oligonucleotides to the solid support. The linker may be formed of a compound that does not significantly interfere with the hybridization of the target sequence to the probe bound to the support. The linker may be formed of homopolymer oligonucleotides that can be easily added to the linker by automated synthesis. Alternatively, polymers such as functionalized polyethylene glycols can be used as linkers. Such polymers are preferred over homopolymer oligonucleotides because they do not significantly interfere with hybridization of the probe to the target oligonucleotide. Polyethylene glycol is particularly preferred because it is commercially available, soluble in organic and aqueous media, easy to functionalize, and completely stable under oligonucleotide synthesis and post-synthesis conditions.

The bond between the solid support, the linker and the probe is preferably not cleaved during the removal of the base protecting group under basic conditions at high temperature.

Preferred bonds include carbamate and amide bonds. Immobilization of probes is well known in the art and one skilled in the art can determine immobilization conditions.

According to one embodiment of the method, the CataCleave ™ probe is bound to a solid support. The CataCleave ™ probe comprises a detectable label and a DNA and RNA nucleic acid sequence, the RNA nucleic acid sequence of the probe is complementary to a selected region of the target DNA sequence and the DNA nucleic acid sequence of the probe is adjacent to the selected region of the target DNA sequence Substantially complementary to the DNA sequence. The probe is contacted with a sample of nucleic acid in the presence of RNase H and under conditions such that the RNA sequence in the probe can form an RNA: DNA heteroduplex with a complementary DNA sequence in a PCR fragment. RNase H cleavage of the RNA sequence in the RNA: DNA heteroduplex results in a real-time increase in signal release from the label on the probe, and the increase in signal indicates the presence of polymorphism in the target DNA.

Cleavage by RNase H of Catacleave ™ Probe

RNase H hydrolyzes RNA in RNA-DNA hybrids. After first being identified in the calf thymus, RNase H was subsequently found in various individuals. RNase H activity appears to be ubiquitous in eukaryotes and bacteria. RNase H forms a family of proteins of varying molecular weight and nucleolytic activity, but the substrate requirements appear to be similar for the various isotypes. For example, most of the RNase Hs studied to date function as endonucleases and produce divalent cations (eg, Mg ²⁺ , Mn to produce cleavage products having 5 'phosphate and 3'-hydroxy termini). ²⁺ ).

In prokaryotes, RNase H has been cloned and extensively identified (Crooke, et al., (1995) Biochem J, 312 (Pt 2), 599-608; Lima, et al., (1997) J Biol Chem, 272 , 27513-27516; Lima, et al., (1997) Biochemistry, 36, 390-398; Lima, et al., (1997) J Biol Chem, 272, 18191-18199; Lima, et al., (2007) Mol Pharmacol, 71, 83-91; Lima, et al., (2007) Mol Pharmacol, 71, 73-82; Lima, et al., (2003) J Biol Chem, 278, 14906-14912; Lima, et al , (2003) J Biol Chem, 278, 49860-49867; Itaya, M., Proc. Natl. Acad. Sci. USA, 1990, 87, 8587-8591). For example, E. coli RNase HII is 213 amino acids long and RNase HI is 155 amino acids long. E. coli RNase HII shows only 17% homology with E. coli RNase HI. Salmonella typhimurium The RNase H cloned from (S. typhimurium) is E. coli RNase HI and differ only in length was only 11 locations were composed of 155 amino acids (Itaya, M. and Kondo K., Nucleic Acids Res., 1991, 19, 4443-4449). Proteins showing RNase H activity have also been cloned and purified from a number of viruses, other bacteria and yeasts (Wintersberger, U. Pharmac. Ther., 1990, 48, 259-280). In many cases, a protein with RNase H activity is thought to be a fusion protein in which RNase H is fused to the amino terminus or carboxy terminus of another enzyme, often a DNA or RNA polymerase. The RNase H domain has been consistently identified as having high homology with Escherichia coli RNase HI, but the remaining domains are quite diverse, so the molecular weight and other properties of the fusion protein must be extensive. In higher eukaryotes, two types of RNase H have been defined based on differences in molecular weight, effects of divalent cations, sensitivity to sulfhydryl agonists and immunological cross-reactivity (Busen et al. , Eur. J. Biochem., 1977, 74, 203-208). RNase HI enzymes have a molecular weight ranging from 68-90 kDa and are activated by Mn ²⁺ or Mg ²⁺ and have been reported to be insensitive to sulfhydryl agonists. In contrast, RNase H II enzymes have a molecular weight ranging from 31-45 kDa and require Mg ²⁺ , are very sensitive to sulfhydryl agonists, and have been reported to be inhibited by Mn ²⁺ (Busen, W., and Hausen, P., Eur. J. Biochem., 1975, 52, 179-190; Kane, CM, Biochemistry, 1988, 27, 3187-3196; Busen, W., J. Biol. Chem., 1982, 257, 7106-7108).

Enzymes with RNase HII properties have also been purified from human placenta to near homogeneity levels (Frank et al., Nucleic Acids Res., 1994, 22, 5247-5254). This protein has a molecular weight of about 33 kDa and is active in a pH range of 6.5-10 with an optimal pH of 8.5-9. The enzyme requires Mg ²⁺ and is inhibited by Mn ²⁺ and n-ethyl maleimide. The product of the cleavage reaction has a 3 'hydroxy end and a 5' phosphate end.

Detailed comparisons of RNases from different species are described in Ohtani N, Haruki M, Morikawa M, Kanaya S. J Biosci Bioeng. 1999; 88 (1): 12-9.

