Classifications

• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
  • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
  • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
  • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
  • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
  • G01N33/57407—Specifically defined cancers
  • G01N33/5743—Specifically defined cancers of skin, e.g. melanoma

Definitions

• the invention relates to approaches and methods useful for the assessment, characterization and treatment of melanoma, based upon the presence or absence of mutations in the Ras GTPase-Activating Protein (RASA2) gene.
• RASA2 Ras GTPase-Activating Protein
• kinases 6 most clinically approved drugs that target genetically altered proteins in cancer are towards kinases 6 .
• a majority of the proteins mutated in cancer are tumor suppressors which cannot be re-activated by small molecules. As drugs usually interfere with protein function, these drivers cannot be targeted.
• a possible solution is exploiting the fact that tumor suppressor gene inactivation may result in the activation of a downstream growth signal pathway. For example, PTEN mutations lead to increased activity of the downstream kinase AKT .
• a method of diagnosing melanoma in a subject in need thereof comprising analyzing Ras GTPase-Activating Protein (RASA2) or a gene encoding said RASA2 in a sample of the subject, wherein a decrease in the amount and/or activity of said RASA2 beyond a predetermined level with respect to a control sample of a healthy subject or the presence of a RASA2 mutation is indicative of a subject having melanoma.
• RASA2 Ras GTPase-Activating Protein
• a method of determining the probability of survival of a subject having melanoma comprising analyzing RASA2 or a gene encoding said RASA2 in a sample of the subject, wherein a decrease in the amount and/or activity of said RASA2 beyond a predetermined level with respect to a control sample of a healthy subject or the presence of a RASA2 mutation is indicative of the probability of survival.
• a method of determining a treatment course of a subject afflicted with or suspected to be afflicted with melanoma comprising analyzing RASA2 or a gene encoding said RASA2 in a sample of the subject, wherein an amount and/or activity of said RASA2, or the presence or absence of a RASA2 mutation is indicative of the treatment course.
• step (b) selecting a treatment course for the subject based on the results of step (a), thereby treating melanoma in the subject.
• a method of treating melanoma in a subject in need thereof comprising administering to the subject a polynucleotide agent which encodes RASA2, thereby treating melanoma in the subject.
• the sample comprises a tumor sample.
• the sample comprises a skin sample.
• the analyzing is effected on the protein level.
• the analyzing is effected by immunohistochemistry. According to some embodiments of the invention, the analyzing is effected on the RNA level.
• the analyzing is effected on the gene level.
• the method further comprises amplifying nucleic acid obtained from the sample prior to said analyzing.
• the analyzing is effected using any of the primer pairs as set forth in Table 1.
• the method further comprises performing an additional test so as to corroborate the results of the analyzing.
• the mutation is selected from the group consisting of a frameshift mutation, a nonsense mutation and a mis sense mutation.
• the mutation is selected from the group consisting of S82F, P96L, C180 frameshift (Fs), H181L, L199Fs, G201S, P219L, I248Fs, L291P, R310* (codon stop), R355*, P363A, K387*, R397K, S400F, D496N, R511C, P530S, S590P, E608K, L764F, G780*, P796S, P843S and G846E.
• the method further comprises determining if the sample contains a mutation in a gene selected from the group consisting of BRAF, NRAS and NF1.
• the method further comprises determining if the sample contains a mutation in the NF1 gene.
• the treatment course comprises a RAS pathway inhibitor or an agent which up-regulates an amount and/or activity of RASA2.
• the treatment course comprises a RAS pathway inhibitor or an agent which up-regulates an amount and/or activity of RASA2.
• the RAS pathway inhibitor comprises a MEK inhibitor.
• the MEK inhibitor is a small molecule or a MEK neutralizing antibody.
• the MEK inhibitor is selected from the group consisting of Trametinib, cobimetinib, pimasertib, and MEK- 162.
• the RAS pathway inhibitor comprises an ERK inhibitor.
• the RAS pathway inhibitor comprises a B-RAF inhibitor.
• the B-RAF inhibitor comprises Vemurafenib or Dabrafenib.
• FIGs. 1A-G describe the effects of RASA2 mutations on RAS activity, growth and patient survival.
• A Human RASA2 protein, conserved domains indicated as blocks: C2 domain first repeat (C2 1); C2 domain second repeat (C2 2); Ras-GTPase activating domain (RAS -GAP); Plekstrin homology domain (PH); Bruton's tyrosine kinase Cys-rich motif (BTK).
• C Immunoblot of RAS-GTP levels in (i) 501Mel cells expressing the indicated constructs, (ii) 501Mel cells and (iii) 108T cells depleted for RASA2 using siRNA. RAS-GTP levels were assessed by RAS pull-down assay and the RAS- GTP/RAS ratio was calculated and normalized to the vector control (lower panel).
• FIG. 2 is a graph summarizing non- synonymous mutations in RASA2 across different tumor types from COSMIC. NS: not specified.
• FIG. 3 is photograph illustrating expression of the different RASA2 forms in different melanoma cells. Detection of RASA2 protein expression by immunoblot analysis in A375, 108T and 501Mel melanoma cells stably infected with an empty vector, human WT RASA2, the truncated mutant RASA2 (R310X) or the mutant RASA2 (S400F). Lysates from the different clones were immunoblotted with FLAG antibody. The lysates were analyzed in parallel using anti-GAPDH for normalization.
• FIGs. 4A-B illustrate that RASA2 mutations and RNAi-mediated suppression of RASA2 result in the activation of RAS.
• Immunoblot of RAS-GTP levels in A) 108T cells expressing the indicated constructs.
• (B) A375 cells depleted for RASA2 using siRNA.
• RAS-GTP levels were assessed by RAS pull-down assay. The RAS-GTP/RAS ratio was calculated and normalized to the control in the right panels.
• FIGs. 5A-B illustrate the effects of RASA2 mutations on cell growth (A) Somatic alterations in RASA2 cause increased proliferation in reduced serum.
• A375, 501Mel or 108T pooled clones expressing wild-type, R310X, S400F or vector alone RASA2 were seeded in complete normal (10% FBS) or low serum (2.5% or 5% FBS) in 96-well plates and incubated over a 7-17 day period. Plates were harvested and analyzed by SYBR Green I. Error bars, standard deviation (S.D). (B) Somatic alterations in RASA2 cause increased anchorage independent growth.
• Anchorage- independent proliferation of A375 (left) and 501Mel (right) pooled RASA2 clones expressing wild-type, R310X, S400F or vector alone were assessed in complete normal (10% FBS) or low serum (5% FBS) by measuring colony formation in soft agar. Graph indicates the mean number of colonies + S.D observed after 7 days of growth. Students i-tests in all instances showed a **P ⁇ 0.005.
• FIG. 6 illustrates that RASA2 mutations increase migration in vitro.