Examples of RNase H enzymes that can be used in embodiments are pyrococcus furiosus (Pyrococcus furiosusRNase HII, pyrococcus horikoshi (Pyrococcus horikoshi) RNase HII, Thermococcus litoralis (Thermococcus litoralis) RNase HI, Thermos Thermophilus (Thermus thermophilus) And thermostable RNase H enzymes isolated from thermophilic individuals such as RNase HI.

Other RNase H enzymes that can be used in embodiments are described, for example, in U.S. Patent No. 7,422,888 to Uemori or U.S. Patent Application Publication No. 2009/0325169 to Walder, the contents of which are incorporated herein by reference.

In one embodiment, the RNase H enzyme is 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% homologous to the amino acid sequence of the Pfu RNase HII (SEQ ID NO: 1) enzyme shown below It is a thermostable RNase H having.

MKIGGIDEAG RGPAIGPLVV ATVVVDEKNI EKLRNIGVKD SKQLTPHERK NLFSQITSIA 60

DDYKIVIVSP EEIDNRSGTM NELEVEKFAL ALNSLQIKPA LIYADAADVD ANRFASLIER 120

RLNYKAKIIA EHKADAKYPV VSAASILAKV VRDEEIEKLK KQYGDFGSGY PSDPKTKKWL 180

EEYYKKHNSF PPIVRRTWET VRKIEESIKA KKSQLTLDKF FKKP (SEQ ID NO: 1)

Homology is described, for example, in the computer program DNASIS-Mac (Takara Shuzo), computer algorithm FASTA (version 3.0; Pearson, WR et al., Pro. Natl. Acad. Sci., 85: 2444-2448, 1988 ) Or computer algorithm BLAST (version 2.0, Altschul et al., Nucleic Acids Res. 25: 3389-3402, 1997).

In another embodiment, the RNase H enzyme is a thermostable RNase H having one or more of the homology regions 1-4 corresponding to positions 5-20, 33-44, 132-150, and 158-173 of SEQ ID NO: 1 .

Homologous region 1: GIDEAG RGPAIGPLVV (SEQ ID NO: 19; corresponding to positions 5-20 of SEQ ID NO: 1)

Homologous region 2: LRNIGVKD SKQL (SEQ ID NO: 20; corresponds to positions 33-44 of SEQ ID NO: 1)

Homologous region 3: HKADAKYPV VSAASILAKV (SEQ ID NO: 21; corresponds to positions 132-150 of SEQ ID NO: 1)

Homologous Region 4: KLK KQYGDFGSGY PSD (SEQ ID NO: 22; corresponds to positions 158-173 of SEQ ID NO: 1)

In another embodiment, the RNase H enzyme is 50%, 60% with the polypeptide sequences of SEQ ID NOs: 19, 20, 21, and 22. Thermostable RNase H with one or more of the homology regions having 70%, 80%, 90%, 95% sequence identity.

As used herein, the term "sequence identity" refers to the extent to which sequences are identical, functionally or structurally similar on an amino acid to amino acid basis throughout the window of comparison. Thus, a "percentage of sequence identity" refers to, for example, comparing two optimally aligned sequences throughout a comparison range, determining the number of positions where identical amino acids appear in both sequences, and matching Obtaining the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison range (ie, range size), and multiplying the result by 100 to obtain a percentage of sequence identity Can be calculated by step.

In certain embodiments, the RNase H can be modified to produce a hot start "inducible" RNase H.

As used herein, the term “modified RNase H” may be RNase H that is reversibly coupled or reversibly coupled to an inhibitor that causes a loss of endonuclease activity of RNase H.

Release or decoupling of the inhibitory factor from RNase H restores the endonuclease activity of at least partial or complete RNase H. About 30-100% of the activity of intact RNase H may be sufficient. The inhibitory factor may be a ligand or a chemical modification. The ligand may be an antibody, aptamer, receptor, cofactor, or chelating agent. The ligand can bind to the active site of the RNase H enzyme, thereby inhibiting the enzyme activity or binding to a site away from the active site of the RNase. In some embodiments, the ligand can induce a conformational change. The chemical modification may be crosslinking (eg crosslinking with formaldehyde) or acylation. The release or separation of the inhibitory factor from RNase HII involves heating a sample or mixture comprising coupled RNase HII (inert) to a temperature of at least about 65 ° C. to about 95 ° C., and / or reducing the pH of the mixture or sample to about By lowering to below 7.0.

As used herein, hot start "inducible" RNase H activity refers to the modified RNase H described herein having endonuclease catalytic activity that can be regulated by the binding of a ligand. Under permissive conditions, RNase H endonuclease catalytic activity is activated, but under non-permissive conditions, this catalytic activity is inhibited. In some embodiments, the catalytic activity of the modified RNase H is activated at a temperature suitable for reverse transcription, ie 42 ° C. and at a higher temperature found in the PCR reaction, ie, about 65 ° C. to 95 ° C. Modified RNase H with this property is referred to as "heat inducible".

In another embodiment, the catalytic activity of the modified RNase H can be adjusted by changing the pH of the solution containing the enzyme.

As used herein, a “hot start” enzyme composition is inhibited at a non-acceptable temperature, ie, from about 25 ° C. to about 45 ° C., and suitable for a PCR reaction, eg, from about 55 ° C. to about It means a composition having an enzymatic activity that is activated at 95 ℃. In certain embodiments, a "hot start" enzyme composition may have a 'hot start' RNase H and / or 'hot start' thermostable DNA polymerase, known in the art.

Crosslinking of the RNase H enzyme can be carried out using, for example, formaldehyde. In one embodiment, the thermostable RNase HII is subjected to controlled and limited crosslinking with formaldehyde. By heating the amplification reaction composition comprising the modified RNase HII in an active state for a prolonged time, for example, for about 15 minutes, to a temperature of about 95 ° C. or more, the crosslinking is reversed and the RNase HII activity is restored. .