• A375, 501Mel and 108T pooled clones expressing mutant RASA2 R310X or S400F show increased cell migration compared to cells expressing wild type RASA2.
• FIGs. 7A-B illustrate that RASA2 expression is lost / low in melanoma patients and low RASA2 expression is associated with reduced overall survival.
• A Metastatic melanoma immunohistochemical images staining for RASA2: (a) negative, (b) weak, (c) strong.
• B RASA2 immunohistochemistry (IHC) performed on different melanoma tumor microarrays (TMAs). There is a negative survival effect of RASA2 loss. This expression profiling was generated for optimal calculation of survival effects with balanced good, moderate and bad outcome patients.
• FIG. 8 is a graph illustrating the copy number status (CNS) in RASA2 as identified by CHAS software in three melanoma samples. Arrows indicate loss. Copy number is represented on the y-axis and chromosomal position on the x-axis.
• FIGs. 9A-C illustrate that RASA2 acts as a tumor suppressor in NIH3T3 cells.
• A NIH3T3 cells were infected with lentiviral shRNAs that target RASA2 or control and were assessed by RAS pull-down assay. The RAS-GTP/RAS ratio of two independent experiments was calculated and normalized in the right panel. Error bars, standard deviation (S.D).
• B RASA2 knockdown increases proliferation.
• NIH3T3 cells were infected with lentiviral shRNAs that target RASA2, or control and were seeded in 96-well plates and incubated over a 10 day period. Plates were harvested and average cell number at each time point was measured by assessing DNA content using SYBR Green I. Error bars, standard deviation (S.D).
• C RASA2 knockdown increased anchorage independent growth. Anchorage-independent proliferation of NIH3T3 pooled RASA2 clones infected with lentiviral shRNAs that target RASA2 or control were assessed by measuring colony formation in soft agar. Graph indicates the mean number of colonies + S.D observed after 7 days of growth. Students i-tests in all instances showed a ***P ⁇ 0.00015.
• FIGs. lOA-C are pictures of a 3D Ras-RASA2 model.
• Helices a6c and a7c, and loops Lie and L6c of RASA2 are colored in orange, magenta, red and blue, respectively.
• Wild-type RASA2 interacts with RAS via helices a6c (residues 498-518), a7c (residues 532-550), and loops Lie (residues 388-401) and L6c (residues 551-561), and stabilizes NRAS Switch I and Switch II regions (residues 44- 54, and 74-84, respectively).
• S400 is located at the end of Lie loop and establishes an H-bond interaction with D385 in helix ale.
• C Zoom-in on F400 in the point mutated RASA2.
• FIG. 11 illustrates that wild-type but not mutant RASA2 inhibits Ras activation.
• RAS-GTP levels were assessed by RAS pull-down assay.
• the RAS-GTP/RAS ratio of two independent experiments were calculated and normalized in the lower panel. Error bars, standard deviation (S.D).
• FIGs. 12A-C are graphs illustrating the effects of wild-type and mutant RASA2 on cell growth.
• A-B 76T or C084 pooled clones expressing wild-type RASA2 or vector alone were seeded in low serum (2.5% FBS) in 96-well plates and incubated over a 15-17 day period. Plates were harvested and average cell number at each time point was measured by assessing DNA content using SYBR Green I. Error bars, standard deviation (S.D).
• the invention relates to approaches and methods useful for the assessment, characterization and treatment of melanoma, based upon the presence or absence of mutations in the Ras GTPase-Activating Protein (RASA2) gene.
• RASA2 Ras GTPase-Activating Protein
• R310X which causes RASA2 truncation
• S400F catalytic RAS-GAP domain
• Stable pooled clones expressing vector control, WT or mutant (R310X and S400F) RASA2 were established.
• Overexpression of WT RASA2 substantially suppressed RAS-GTP levels; in contrast both RASA2 mutants increased RAS-GTP levels ( Figure ICi and Figure 4A).
• RNA interference (RNAi)-mediated suppression of RASA2 lead to the activation of RAS ( Figure ICii, ICiii and Figure 4B).
• a method of diagnosing melanoma in a subject in need thereof comprising analyzing Ras GTPase- Activating Protein (RASA2) or a gene encoding said RASA2 in a sample of the subject, wherein a decrease in the amount and/or activity of said RASA2 beyond a predetermined level with respect to a control sample of a healthy subject or the presence of a mutation in the gene encoding the RASA2 is indicative of a subject having melanoma.
• RASA2 Ras GTPase- Activating Protein
• melanoma refers to a cancer of the skin in which malignant melanocytes are involved.
• the melanoma may be at any stage e.g. IA, IB, IIA, IIB, IIC, IIIA, IIIB, IIIC and IV.
• diagnosis refers to classifying a melanoma, determining a severity of melanoma (grade or stage), monitoring melanoma progression, forecasting an outcome of the melanoma and/or prospects of recovery.
• the subject may be a healthy subject (e.g., human) undergoing a routine well- being check up.
• the subject may be at risk of having melanoma (e.g., a genetically predisposed subject, a subject with medical and/or family history of cancer, a subject who has been exposed to carcinogens, occupational hazard, environmental hazard) and/or a subject who exhibits suspicious clinical signs of melanoma (e.g., a change in the appearance of a mole).
• Ras GTPase-Activating Protein RASA2; Swiss prot No. Q15283, SEQ ID NO: 49 refers to the protein encoded by the RASA2 gene.
• This protein is member of the GAP1 family of GTPase-activating proteins.
• the protein stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation.
• Human RASA2 cDNA is set forth in NM_006506 (SEQ ID NO: 50).
• the sample which is analyzed typically comprises melanocytes and may be obtained for example by taking a skin cell biopsy (surgical biopsy including incisional or excisional biopsy, fine needle aspirates and the like). Methods of biopsy retrieval are well known in the art.
• the cell sample may comprise cells of the primary tumor and/or metastatic effusion thereof.
• the cell sample may be a peripheral blood sample, lymph sample. Single cells may be used in accordance with the teachings of the present invention as well as a plurality of cells.
• control sample which is used for the sake of comparison also comprises melanocytes and is typically obtained from a healthy subject (or at least one not having a melanoma) or from the same subject prior to the onset of the cancer. It is preferable that the non-cancerous control sample come from a subject of the same species and age and from the same sub-population (e.g. smoker/nonsmoker). Alternatively, control data may be taken from databases and literature. It will be appreciated that the control sample may also be taken from the diseased subject at a particular time-point, in order to analyze the progression of the disease.
• Measuring the amount and/or activity of RASA2 may be effected on the protein and/or RNA level.
• polynucleotide probes e.g. oligonucleotides or primers
• RASA2 RNA or cDNA generated therefrom typically polynucleotide probes (e.g. oligonucleotides or primers) are used that are capable of specifically hybridizing with RASA2 RNA or cDNA generated therefrom.
• the oligonucleotide probes and primers utilized by the various hybridization techniques described hereinabove are capable of hybridizing to the RASA2 under stringent hybridization conditions.
• hybridization of short nucleic acids (below 200 bp in length, e.g.
• the polynucleotide probe/primer hybridizes with RASA2 at a nucleic acid sequence which is shared by the two isoforms.
• RNA sample is denatured by treatment with an agent (e.g., formaldehyde) that prevents hydrogen bonding between base pairs, ensuring that all the RNA molecules have an unfolded, linear conformation.
• agent e.g., formaldehyde
• the individual RNA molecules are then separated according to size by gel electrophoresis and transferred to a nitrocellulose or a nylon-based membrane to which the denatured RNAs adhere.
• the membrane is then exposed to labeled DNA probes.
• Probes may be labeled using radio-isotopes or enzyme linked nucleotides. Detection may be using autoradiography, colorimetric reaction or chemiluminescence. This method allows both quantitation of an amount of particular RNA molecules and determination of its identity by a relative position on the membrane which is indicative of a migration distance in the gel during electrophoresis.
• RNA molecules are purified from the cells and converted into complementary DNA (cDNA) using a reverse transcriptase enzyme (such as an MMLV-RT) and primers such as, oligo dT, random hexamers or gene specific primers. Then by applying gene specific primers and Taq DNA polymerase, a PCR amplification reaction is carried out in a PCR machine.
• a reverse transcriptase enzyme such as an MMLV-RT
• primers such as, oligo dT, random hexamers or gene specific primers.
• a PCR amplification reaction is carried out in a PCR machine.
• Those of skills in the art are capable of selecting the length and sequence of the gene specific primers and the PCR conditions (i.e., annealing temperatures, number of cycles and the like) which are suitable for detecting specific RNA molecules. It will be appreciated that a semi-quantitative RT- PCR reaction can be employed by adjusting the number of PCR cycles and comparing the a
• RNA in situ hybridization stain DNA or RNA probes are attached to the RNA molecules present in the cells.
• the cells are first fixed to microscopic slides to preserve the cellular structure and to prevent the RNA molecules from being degraded and then are subjected to hybridization buffer containing the labeled probe.
• the hybridization buffer includes reagents such as formamide and salts (e.g., sodium chloride and sodium citrate) which enable specific hybridization of the DNA or RNA probes with their target mRNA molecules in situ while avoiding nonspecific binding of probe.
• formamide and salts e.g., sodium chloride and sodium citrate
• any unbound probe is washed off and the slide is subjected to either a photographic emulsion which reveals signals generated using radio-labeled probes or to a colorimetric reaction which reveals signals generated using enzyme-linked labeled probes.
• Oligonucleotide microarray In this method oligonucleotide probes capable of specifically hybridizing with the polynucleotides of the present invention are attached to a solid surface (e.g., a glass wafer). Each oligonucleotide probe is of approximately 20- 25 nucleic acids in length.
• a specific cell sample e.g., blood cells
• RNA is extracted from the cell sample using methods known in the art (using e.g., a TRIZOL solution, Gibco BRL, USA).
• Hybridization can take place using either labeled oligonucleotide probes (e.g., 5'-biotinylated probes) or labeled fragments of complementary DNA (cDNA) or RNA (cRNA).
• labeled oligonucleotide probes e.g., 5'-biotinylated probes
• cDNA complementary DNA
• cRNA RNA
• double stranded cDNA is prepared from the RNA using reverse transcriptase (RT) (e.g., Superscript II RT), DNA ligase and DNA polymerase I, all according to manufacturer's instructions (Invitrogen Life Technologies, Frederick, MD, USA).
• RT reverse transcriptase
• DNA ligase DNA polymerase I
• the double stranded cDNA is subjected to an in vitro transcription reaction in the presence of biotinylated nucleotides using e.g., the BioArray High Yield RNA Transcript Labeling Kit (Enzo, Diagnostics, Affymetix Santa Clara CA).
• the labeled cRNA can be fragmented by incubating the RNA in 40 mM Tris Acetate (pH 8.1), 100 mM potassium acetate and 30 mM magnesium acetate for 35 minutes at 94 °C.
• the microarray is washed and the hybridization signal is scanned using a confocal laser fluorescence scanner which measures fluorescence intensity emitted by the labeled cRNA bound to the probe arrays.
• each gene on the array is represented by a series of different oligonucleotide probes, of which, each probe pair consists of a perfect match oligonucleotide and a mismatch oligonucleotide. While the perfect match probe has a sequence exactly complimentary to the particular gene, thus enabling the measurement of the level of expression of the particular gene, the mismatch probe differs from the perfect match probe by a single base substitution at the center base position.
• the hybridization signal is scanned using the Agilent scanner, and the Microarray Suite software subtracts the non-specific signal resulting from the mismatch probe from the signal resulting from the perfect match probe.
• Determining expression of RASA2on the protein level is typically effected using an antibody capable of specifically interacting with RASA2. Since RASA2 is an intracellular protein, preferably efforts are undertaken to allow for the antibody to permeabilize the membrane, when whole cells (and not cell extracts) are used.
• Methods of detecting RASA2 include immunoassays which include but are not limited to competitive and non-competitive assay systems using techniques such as Western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, and immunoprecipitation assays and immunohistochemical assays as detailed herein below.
• Enzyme linked immunosorbent assay This method involves fixation of a sample (e.g., fixed cells or a proteinaceous solution) containing a protein substrate to a surface such as a well of a microtiter plate. A substrate specific antibody coupled to an enzyme is applied and allowed to bind to the substrate. Presence of the antibody is then detected and quantitated by a colorimetric reaction employing the enzyme coupled to the antibody. Enzymes commonly employed in this method include horseradish peroxidase and alkaline phosphatase. If well calibrated and within the linear range of response, the amount of substrate present in the sample is proportional to the amount of color produced. A substrate standard is generally employed to improve quantitative accuracy.
• Western blot This method involves separation of a substrate from other protein by means of an acrylamide gel followed by transfer of the substrate to a membrane (e.g., nylon or PVDF). Presence of the substrate is then detected by antibodies specific to the substrate, which are in turn detected by antibody binding reagents.
• Antibody binding reagents may be, for example, protein A, or other antibodies. Antibody binding reagents may be radiolabeled or enzyme linked as described hereinabove. Detection may be by autoradiography, colorimetric reaction or chemiluminescence. This method allows both quantitation of an amount of substrate and determination of its identity by a relative position on the membrane which is indicative of a migration distance in the acrylamide gel during electrophoresis.
• Radio-immunoassay In one version, this method involves precipitation of the desired protein (i.e., the substrate) with a specific antibody and radiolabeled antibody binding protein (e.g., protein A labeled with I 125 ) immobilized on a precipitable carrier such as agarose beads. The number of counts in the precipitated pellet is proportional to the amount of substrate.