In general, the lower the degree of crosslinking, the higher the endonuclease activity of the enzyme after reversal of crosslinking. The degree of crosslinking can be controlled by varying the concentration of formaldehyde and the duration of the crosslinking reaction. For example, about 0.2% (w / v), about 0,4% (w / v), about 0.6% (w / v), or about 0.8% (w / v) formaldehyde may be used to form the RNase H enzyme. It can be used to crosslink. A crosslinking reaction of about 10 minutes with 0.6% formaldehyde may be sufficient to inactivate RNase HII from Pyrococcus furiosus.

Crosslinked RNase HII shows no measurable endonuclease activity at about 37 ° C. In some cases, measurable partial reactivation of crosslinked RNase HII may occur at a temperature of about 50 ° C., lower than the PCR denaturation temperature. In order to avoid reactivation of such unintended enzymes, it may be necessary to store or maintain at temperatures below 50 ° C. until the modified RNase HII is reactivated.

In general, PCR requires heating the amplification composition to about 95 ° C. in each cycle to denature the double stranded target sequence, which also releases inactivation factors from RNase H, thus partially or completely activating the enzyme. To recover.

RNase H can also be modified by applying acylation of lysine residues to the enzyme using an acylating agent such as dicarboxylic acid. Acylation of RNase H may be performed by adding cis-aconitic anhydride to a solution of RNase H in acylation buffer and incubating at about 1-20 ° C. for 5-30 hours. In one embodiment, the acylation may be performed at about 3 to 8 ° C. for 18 to 24 hours. The kind of acylation buffer is not specifically limited. In one embodiment, the acylation buffer has a pH of about 7.5 to about 9.0.

The activity of acylated RNase H can be restored by lowering the pH of the amplifying composition to about 7.0 or less. For example, when Tris buffer is used as a buffer, the composition may be heated to about 95 ° C., resulting in a pH drop from about 8.7 (25 ° C.) to about 6.5 (95 ° C.).

The duration of the heating step in the amplification reaction composition can vary depending on the modified RNase H, the buffer used in the PCR, and the like. In general, however, heating the amplification composition to 95 ° C. for about 30 seconds to 4 minutes is sufficient to restore RNase H activity. In one embodiment, using a commercially available buffer, such as Invitrogen AgPath ™ buffer, complete activity of Pyrocoxose Puriosus RNase HII is restored after about 2 minutes of heating.

RNase H activity can be determined using methods well known in the art. For example, according to the first method, unit activity is determined by acid-solubilization of certain moles of radiolabeled polyadenylic acid in the presence of the same molar amount of polythymidylic acid under defined assay conditions. solubilization (see Epicentre Hybridase thermostable RNase HI). In a second method, unit activity is defined as the specific increase in the relative fluorescence intensity of a reaction comprising the same molar amount of probe and complementary template DNA under defined assay conditions.

프로브 보호 올리고뉴클레오티드(probe protector oligonucleotide)Probe protector oligonucleotide

The CATACLEAVE ™ oligonucleotide probes disclosed herein may be single stranded oligonucleotides comprising RNA and DNA sequences, the ends of which may be labeled with FRET pairs comprising fluorescent donors and quencher. Endonucleolytic cleavage of the oligonucleotide probes results in increased isolation of fluorescent donors and fluorescence emission from the quencher.

Thus, spurious cleavage of the CATACLEAVE ™ oligonucleotide probe prior to detection of the target nucleic acid sequence may result in increased levels of background non-specific fluorescence that weakens the overall sensitivity of the assay. Such premature cleavage of CATACLEAVE ™ oligonucleotide probes can have several causes. For example, the sample may be a cell lysate that may have a residual amount of contaminating nuclease capable of cleaving single-stranded RNA or DNA. Single stranded sequences may be vulnerable to pH changes or the presence of free radicals. During the PCR cycle, the RNA moiety of the CATACLEAVE ™ oligonucleotide probe can form a non-specific RNA: DNA heteroduplex that can be cleaved by RNase H in the amplification buffer. Regardless of the root cause, CATACLEAVE ™ oligonucleotide probes are very susceptible to degradation by endonucleases during real time PCR reactions or long term storage.

To counteract these potential problems, the present disclosure is referred to as probe protection oligonucleotides (also referred to throughout this specification as "complementary strand" or "protector" or "probe protector"). Wherein the oligonucleotide is at least partially complementary to an "oligonucleotide probe" (also referred to as a "probe" or "CATACLEAVE ™ probe" throughout this specification). The probe protection oligonucleotides, which can also be modified by methylation, are therefore designed to form base pairs with CATACLEAVE ™ oligonucleotide probes during real time PCR cycling and to “protect” the probes from degradation or non-specific hybridization with DNA sequences. do.

Thus, in a perfectly planned amplification protocol, the single stranded CATACLEAVE ™ oligonucleotide probe is exposed just prior to annealing with the selected target DNA sequence in the amplified PCR fragment to generate an RNA: DNA heteroduplex, the heteroduplex amplifying mixture Can be cleaved by RNase H, resulting in a concomitant increase in fluorescence emission.

The oligonucleotide probe and the probe protection oligonucleotide are represented by Formula I and Formula II, respectively:

R1-X-R2 (Formula I)

R3-X'-R4 (Formula II)

Wherein each R 1 and R 2 is selected from a nucleic acid or a nucleic acid analog, and X is RNA. The X sequence of the probe is complementary to the X ′ sequence of the probe protective oligonucleotide, so that the first probe and the second probe may form base pairs with each other.

In Formulas I and II, one or more of R1, R2, R3, and R4 may be nucleic acids or nucleic acid analogs.