• a specific antibody and radiolabeled antibody binding protein e.g., protein A labeled with I 125
• a labeled substrate and an unlabelled antibody binding protein are employed.
• a sample containing an unknown amount of substrate is added in varying amounts.
• the decrease in precipitated counts from the labeled substrate is proportional to the amount of substrate in the added sample.
• Fluorescence activated cell sorting This method involves detection of a substrate in situ in cells by substrate specific antibodies.
• the substrate specific antibodies are linked to fluorophores. Detection is by means of a cell sorting machine which reads the wavelength of light emitted from each cell as it passes through a light beam. This method may employ two or more antibodies simultaneously.
• Immunohistochemical analysis This method involves detection of a substrate in situ in fixed cells by substrate specific antibodies.
• the substrate specific antibodies may be enzyme linked or linked to fluorophores. Detection is by microscopy and subjective or automatic evaluation. If enzyme linked antibodies are employed, a colorimetric reaction may be required. It will be appreciated that immunohistochemistry is often followed by counterstaining of the cell nuclei using for example Hematoxyline or Giemsa stain.
• In situ activity assay According to this method, a chromogenic substrate is applied on the cells containing an active enzyme and the enzyme catalyzes a reaction in which the substrate is decomposed to produce a chromogenic product visible by a light or a fluorescent microscope. It will be appreciated that the method of the present invention may also be performed by measuring an activity of RASA2 (via its activation of RAS, using kits known in the art).
• the diagnosis is carried out by analyzing an amount or activity of RASA2 in a cell sample of the subject, wherein a decrease in an amount or activity of RASA2 beyond a predetermined threshold with respect to a control cell sample is indicative of the disease.
• the present inventors have shown that the expression level of RASA2 correlates with the progression of the disease. Thus, low expression levels indicate a later stage of the disease with a poorer prognosis, whereas high expression levels indicate an early stage of the disease with a better prognosis.
• the decrease in expression and/or activity of RASA2 is statistically significant.
• the difference is at least 10 %, 20 %, 30 %, 40 %, 50 %, 80 %, 100 % (i.e., two-fold), 3 fold, 5 fold or 10 fold different as compared to the control cells.
• RASA2 may also be analyzed for the presence or absence of mutations. Mutations in the RASA2 gene (and/or protein) as compared to the wild type gene are indicative that the subject may have melanoma.
• the protein or gene may have one mutation, or a plurality of mutations.
• the mutant RASA2 polypeptides may include, but are not limited to, allelic valiants, splice variants, derivative variants, substitution variants, deletion valiants, and/or insertion variants, fusion polypeptides, orthologs, and interspecies homologs.
• a mutant RASA2 polypeptide includes additional residues at the C- or N-terminus, such as, but not limited to, leader sequence residues, targeting residues, amino terminal methionine residues, lysine residues, tag residues and/or fusion protein residues.
• the mutations may be frameshift mutation, a nonsense mutation or a missense mutation.
• mutant RASA2 include polypeptides or gene encoding a polypeptide in which part of all of the polypeptide or gene encoding the polypeptide is deleted or absent from the cell.
• a RASA2 protein may be produced by a cell in a truncated form.
• a deletion may mean the absence of all or part of a gene or protein encoded by a gene.
• the mutation is selected from the group consisting of S82F, P96L, C180 frameshift (Fs), H181L, L199Fs, G201S, P219L, I248Fs, L291P, R310* (codon stop), R355*, P363A, K387*, R397K, S400F, D496N, R511C, P530S, S590P, E608K, L764F, G780*, P796S, P843S and G846E.
• wild type refers to a polypeptide or polynucleotide sequence that occurs in a native population without genetic modification.
• a “mutant” includes a polypeptide or polynucleotide sequence having at least one modification to an amino acid or nucleic acid compared to the corresponding amino acid or nucleic acid found in a wild type polypeptide or polynucleotide, respectively. Included in the term mutant is Single Nucleotide Polymorphism (SNP) where a single base pair distinction exists in the sequence of a nucleic acid strand compared to the most prevalently found (wild type) nucleic acid strand.
• SNP Single Nucleotide Polymorphism
• genotyping a ceil including a tumor cell from a subject (or DNA or other biological sample) for a mutation or a polymorphic allele of a gene(s) means detecting which allelic or polymorphic form(s) and/or wild type or somatically mutated form(s) of the gene(s) or gene expression products (e.g., hnRNA, mRNA or protein) are present or absent in a subject (or a sample).
• gene expression products e.g., hnRNA, mRNA or protein
• Related RNA or protein expressed from suc gene may also be used to detect polymorphic variation.
• “genotyping” includes the determination of somatic as well as genotypic mutations from a sample.
• an allele may be 'detected' when other possible allelic variants have been ruled out; e.g., where a specified nucleic acid position is found to be neither adenine (A), thymine (T) or cytosine (C), it can be concluded that guanine (G) is present at that position (i.e., G is 'detected' or 'diagnosed' in a subject). Sequence variations may be detected directly (by, e.g.
• sequencing for example, EST sequencing or partial or full genome sequencing
• indirectly e.g., by restriction fragment length polymorphism analysis, or detection of the hybridization of a probe of known sequence, or reference strand conformation polymorphism, or by using other known methods.
• At least one mutation in a polypeptide or a gene encoding a polypeptide refers to a polypeptide or gene encoding a polypeptide having one or more allelic variants, splice variants, derivative variants, substitution variants, deletion variants, truncation variants, and/or insertion variants, fusion polypeptides, orthologs, and/or interspecies homo logs.
• at least one mutation of RASA2 protein would include a RASA2 protein in which part of all of the sequence of a polypeptide or gene encoding the RASA2 protein is absent or not expressed in the cell for at least one RASA2 protein produced in the cell.
• a RASA2 protein may be produced by a cell in a truncated form and the sequence of the truncated form may be wild type over the sequence of the truncate.
• a deletion may mean the absence of ail or part of a gene or protein encoded by a gene.
• some of a protein expressed in or encoded by a cell may be mutated while other copies of the same protein produced in the same cell may be wild type.
• a mutation in a RASA2 protein would include a RASA2 protein having one or more amino acid differences in its amino acid sequence compared with wild type of the same RASA2 protein.
• polypeptide As used herein "genetic abnormality” is meant a deletion, substitution, addition, translocation, amplification and the like relative to the normal native nucleic acid content of a ceil of a subject.
• polypeptide and “protein” are used interchangeably and are used herein as a generic term to refer to native protein, fragments, peptides, or analogs of a polypeptide sequence. Hence, native protein, fragments, and analogs are species of the polypeptide genus.
• X#Y in the context of a mutation in a polypeptide sequence is art-recognized, where "#” indicates the location of the mutation in terms of the amino acid number of the polypeptide, "X” indicates the amino acid found at that position in the wild-type amino acid sequence, and "Y” indicates the mutant amino acid at that position.
• the notation "S4G0F” with reference to the RASA2 indicates that there is a serine at amino acid number 400 of the wild-type RASA2 sequence, and that serine is replaced with a phenylalanine in the mutant RASA2 sequence.
• R310X indicates that there is an arginine at amino acid number 310 of the wild type RASA2 sequence, and that arginine is replaced by a codon stop that gives rise to a truncated R AS A2 protein.
• the term "amplification” refers to the presence of one or more extra gene copies in a chromosome complement.
• the gene encoding R S A2 protein may be amplified in a cell.
• the sequence of any nucleic acid including a gene or PCR product or a fragment or portion thereof may be sequenced by any method known in the art (e.g., chemical sequencing or enzymatic sequencing).
• “Chemical sequencing” of DNA may denote methods such as that of Maxam and Gilbert (1977) (Proc. Natl. Acad. Sci. USA 74:560), in which DNA is randomly cleaved using individual base-specific reactions.
• Enzymatic sequencing of DNA may denote methods such as that of Sanger (Sanger, et al., (1977) Proc. Natl. Acad. Sci. USA 74:5463).
• DNA is first obtained from a biological sample of the tested subject.
• DNA is extracted using methods which are well known in the art, involving tissue mincing, cell lysis, protein extraction and DNA precipitation using 2 to 3 volumes of 100% ethanol, rinsing in 70% ethanol, pelleting, drying and resuspension in water or any other suitable buffer (e.g., Tris-EDTA).
• the OD 260/OD 280 ratio is determined.
• DNA preparations having an OD 260/OD 280 ratio between 1.8 and 2 are used in the following procedures described hereinbelow.
• the sequence alteration (or SNP) of some embodiments of the invention can be identified using a variety of methods. One option is to determine the entire gene sequence of a PCR reaction product (see sequence analysis, hereinbelow).
• a given segment of nucleic acid may be characterized on several other levels.
• the size of the molecule can be determined by electrophoresis by comparison to a known standard run on the same gel.
• a more detailed picture of the molecule may be achieved by cleavage with combinations of restriction enzymes prior to electrophoresis, to allow construction of an ordered map.
• the presence of specific sequences within the fragment can be detected by hybridization of a labeled probe, or the precise nucleotide sequence can be determined by partial chemical degradation or by primer extension in the presence of chain- terminating nucleotide analogs.
• Restriction fragment length polymorphism This method uses a change in a single nucleotide (the SNP nucleotide) which modifies a recognition site for a restriction enzyme resulting in the creation or destruction of an RFLP.
• Single nucleotide mismatches in DNA heteroduplexes are also recognized and cleaved by some chemicals, providing an alternative strategy to detect single base substitutions, generically named the "Mismatch Chemical Cleavage" (MCC) (Gogos et al., Nucl. Acids Res., 18:6807-6817, 1990).
• MCC Mismatch Chemical Cleavage
• this method requires the use of osmium tetroxide and piperidine, two highly noxious chemicals which are not suited for use in a clinical laboratory.
• the DNA sample is preferably amplified prior to determining sequence alterations, since many genotyping methods require amplification of the DNA region carrying the sequence alteration of interest.
• determining the presence of a sequence alteration in the RASA2 gene is effected using methods which typically involve the use of oligonucleotides which specifically hybridize with the nucleic acid sequence alterations in the RASA2 gene, such as those described in Table 1 in the Examples section herein below.
• Preferred methods of detecting sequence alterations involve directly determining the identity of the nucleotide at the alteration site by a sequencing assay, an enzyme- based mismatch detection assay, or a hybridization assay.
• a sequencing assay an enzyme- based mismatch detection assay
• a hybridization assay a hybridization assay
• Sequencing analysis The isolated DNA is subjected to automated dideoxy terminator sequencing reactions using a dye-terminator (unlabeled primer and labeled di-deoxy nucleotides) or a dye -primer (labeled primers and unlabeled di-deoxy nucleotides) cycle sequencing protocols.
• a dye-terminator reaction a PCR reaction is performed using unlabeled PCR primers followed by a sequencing reaction in the presence of one of the primers, deoxynucleotides and labeled di-deoxy nucleotide mix.
• a PCR reaction is performed using PCR primers conjugated to a universal or reverse primers (one at each direction) followed by a sequencing reaction in the presence of four separate mixes (correspond to the A, G, C, T nucleotides) each containing a labeled primer specific the universal or reverse sequence and the corresponding unlabeled di-deoxy nucleotides.
• Microsequencing analysis can be effected by conducting microsequencing reactions on specific regions of the RASA2 gene which may be obtained by amplification reaction (PCR) such as mentioned hereinabove. Genomic or cDNA amplification products are then subjected to automated microsequencing reactions using ddNTPs (specific fluorescence for each ddNTP) and an appropriate oligonucleotide microsequencing primer which can hybridize just upstream of the alteration site of interest. Once specifically extended at the 3' end by a DNA polymerase using a complementary fluorescent dideoxynucleotide analog (thermal cycling), the primer is precipitated to remove the unincorporated fluorescent ddNTPs.
• ddNTPs specific fluorescence for each ddNTP
• oligonucleotide microsequencing primer which can hybridize just upstream of the alteration site of interest.
• reaction products in which fluorescent ddNTPs have been incorporated are then analyzed by electrophoresis on sequencing machines (e.g., ABI 377) to determine the identity of the incorporated base, thereby identifying the sequence alteration in the RASA2 gene of some embodiments of the invention.
• sequencing machines e.g., ABI 377
• the extended primer may also be analyzed by MALDI- TOF Mass Spectrometry.
• the base at the alteration site is identified by the mass added onto the microsequencing primer [see Haff and Smirnov, (1997) Nucleic Acids Res. 25(18):3749-50].
• Solid phase microsequencing reactions can be utilized as an alternative to the microsequencing approach described above.
• Solid phase microsequencing reactions employ oligonucleotide micro sequencing primers or PCR-amplified products of the DNA fragment of interest which are immobilized. Immobilization can be carried out, for example, via an interaction between biotinylated DNA and streptavidin-coated microtitration wells or avidin-coated polystyrene particles.
• incorporated ddNTPs can either be radiolabeled [see Syvanen, (1994),] Clin Chim Acta 1994;226(2):225-236] or linked to fluorescein (see Livak and Hainer, (1994) Hum Mutat 1994;3(4):379-385].
• the detection of radiolabeled ddNTPs can be achieved through scintillation-based techniques.
• the detection of fluorescein-linked ddNTPs can be based on the binding of antifluorescein antibody conjugated with alkaline phosphatase, followed by incubation with a chromogenic substrate (such asp-nitrophenyl phosphate).