For example, both R1 and R2 can be DNA, R1 is DNA and R2 is RNA, R1 is RNA and R2 is DNA, or both R1 and R2 can be RNA.

For example, both R3 and R4 can be DNA, R3 is DNA and R4 is RNA, R3 is RNA and R4 is DNA, or both R3 and R4 can be RNA.

In one embodiment, X can be at least partially complementary to X '. In another embodiment, X can be completely complementary to X '.

The nucleic acid or nucleic acid analog of R 1, R 2, R 3 and R 4 may be a protected nucleic acid. The nucleic acid and nucleic acid analog can be modified, for example methylated, and thus can be resistant to degradation by enzymes.

The length of the nucleic acid probe can vary depending on the target sequence selected and the PCR conditions.

The melting temperature (Tm) of the oligonucleotide probe to the target nucleic acid sequence may be at least about 50 ° C, at least about 60 ° C, at least about 70 ° C or at least about 80 ° C.

The oligonucleotide probe may be, for example, about 10 to about 200 nt, about 15 to about 200 nt, about 10 to about 60 nt, or about 15 to about 60 nt.

The melting temperature (Tm) of the probe protective oligonucleotide hybridizing with the oligonucleotide probe is, for example, about 5 ° C or about 10 ° C or about 15 ° C or about 20 ° C or higher than the melting temperature (Tm ') of the PCR reaction. It may be about 25 ° C. lower.

For example, the melting temperature (Tm) of the probe protective oligonucleotide hybridizing with the oligonucleotide probe may be about 50 ° C. or less, about 40 ° C. or less, or about 30 ° C. or less.

The melting temperature (Tm) of the probe protective oligonucleotide hybridizing with the oligonucleotide probe is about 5 ° C or 10 ° C or about 15 ° C or about less than the melting temperature (Tm ') of the oligonucleotide probe hybridizing with the target nucleic acid sequence. 20 ° C. or about 25 ° C. lower.

The oligonucleotide probe or probe protecting oligonucleotide may also be modified. For example, one or more bases of the oligonucleotide probe or probe protecting oligonucleotide may be partially or fully methylated. Because of this modification, degradation by enzymes or degradation by other factors can be avoided.

In other embodiments, -OH at the 5 'end and 3' end of the oligonucleotide probe or probe protecting oligonucleotide may be blocked. For example, the -OH at the 3 'end of the oligonucleotide probe or probe protecting oligonucleotide is blocked, thereby making it impossible to extend the primer from the 3' end by template-dependent nucleic acid polymerase.

In certain embodiments, the probe protecting agent may consist of two or more oligonucleotides which may or may not be bound by covalent bonds. Probe protecting agents may have the general structure R1-X-R2, wherein R1 and R2 are DNA sequences and X is an RNA sequence.

In one embodiment, the probe protectant may comprise two or more oligonucleotides, for example, an oligonucleotide comprising an R1-X sequence and an oligonucleotide comprising an R2 sequence. In another embodiment, the probe protectant may comprise an oligonucleotide comprising an R1 sequence and an oligonucleotide comprising an X-R2 sequence. In yet another embodiment, the probe protecting agent may comprise three oligonucleotides having the sequences R1, R2 and X. In other embodiments, the R1, X or R2 sequences can be covalently linked by phosphodiester bonds. In other embodiments, the R1, X or R2 sequences can be linked by non-covalent bonds.

Real-Time Detection of Target Nucleic Acid Sequences Using Protected CATACLEAVE ™ Oligonucleotide Probes

CATACLEAVE ™ oligonucleotide probes are first synthesized with DNA and RNA sequences complementary to the selected target nucleic acid sequence. The probe may be labeled with, for example, a FRET pair, for example, labeled at one end of the probe with a fluorescein molecule, and the remaining end of the probe is labeled with a rhodamine quencher molecule. Can be. The probe can be synthesized to be substantially complementary to the target nucleic acid sequence.

Probe protecting agent molecules substantially complementary to the CATACLEAVE ™ oligonucleotide probe are synthesized. Thus, addition of the probe protection oligonucleotide to a solution of a labeled CATACLEAVE ™ oligonucleotide probe results in the formation of base pairs between the two molecules to form a substantially double stranded hybrid molecule.

The CATACLEAVE ™ oligonucleotide probe and the probe protection oligonucleotide are represented by Formula I and Formula II, respectively:

R1-X-R2 (Formula I)

R3-X'-R4 (Formula II)

Wherein each R 1, R 2, R 3, and R 4 is selected from a nucleic acid or a nucleic acid analog, and X is at least partially hybridized to X ′ in formula II.

The melting temperature (Tm) of the probe protective oligonucleotide to the oligonucleotide probe may be designed to be lower than the melting temperature (Tm ') of the oligonucleotide probe to the target sequence completely complementary to the nucleic acid probe. For example, the melting temperature (Tm ') of the probe protection oligonucleotide to the oligonucleotide probe may be about 10 ° C lower than the melting temperature (Tm) of the oligonucleotide probe to the target nucleic acid sequence.

At room temperature, the probe protecting oligonucleotides hybridize to the CATACLEAVE ™ oligonucleotide probe.

The real-time PCR reagent is then subjected to a target nucleic acid sequence, forward and reverse amplification primers that can anneal the target nucleic acid sequence, protected FRET labeled CATACLEAVE ™ oligonucleotide probes, amplification buffers containing nucleotides, thermostable DNA polymerases. , Reverse transcriptase (if appropriate) and hot start thermostable RNase H are added to a suitable container.