• reporter-detection conjugates include: ddNTP linked to dinitrophenyl (DNP) and anti-DNP alkaline phosphatase conjugate [see Harju et al., (1993) Clin Chem 39:2282-2287]; and biotinylated ddNTP and horseradish peroxidase-conjugated streptavidin with o-phenylenediamine as a substrate (see WO 92/15712).
• a diagnostic kit based on fluorescein-linked ddNTP with antifluorescein antibody conjugated with alkaline phosphatase is commercially available from GamidaGen Ltd (PRONTO).
• OLA Oligonucleotide Ligation Assay
• OLA uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of target molecules.
• One of the oligonucleotides is biotinylated, and the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their termini abut, and create a ligation substrate that can be captured and detected.
• OLA is capable of detecting single nucleotide polymorphisms and may be advantageously combined with PCR as described by Nickerson et al. (1990) Proc. Natl. Acad. Sci. U.S.A.
• PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA.
• Other amplification methods which are particularly suited for the detection of single nucleotide polymorphism include LCR (ligase chain reaction), Gap LCR (GLCR). LCR uses two pairs of probes to exponentially amplify a specific target. The sequences of each pair of oligonucleotides, is selected to permit the pair to hybridize to abutting sequences of the same strand of the target. Such hybridization forms a substrate for a template-dependent ligase.
• LCR ligase chain reaction
• GLCR Gap LCR
• LCR can be performed with oligonucleotides having the proximal and distal sequences of the same strand of a biallelic marker site.
• either oligonucleotide will be designed to include the biallelic marker site.
• the reaction conditions are selected such that the oligonucleotides can be ligated together only if the target molecule either contains or lacks the specific nucleotide that is complementary to the biallelic marker on the oligonucleotide.
• the oligonucleotides will not include the biallelic marker, such that when they hybridize to the target molecule, a "gap" is created as described in WO 90/01069. This gap is then "filled” with complementary dNTPs (as mediated by DNA polymerase), or by an additional pair of oligonucleotides.
• each single strand has a complement capable of serving as a target during the next cycle and exponential allele- specific amplification of the desired sequence is obtained.
• Ligase/Polymerase-mediated Genetic Bit AnalysisTM is another method for determining the identity of a nucleotide at a preselected site in a nucleic acid molecule (WO 95/21271). This method involves the incorporation of a nucleoside triphosphate that is complementary to the nucleotide present at the preselected site onto the terminus of a primer molecule, and their subsequent ligation to a second oligonucleotide. The reaction is monitored by detecting a specific label attached to the reaction's solid phase or by detection in solution.
• Hybridization Assay Methods - Hybridization based assays which allow the detection of single base alterations rely on the use of oligonucleotide which can be 10, 15, 20, or 30 to 100 nucleotides long preferably from 10 to 50, more preferably from 40 to 50 nucleotides.
• the oligonucleotide includes a central nucleotide complementary to a polymorphic site of the RASA2 gene and flanking nucleotide sequences spanning on each side of the central nucleotide and substantially complementary to the nucleotide sequences of the RASA2 gene spanning on each side of the polymorphic site. Sequence alteration can be detected by hybridization of the oligonucleotide of some embodiments of the invention to the template sequence under stringent hybridization reactions, as described herein above.
• hybridization duplexes are separated from unhybridized nucleic acids and the labels bound to the duplexes are then detected.
• labels refer to radioactive, fluorescent, biological or enzymatic tags or labels of standard use in the art.
• a label can be conjugated to either the oligonucleotide probes or the nucleic acids derived from the biological sample (target).
• oligonucleotides of some embodiments of the invention can be labeled subsequent to synthesis, by incorporating biotinylated dNTPs or rNTP, or some similar means (e.g., photo-cross-linking a psoralen derivative of biotin to RNAs), followed by addition of labeled streptavidin (e.g., phycoerythrin- conjugated streptavidin) or the equivalent.
• biotinylated dNTPs or rNTP or some similar means (e.g., photo-cross-linking a psoralen derivative of biotin to RNAs)
• streptavidin e.g., phycoerythrin- conjugated streptavidin
• fluorescein, lissamine, phycoerythrin, rhodamine (Perkin Elmer Cetus), Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX (Amersham) and others [e.g., Kricka et al. (1992), Academic Press San Diego, Calif] can be attached to the oligonucleotides.
• wash steps may be employed to wash away excess target DNA or probe as well as unbound conjugate.
• standard heterogeneous assay formats are suitable for detecting the hybrids using the labels present on the oligonucleotide primers and probes.
• the TaqMan assay takes advantage of the 5' nuclease activity of Taq DNA polymerase to digest a DNA probe annealed specifically to the accumulating amplification product.
• TaqMan probes are labeled with a donor-acceptor dye pair that interacts via fluorescence energy transfer. CI cleavage of the TaqMan probe by the advancing polymerase during amplification dissociates the donor dye from the quenching acceptor dye, greatly increasing the donor fluorescence.
• molecular beacons are hairpin- shaped oligonucleotide probes that report the presence of specific nucleic acids in homogeneous solutions. When they bind to their targets they undergo a conformational reorganization that restores the fluorescence of an internally quenched fluorophore (Tyagi et al., (1998) Nature Biotechnology. 16:49].
• samples may be hybridized to an irrelevant probe and treated with RNAse A prior to hybridization, to assess false hybridization.
• U.S. Patent No. 5,451,503 provides several examples of oligonucleotide configurations which can be utilized to detect SNPs in template DNA or RNA.
• Hybridization to oligonucleotide arrays The chip/array technology has already been applied with success in numerous cases.
• the screening of mutations has been undertaken in the BRCAl gene, in S. cerevisiae mutant strains, and in the protease gene of HIV-1 virus [see Hacia et al., (1996) Nat Genet 1996;14(4):441-447; Shoemaker et al., (1996) Nat Genet 1996;14(4):450-456; Kozal et al., (1996) Nat Med 1996;2(7):753-759].
• the nucleic acid sample which includes the candidate region to be analyzed is isolated, amplified and labeled with a reporter group.
• This reporter group can be a fluorescent group such as phycoerythrin.
• the labeled nucleic acid is then incubated with the probes immobilized on the chip using a fluidics station.
• a fluidics station For example, Manz et al. (1993) Adv. in Chromatogr 1993; 33: 1-66 describe the fabrication of fluidics devices and particularly microcapillary devices, in silicon and glass substrates.
• the chip is inserted into a scanner and patterns of hybridization are detected.
• the hybridization data is collected, as a signal emitted from the reporter groups already incorporated into the nucleic acid, which is now bound to the probes attached to the chip.
• Probes that perfectly match a sequence of the nucleic acid sample generally produce stronger signals than those that have mismatches. Since the sequence and position of each probe immobilized on the chip is known, the identity of the nucleic acid hybridized to a given probe can be determined.