The target polynucleotide is then in the presence of a thermostable nucleic acid polymerase, a thermostable modified RNase H activity, a pair of primers for PCR amplification that can hybridize to the target polynucleotide, and a labeled CataCleave oligonucleotide probe. Perform real time nucleic acid amplification on. For detection of the target RNA sequence, the reaction mix may comprise reverse transcriptase activity for the first cDNA synthesis step as described herein. During real time PCR, by applying the mixture at a temperature above Tm but below Tm ', FRET labeled CATACLEAVE ™ oligonucleotide probes are dissociated from the probe protective oligonucleotides and annealed to the target nucleic acid sequence inside the PCR amplicon To form an RNA: DNA heteroduplex that can be cleaved by RNase H activity. Cleavage of the probe by RNase H results in separation of the fluorescent donor from the fluorescence quencher and results in a real time increase in fluorescence of the probe corresponding to real time detection of the target DNA sequence in the sample.

In certain embodiments, real time nucleic acid amplification enables real time detection of a single target DNA molecule in less than about 40 PCR amplification cycles.

보호된 CATACLEAVE™ 올리고뉴클레오티드 프로브의 저장 Storage of Protected CATACLEAVE ™ Oligonucleotide Probes

Stabilization methods can include storage of protected CATACLEAVE ™ oligonucleotide probes. Storage of the hybrid molecule can be performed at room temperature or below. The storage temperature may be, for example, about 40 ° C. or less, about 30 ° C. or less, about 20 ° C. or less, or about 4 ° C. or less. In another embodiment, the storage temperature may also be about 0 ° C. or less, such as −4 ° C. or −20 ° C. The storage can be maintained for a given period of time. The storage period may be a time longer than 1 day, for example 2 days, 17 days, 30 days, or 1 year. Storage can be performed at alkaline conditions, for example at a pH of about 7.0 to about 8.0. In another embodiment, the storage pH can also be acidic, for example, a pH of about 5.0 to 7.0.

키트Kit

The present disclosure also provides a kit format comprising a package unit having one or more reagents for real-time detection of target nucleic acid sequences in a sample using a protected FRET labeled CATACLEAVE ™ oligonucleotide probe. The kit may also include one or more of the following items: buffers, instructions, and positive or negative controls. The kit may comprise a container of mixed reagents in a suitable proportion for carrying out the methods described herein. The reagent vessel may contain reagents in unit quantities that eliminate the measuring step when performing the method of the present invention.

The kit can also anneal to thermostable polymerases, RNase H, forward and reverse amplification primers, real-time PCR products according to the methods described herein, and FRET labeled CATACLEAVE ™ oligonucleotide probes allowing detection of target nucleic acid sequences. Including but not limited to, it may include a reagent for real-time PCR. In another embodiment, the kit reagent further comprises a reagent for extracting total genomic DNA, total RNA, or polyA ⁺ RNA from the sample. Kit reagents may also include reagents for reverse transcriptase-PCR analysis, where applicable.

Patents, patent applications, documents, or other disclosed materials indicated herein are hereby incorporated by reference in their entirety. Although incorporated herein by reference, materials inconsistent with the existing definitions, statements, or other disclosures described herein, or portions thereof, are included only to the extent that no inconsistencies occur between the included materials and the disclosure of the present application.

Those skilled in the art will understand that the drawings described below are for illustrative purposes only. The drawings are not intended to limit the scope of the teachings in any way.

1 is a schematic of CATACLEAVE ™ probe technology.

2 is a schematic of real-time CATACLEAVE ™ probe detection of PCR amplification products.

3 is a graph showing the results of real-time PCR performed with a reaction mixture containing both protected and unprotected probes.

4A-4C show real-time PCR results after storage of unprotected probes (FIG. 4A) and RNA-comp1 protected probes (FIG. 4B) or RNA-comp2 protected probes (FIG. 4C) at different temperatures for 24 hours. It is a graph showing.

5A-5C show real-time PCR results after storage of unprotected probes (FIG. 5A) and RNA-comp1 protected probes (FIG. 5B) or RNA-comp2 protected probes (FIG. 5C) at different temperatures for 48 hours. It is a graph showing.

6A-6C show unprotected probes and probes protected with RNA-comp1 or RNA-comp2 after storage at −20 ° C. (FIG. 6A), 4 ° C. (FIG. 6B), and 30 ° C. (FIG. 6C) for 17 days. A graph showing real time PCR results.

7A-7C show unprotected probes and probes protected with RNA-comp1 or RNA-comp2 stored at −20 ° C. (FIG. 7A), 4 ° C. (FIG. 7B), and 30 ° C. (FIG. 7C) for 30 days, respectively. This is a graph showing the real-time PCR results.

8 shows the relative intensity change of the fluorescence signal in real time PCR results after the protected probes were stored under different conditions.

9A and 9B show real-time PCR of E. coli 0157: H7 sequences using protected probes (FIG. 9A) and unprotected probes (FIG. 9B) stored at −20 ° C., 4 ° C., and 30 ° C. for 40 days. Show results.

10A and 10B show the results of real-time PCR targeting Salmonella sequences using protected probes (FIG. 10A) and unprotected probes (FIG. 10B), stored at −20 ° C., 4 ° C., and 30 ° C. for 40 days. .

11A and 11B show real-time PCR of a Listeria sequence using a protected probe (FIG. 11A) and an unprotected probe (FIG. 11B) stored at −20 ° C., 4 ° C., and 30 ° C. for 40 days. Show results.

12A and 12B show real-time PCR of E. coli 0157: H7 sequences using protected probes (FIG. 12A) and unprotected probes (FIG. 12B) stored at −20 ° C., 4 ° C., and 30 ° C. for 60 days. Show results.

13A and 13B show the results of real-time PCR targeting Salmonella sequences using protected probes (FIG. 13A) and unprotected probes (FIG. 13B), stored at −20 ° C., 4 ° C., and 30 ° C. for 60 days. .

14A and 14B show the results of real-time PCR targeting E. coli Listeria sequences using protected probes (FIG. 14A) and unprotected probes (FIG. 14B), stored at −20 ° C., 4 ° C., and 30 ° C. for 60 days. Shows.

FIG. 15 is a graph showing the results of real time PCR performed using a reaction mixture comprising protected and unprotected probes and 10 to 10 ⁶ copies of E. coli 0157: H7 as target nucleic acid sequences.

The following examples describe methods of using modified RNase H enzyme compositions according to the present invention. It is understood that the steps of the method described in this example are not intended to be limiting. Additional objects and advantages of the present invention other than those described above will be apparent from embodiments not intended to limit the scope of the present invention.

In the examples and figures, the term "protected probe" or "protected" is also referred to as a probe ("nucleic acid probe" or "oligonucleotide probe" of formula I). Means hydrolyzed to a probe protective oligonucleotide of formula II (also referred to as a protector or complementary strand).

실시예 1: 상보적 RNA에 의한 핵산 프로브의 안정화Example 1 Stabilization of Nucleic Acid Probes by Complementary RNA

In this example, nucleic acid probes having the structure of DNA-RNA-DNA were hybridized with complementary strands comprising sequences complementary to the RNA portion, and the resulting hybridization products were stored under various conditions. This confirmed that the nucleic acid probe was stabilized. The nucleic acid probes and complementary strands used in this example are shown in Table 1.

Table 1

designation	Tm (℃)	Sequence (5 '->3' direction)	SEQ ID NO:
Lmon-probe	65.3	CGAATGTAA ( *C) r* AGACACGGTCTCA	2
RNA-comp1	46.7 *	(ACCGUGUCU G UUACAUU) r	3
RNA-comp2	26.3 *	(CGUGUCU G UU) r	4

In Table 1, Lmon-probe represents a nucleic acid probe specific for the inlA gene of Listeria monocytogenes, and RNA-comp1 and RNA-comp2 are complementary to the RNA portion (X of formula I) of the nucleic acid probe. RNA comprising portion (X ′), and RNA-comp1 and RNA-comp2 have different lengths. In addition, in Table 1, * represents annealing temperature (Tm) when the corresponding RNA binds to a DNA template, and r represents ribonucleic acid. The RNA-comp1 and RNA-comp2 were designed to have a short length such that Tm <50 ° C, and may be hybridized to the probe at a temperature below room temperature, but generally PCR conditions in which annealing and extension reactions have a temperature of about 60 ° C. In the RNA-comp1 and RNA-comp2 can be separated from the nucleic acid probe.

The nucleic acid probe (10 mM) and the RNA-comp1 (10 mM) or RNA-comp2 (10 mM) are mixed in the same volume, incubated at 65 ° C. for 5 minutes, cooled on ice for at least 2 minutes, and the RNA-comp1 or RNA -comp2 was hybridized to the probe. Thereafter, this protected nucleic acid probe, ie, a double stranded nucleic acid probe in which the RNA-comp1 or RNA-comp2 was hybridized, was used as a probe for the PCR reaction. The probes were labeled with FAM at the 5 'end and labeled with the IOWA Black FQ quencher at the 3' end.

The composition and PCR conditions of the PCR mixture are shown in Tables 2 and 3 below.

Table 2: Composition (μl) of PCR mixture for each well

TABLE 2

ingredient	volume
10xICAN	2.5
Forward primer (20 μM)	One
Reverse primer (20 μM)	One
Protected or unprotected probe (5 μM)	One
dNTP / dUTP Mix (2 / 4mM) (Fermentas)	One
Taq polymerase (5 u / μl)	0.5
UNG (10 u / μl)	0.1
pfu RNase HII ((5 u / μl)	0.2
Template DNA ((10 ⁵ copies / μl)	2
water	15.70

In Table 2, the template DNA was plasmid DNA (concentration 1 × 10 ⁵ / μl) comprising Listeria cytomonogenes 23s RNA.

Forward primer: Lmon_C3_F: ACGAGTAACGGGACAAATGC (SEQ ID NO: 5),

Reverse primer: Lmon_C3_R: TCCCTAATCTATCCGCCTGA (SEQ ID NO: 6).

Table 3: PCR conditions

TABLE 3

step	Temperature (℃)	Minutes	Cycle
UNG Incubation
	37	10	One
denaturalization	95	10	One
repeat	95	0.25	50
repeat	60	0.33	50

3 is a graph showing the results of real-time PCR performed with a reaction mixture containing both protected and unprotected probes. According to FIG. 3, it can be seen that the protected probe did not interfere with detecting the target sequence by amplifying the target sequence by PCR or by cleaving the nucleic acid probe by RNase H. These results show that nucleic acid probes, complementary strands, and two primers do not interfere with each other during amplification.

The same reaction conditions were then used to detect E. coli 0157: H7 target DNA sequences by real time PCR. The concentration of E. coli plasmid DNA ranged from 10 copies / reaction to 10 ⁶ copies / reaction. Primers, probes and probe protectors are described in Example 2 below. The results are shown in FIG. 15 suggests that the incorporation of the probe protectant does not affect the sensitivity of the original assay where the probe is not protected for at least the selected target nucleic acid sequence and the tested probe.

4A-4C show real-time PCR results after storage of unprotected probes (FIG. 4A) and RNA-comp1 protected probes (FIG. 4B) or RNA-comp2 protected probes (FIG. 4C) at different temperatures for 24 hours. Shows. All components of the real-time PCR mixture except template DNA were stored in the form of a master mix. In general, higher starting background fluorescence (eg, mean baseline fluorescence intensity for 1 to 22 cycles at room temperature versus −20 ° C. in FIG. 4C) indicates that some CATACLEAVE ™ probes degraded due to RNA hydrolysis. According to FIGS. 4A-4C, the stability of the protected probe was maintained for 24 hours and the protected probe did not interfere with PCR.