• sets of four oligonucleotide probes are generally designed that span each position of a portion of the candidate region found in the nucleic acid sample, differing only in the identity of the polymorphic base.
• the relative intensity of hybridization to each series of probes at a particular location allows the identification of the base corresponding to the polymorphic base of the probe.
• Integrated Systems - Another technique which may be used to analyze sequence alterations includes multicomponent integrated systems, which miniaturize and compartmentalize processes such as PCR and capillary electrophoresis reactions in a single functional device.
• multicomponent integrated systems which miniaturize and compartmentalize processes such as PCR and capillary electrophoresis reactions in a single functional device.
• An example of such technique is disclosed in U.S. Pat. No. 5,589,136, which describes the integration of PCR amplification and capillary electrophoresis in chips.
• Integrated systems are preferably employed along with microfluidic systems.
• These systems comprise a pattern of microchannels designed onto a glass, silicon, quartz, or plastic wafer included on a microchip.
• the movements of the samples are controlled by electric, electro-osmotic or hydrostatic forces applied across different areas of the microchip to create functional microscopic valves and pumps with no moving parts. Varying the voltage controls the liquid flow at intersections between the micro-machined channels and changes the liquid flow rate for pumping across different sections of the microchip.
• a microfluidic system may integrate nucleic acid amplification, microsequencing, capillary electrophoresis and a detection method such as laser-induced fluorescence detection.
• the DNA sample is amplified, preferably by PCR.
• the amplification product is then subjected to automated microsequencing reactions using ddNTPs (specific fluorescence for each ddNTP) and the appropriate oligonucleotide micro sequencing primers which hybridize just upstream of the targeted polymorphic base.
• ddNTPs specific fluorescence for each ddNTP
• the primers are separated from the unincorporated fluorescent ddNTPs by capillary electrophoresis.
• the separation medium used in capillary electrophoresis can for example be polyacrylamide, polyethyleneglycol or dextran.
• the incorporated ddNTPs in the single-nucleotide primer extension products are identified by fluorescence detection. This microchip can be used to process 96 to 384 samples in parallel. It can use the typical four-color laser induced fluorescence detection of ddNTPs.
• Allele specific oligonucleotide In this method an allele- specific oligonucleotides (ASOs) is designed to hybridize in proximity to the polymorphic nucleotide, such that a primer extension or ligation event can be used as the indicator of a match or a mis-match. Hybridization with radioactively labeled allelic specific oligonucleotides (ASO) also has been applied to the detection of specific SNPs (Conner et al, Proc. Natl. Acad. Sci., 80:278-282, 1983). The method is based on the differences in the melting temperature of short DNA fragments differing by a single nucleotide. Stringent hybridization and washing conditions can differentiate between mutant and wild-type alleles.
• DGGE/TGGE Denaturing/Temperature Gradient Gel Electrophoresis
• the fragments to be analyzed are "clamped” at one end by a long stretch of G-C base pairs (30-80) to allow complete denaturation of the sequence of interest without complete dissociation of the strands.
• the attachment of a GC “clamp" to the DNA fragments increases the fraction of mutations that can be recognized by DGGE (Abrams et al, Genomics 7:463-475, 1990). Attaching a GC clamp to one primer is critical to ensure that the amplified sequence has a low dissociation temperature (Sheffield et al, Proc. Natl. Acad. Sci., 86:232-236, 1989; and Lerman and Silverstein, Meth. Enzymol., 155:482-501, 1987).
• DGGE constant denaturant gel electrophoresis
• TGGE temperature gradient gel electrophoresis
• Single-Strand Conformation Polymorphism (SSCP): Another common method, called “Single-Strand Conformation Polymorphism” (SSCP) was developed by Hayashi, Sekya and colleagues (reviewed by Hayashi, PCR Meth. AppL, 1:34-38, 1991) and is based on the observation that single strands of nucleic acid can take on characteristic conformations in non-denaturing conditions, and these conformations influence electrophoretic mobility. The complementary strands assume sufficiently different structures that one strand may be resolved from the other.
• SSCP Single-Strand Conformation Polymorphism
• the SSCP process involves denaturing a DNA segment (e.g., a PCR product) that is labeled on both strands, followed by slow electrophoretic separation on a non- denaturing polyacrylamide gel, so that intra-molecular interactions can form and not be disturbed during the run.
• a DNA segment e.g., a PCR product
• This technique is extremely sensitive to variations in gel composition and temperature.
• a serious limitation of this method is the relative difficulty encountered in comparing data generated in different laboratories, under apparently similar conditions.
• Dideoxy fingerprinting (ddF): The dideoxy fingerprinting (ddF) is another technique developed to scan genes for the presence of mutations (Liu and Sommer, PCR Methods Appli., 4:97, 1994).
• the ddF technique combines components of Sanger dideoxy sequencing with SSCP. A dideoxy sequencing reaction is performed using one dideoxy terminator and then the reaction products are electrophoresed on nondenaturing polyacrylamide gels to detect alterations in mobility of the termination segments as in SSCP analysis.
• ddF is an improvement over SSCP in terms of increased sensitivity
• ddF requires the use of expensive dideoxynucleotides and this technique is still limited to the analysis of fragments of the size suitable for SSCP (i.e., fragments of 200-300 bases for optimal detection of mutations).
• the ddF technique is also limited by the relatively small size of the DNA that can be screened.
• PyrosequencingTM analysis (Pyrosequencing, Inc. Westborough, MA, USA): This technique is based on the hybridization of a sequencing primer to a single stranded, PCR-amplified, DNA template in the presence of DNA polymerase, ATP sulfurylase, luciferase and apyrase enzymes and the adenosine 5' phosphosulfate (APS) and luciferin substrates.
• APS adenosine 5' phosphosulfate
• the first of four deoxynucleotide triphosphates is added to the reaction and the DNA polymerase catalyzes the incorporation of the deoxynucleotide triphosphate into the DNA strand, if it is complementary to the base in the template strand.
• Each incorporation event is accompanied by release of pyrophosphate (PPi) in a quantity equimolar to the amount of incorporated nucleotide.
• PPi pyrophosphate
• the ATP sulfurylase quantitatively converts PPi to ATP in the presence of adenosine 5' phosphosulfate.
• This ATP drives the luciferase-mediated conversion of luciferin to oxyluciferin that generates visible light in amounts that are proportional to the amount of ATP.
• the light produced in the luciferase-catalyzed reaction is detected by a charge coupled device (CCD) camera and seen as a peak in a pyrogramTM. Each light signal is proportional to the number of nucleotides incorporated.