5A-5C show real-time PCR results after storage of unprotected probes (FIG. 5A) and RNA-comp1 protected probes (FIG. 5B) or RNA-comp2 protected probes (FIG. 5C) at different temperatures for 48 hours. Shows. All components of the real-time PCR mixture except template DNA were stored in the form of a master mix. According to FIGS. 5A-5C, the stability of the protected probe was maintained for 48 hours and the protected probe did not interfere with PCR.

6A-6C show unprotected Listeria monocytogenes probes and Listeria monocytogenes probes protected with RNA-comp1 or RNA-comp2 for 17 days at −20 ° C. (FIG. 6A), 4 ° C. (FIG. 6B), and Real time PCR results after storage at 30 ° C. (FIG. 6C) are shown. All components of the real-time PCR mixture except template DNA were stored in the form of a master mix. According to FIGS. 6A-6C, the protected probes were relatively stable at −20 ° C. (FIG. 6A) and 4 ° C. (FIG. 6B). However, at room temperature (FIG. 6C), unprotected probes and probes protected with RNA-comp2 were inactivated. The probes protected with RNA-comp1 retained some cleavage activity, but baseline fluorescence (1-20 cycles) was much higher than that observed with unprotected probes at -20 ° C.

7A-7C show unprotected probes and probes protected with RNA-comp1 or RNA-comp2 stored at −20 ° C. (FIG. 7A), 4 ° C. (FIG. 7B), and 30 ° C. (FIG. 7C) for 30 days, respectively. The following real-time PCR results are shown. All components of the real-time PCR mixture except template DNA were stored in the form of a master mix. According to FIGS. 7A-7C, the protected probes were relatively stable at −20 ° C. (FIG. 7A) and 4 ° C. (FIG. 7B). After 30 days at room temperature, all three probes were inactivated (FIG. 7C).

8 shows the relative intensity change of fluorescence signal in real time PCR results after unprotected probes were stored under different conditions. All components of the real-time PCR mixture except template DNA were stored in the form of a master mix. According to FIG. 8, six cycles of freezing and thawing were performed on samples stored at −20 ° C. before use in this example. In FIG. 8, ΔR represents normalized fluorescence intensity. According to FIG. 8, the unprotected probes stored at −20 ° C. were stable even after six cycles of freezing and thawing. However, at elevated temperatures, unprotected probes gradually degraded due to hydrolysis.

실시예 2: 프로브 서열에 따른 보호 효과의 확인Example 2: Confirmation of Protective Effect According to Probe Sequence

In this example, nucleic acid probes specific for Escherichia coli, Salmonella, and Listeria spp. Were protected with corresponding complementary strands and stored, and then the storage effect was confirmed. Primers, probes and complementary strands used are as follows:

Escherichia coli O157: H7 forward primer: AACGAGCTGTATGTCGTGAGAATC (SEQ ID NO: 7)

Escherichia coli O157: H7 reverse primer: ATGGATCATCAAGCTCTAAGAAAGAAC (SEQ ID NO: 8)

E. coli O157: H7 probe: ATAGGCTTrGrArArGCAGTGCAT (SEQ ID NO: 9)

Escherichia coli O157: H7 complementary strand: rCrU rGrCrU rUrCrA rArGrC (SEQ ID NO: 10)

Salmonella Forward Primer: TCG TCA TTC CAT TAC CTA CC (SEQ ID NO: 11)

Salmonella reverse primer: TAC TGA TCG ATA ATG CCA GAC GAA (SEQ ID NO: 12)

Salmonella Probe: CGA TCA GrGrA rArAT CAA CCA G (SEQ ID NO: 13)

Salmonella complementary strand: rGrGrU rUrGrA rUrUrU rCrCrU rGrArU (SEQ ID NO: 14)

Listeria forward primer: TCCAAGCAGTGAGTGTGAGAA (SEQ ID NO: 15)

Listeria reverse primer: TGACAGCGTGAAATCAGGA (SEQ ID NO: 16)

Listeria probe: CCATCACAGCTCArUGCTTCGC (SEQ ID NO: 17)

Listeria complementary strand: rGrArA rGrCrA rUrGrA rGrC (SEQ ID NO: 18)

The composition and conditions of the mixture used for PCR were the same as in Example 1 except that the primers, probes and complementary strands used had different sequences and the template DNA used was different. As the template DNA, plasmid DNA containing the E. coli target sequence, plasmid DNA containing the Salmonella target sequence, and plasmid DNA containing the Listeria target sequence were used.

9A-11B are real time with E. coli-specific, Salmonella-specific, and Listeria-specific unprotected probes and complementary strand protected probes stored at −20 ° C., 4 ° C., and 30 ° C. for 40 days. Show PCR results. All components of the real-time PCR mixture except template DNA were stored in the form of a master mix. According to FIGS. 10 and 11, the protected probes were relatively stable at −20 ° C., 4 ° C., and room temperature. In all cases, protected probes showed much slower degradation kinetics than unprotected probes. These results show that even when the probe sequence changes, the stability of the probe is maintained for a relatively long time over a wide temperature range.

12A-14B are real time with E. coli-specific, Salmonella-specific, and Listeria-specific unprotected probes and complementary strand protected probes stored at −20 ° C., 4 ° C., and 30 ° C. for 60 days Show PCR results. All components of the real-time PCR mixture except template DNA were stored in the form of a master mix. According to FIGS. 12-14, the protected probes were relatively stable at −20 ° C., 4 ° C., and room temperature. In all cases, protected probes showed much slower degradation kinetics than unprotected probes. These results show that even when the probe sequence changes, the stability of the probe is maintained for a relatively long time over a wide temperature range.

The Sequence Listing attached herein is incorporated herein by reference in its entirety.

Claims

A probe protector oligonucleotide having a structure of R3-X'-R4 (Formula II) substantially complementary to an oligonucleotide probe having a structure of R1-X-R2 (Formula I), wherein each R1, R2, R3, and R4 are selected from nucleic acids or nucleic acid analogs and each X and X 'are native RNA or modified RNA, and said oligonucleotide probe nucleic acid sequence is substantially complementary to the target nucleic acid sequence. .
The melting temperature of the probe protective oligonucleotide hybridizing with the oligonucleotide probe, Tm, is lower than the melting temperature of the oligonucleotide probe hybridizing with the target nucleic acid sequence, Tm '. Probe protection oligonucleotides.
The method of claim 2, wherein the melting temperature of the probe protective oligonucleotide hybridizing with the oligonucleotide probe, Tm, is about 10 ° C. lower than the melting temperature of the oligonucleotide probe hybridizing with the target nucleic acid sequence, Tm ′. Probe protection oligonucleotides.
A protected probe comprising the oligonucleotide probe of claim 1 in base pairs with the probe protecting oligonucleotide of claim 1.
A method of stabilizing an oligonucleotide probe, comprising hybridizing the probe protecting oligonucleotide of claim 1 with the oligonucleotide probe of claim 1, wherein the hybridization stabilizes the oligonucleotide probe.
A method of detecting a target DNA sequence in a sample in real time,

Providing a sample comprising a target DNA sequence,

Providing a pair of forward and reverse amplification primers that can anneal to said target DNA sequence,

Providing a protected probe comprising a labeled oligonucleotide probe paired with a protected probe oligonucleotide, wherein the oligonucleotide probe comprises an RNA and DNA nucleic acid sequence substantially complementary to the target DNA sequence. To do,

In the presence of amplification polymerase activity, amplification buffer, and RNaseH activity and protected probes, the oligonucleotide probe can be dissociated from the protected probe oligonucleotide and the RNA sequence of the oligonucleotide probe is present in a PCR fragment. Amplifying the PCR fragment between the forward and reverse amplification primers under conditions capable of forming a target DNA sequence and an RNA: DNA heteroduplex, and

Detecting a real-time increase in the emission of the signal from the label on the oligonucleotide probe,

The increase in signal is indicative of the presence of the target DNA sequence in the sample.
7. The labeled probe of claim 6 wherein the protected probe has a structure of R1-X-R2 (Formula I) base-paired with a probe protection oligonucleotide having a structure of Formula R3-X'-R4 (Formula II). As an oligonucleotide probe, each of R 1, R 2, R 3, and R 4 is selected from a nucleic acid or a nucleic acid analog and each X and X ′ are native RNA or modified RNA, and the probe protecting oligonucleotide is substantially linked to the oligonucleotide. And complementary labeled oligonucleotide probes.
8. The method of claim 7, wherein the melting temperature of the probe protective oligonucleotide hybridizing with the oligonucleotide probe, Tm, is lower than the melting temperature of the oligonucleotide probe hybridizing with the target nucleic acid sequence, Tm '.
The method of claim 8, wherein the melting temperature of the probe protective oligonucleotide hybridizing with the oligonucleotide probe, Tm, is about 10 ° C. lower than the melting temperature of the oligonucleotide probe hybridizing with the target nucleic acid sequence, Tm ′. Way.
The method of claim 6, wherein the real-time increase in signal release from the label on the oligonucleotide probe is derived from cleavage by RNase H of a heteroduplex formed between the oligonucleotide probe and one of the strands of the PCR fragment.
The target DNA sequence and RNA: DNA hetero of claim 10, wherein the amplifying step allows the oligonucleotide probe to be dissociated from the protected probe oligonucleotide and wherein the RNA sequence of the oligonucleotide probe is present in the PCR fragment. The process occurs under conditions capable of forming a duplex.
The method of claim 6, wherein the oligonucleotide probe is labeled with a fluorescence resonance energy transfer (FRET) pair comprising a fluorescence donor and a fluorescence acceptor.
For real-time detection of a target nucleic acid sequence in a sample comprising a probe protective oligonucleotide having a structure of R3-X'-R4 (Formula II) and an oligonucleotide probe having a structure of R1-X-R2 (Formula I) As a kit,

Said probe protective oligonucleotide is substantially complementary to an oligonucleotide probe, each of R 1, R 2, R 3, and R 4 is selected from a nucleic acid or a nucleic acid analog, each X and X ′ are native RNA or modified RNA, and

Wherein said oligonucleotide probe nucleic acid sequence is substantially complementary to a target nucleic acid sequence.
The kit of claim 13, wherein the melting temperature, Tm, of the probe protective oligonucleotide hybridizing with the oligonucleotide probe is lower than the melting temperature, Tm ′, of the oligonucleotide probe hybridizing with the target nucleic acid sequence.
The method of claim 14, wherein the melting temperature of the probe protective oligonucleotide hybridizing with the oligonucleotide probe, Tm, is about 10 ° C. lower than the melting temperature of the oligonucleotide probe hybridizing with the target nucleic acid sequence, Tm '. Kit.
The kit of claim 13, further comprising a positive internal control and a negative control.
The kit of claim 13, wherein the probe is labeled with a FRET pair.
The kit of claim 13, wherein the kit further comprises an amplifying polymerase activity.
The kit of claim 13, wherein the kit further comprises reverse transcriptional activity for reverse transcription of the target RNA sequence to generate the target cDNA sequence.
The kit of claim 13, wherein the kit further comprises RNase H activity.