• CCD charge coupled device
• AcycloprimeTM analysis (Perkin Elmer, Boston, Massachusetts, USA): This technique is based on fluorescent polarization (FP) detection. Following PCR amplification of the sequence containing the SNP of interest, excess primer and dNTPs are removed through incubation with shrimp alkaline phosphatase (SAP) and exonuclease I. Once the enzymes are heat inactivated, the Acycloprime-FP process uses a thermostable polymerase to add one of two fluorescent terminators to a primer that ends immediately upstream of the SNP site. The terminator(s) added are identified by their increased FP and represent the allele(s) present in the original DNA sample.
• SAP shrimp alkaline phosphatase
• the Acycloprime process uses AcycloPolTM, a novel mutant thermostable polymerase from the Archeon family, and a pair of Acyclo TerminatorsTM labeled with R110 and TAMRA, representing the possible alleles for the SNP of interest.
• Acyclo TerminatorTM non-nucleotide analogs are biologically active with a variety of DNA polymerases. Similarly to 2', 3 '-dideoxynucleotide-5' -triphosphates, the acyclic analogs function as chain terminators. The analog is incorporated by the DNA polymerase in a base- specific manner onto the 3 '-end of the DNA chain, and since there is no 3'-hydroxyl, is unable to function in further chain elongation. It has been found that AcycloPol has a higher affinity and specificity for derivatized AcycloTerminators than various Taq mutant have for derivatized 2',3'-dideoxynucleotide terminators.
• Reverse dot blot This technique uses labeled sequence specific oligonucleotide probes and unlabeled nucleic acid samples. Activated primary amine-conjugated oligonucleotides are covalently attached to carboxylated nylon membranes. After hybridization and washing, the labeled probe, or a labeled fragment of the probe, can be released using oligomer restriction, i.e., the digestion of the duplex hybrid with a restriction enzyme.
• Circular spots or lines are visualized colorimetrically after hybridization through the use of streptavidin horseradish peroxidase incubation followed by development using tetramethylbenzidine and hydrogen peroxide, or via chemiluminescence after incubation with avidin alkaline phosphatase conjugate and a luminous substrate susceptible to enzyme activation, such as CSPD, followed by exposure to x-ray film.
• Sequence alterations can also be determined at the protein level. While chromatography and electrophoretic methods are preferably used to detect large variations in RASA2 molecular weight, such as detection of a truncated RASA2 protein, immunodetection assays such as ELISA and western blot analysis, immunohistochemistry and the like, which may be effected using antibodies specific to RASA2 sequence alterations are preferably used to detect point mutations and subtle changes in molecular weight.
• the invention also envisages the use of serum immunoglobulins, polyclonal antibodies or fragments thereof, (i.e., immunoreactive derivatives thereof), or monoclonal antibodies or fragments thereof for analyzing the amino acid sequence of RASA2 protein.
• Monoclonal antibodies or purified fragments of the monoclonal antibodies having at least a portion of an antigen- binding region, including the fragments described hereinbelow, chimeric or humanized antibodies and complementarily determining regions (CDR).
• Additional diagnostic tests may also be performed so as to corroborate the results of the diagnosing (e.g. gold standard tests, assessing the aggressiveness of the tumor, the patient's health and susceptibility to treatment, etc.).
• Imaging studies such as CT and/or MRI may be obtained to further diagnose the cancer/metastasis .
• diagnosis or choice of therapy may be determined by further assessing the size of the tumor, or the lymph node stage or both, optionally together or in combination with other risk factors.
• Other factors which may of course be assessed for determining the choice of therapy may include family history, skin shade etc.
• Other markers which may be analyzed include for example tyrosinase, MART-1, lactate dehydrogenase, S 100, TA90, and C-reactive protein.
• genes may also be analyzed for the presence of mutations.
• Such genes include BRAF, NRAS and/or NF1. If mutations are found both on RASA2 and one of the above, then there is an increased probability that the subject has melanoma.
• kits such as an FDA-approved kit, which may contain one or more unit dosage form containing the active agent (e.g. antibody or probe) for detection of at least one marker of the present invention.
• the kit may be accompanied by instructions for administration.
• the kit may also be accompanied by a notice in a form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions for human or veterinary administration.
• Such notice for example, may include labeling approved by the U.S. Food and Drug Administration.
• the information obtained by analyzing RASA2 may also be used by the clinician to recommend a suitable treatment.
• a suitable treatment may include a RAS pathway inhibitor or an agent which up-regulates an amount and/or activity of RASA2. If mutations are found both on RASA2 and at least one of BRAF, NRAS and NF1, then a RAS pathway inhibitor or an agent which up-regulates an amount and/or activity of RASA2 for treating the melanoma may be recommended.
• the RAS pathway inhibitor is a MEK inhibitor.
• MEK inhibitor refers to small molecule drug compounds or neutralizing antibodies which can inhibit or interrupt the MEK step on the MAP kinase pathway.
• suitable MEKi may include, but are not limited to, those described as MEKi-623, MEKi-973, or GSK1120212.
• MEK inhibitors include, but are not limited to consisting of Trametinib, cobimetinib, pimasertib, and MEK- 162.
• the RAS pathway inhibitor comprises an ERK inhibitor.
• ERK inhibitor refers to an inhibitor of ERK kinase activity.
• An ERK inhibitor may be any type of molecule, including, but not limited to, small molecules and expression modulators (such as antisense molecules, microRNAs, siRNAs, etc.), and may act directly on the ERK protein, may interfere with expression of the ERK protein (e.g., transcription, splicing, translation, and/or post-translational processing), and/or may prevent proper intracellular localization of the ERK protein.
• a nonlimiting exemplary ERK inhibitor is AEZS -131.
• the RAS pathway inhibitor comprises RAF inhibitor.
• Raf inhibitor refers to an inhibitor of b-Raf kinase activity and/or c-Raf kinase activity.
• a Raf inhibitor may be any type of molecule, including, but not limited to, small molecules and expression modulators (such as antisense molecules, microRNAs, siRNAs, etc.), and may act directly on the Raf protein, may interfere with expression of the Raf protein (e.g., transcription, splicing, translation, and/or post-translational processing), and/or may prevent proper intracellular localization of the Raf protein.
• Nonlimiting exemplary Raf inhibitors include sorafenib tosylate, GDC-0879, PLX-4720, regorafenib, PLX-4032, SB-590885-R, RAF265, GW5074, XL281, and GSK2118436.
• the agent used for treating a melanoma patient (which has a mutation in RASA2 or a decreased level of expression or activity of RASA2) is one which upregulates an amount and/or activity of wild-type RASA2.
• Such agents include those which are capable of increasing the transcription (for example a transcription factor known to interact with the 5'untranslated region of RASA2) of RASA2, the translation of RASA2 or the stability of RASA2.
• the agent which increases the amount of wild-type RASA2 may be a polynucleotide which encodes RASA2, the protein itself or an active peptide thereof.
• the RASA2 may be administered to the subject in need thereof as polynucleotides where they are expressed in vivo i.e. gene therapy.
• gene therapy refers to the transfer of genetic material (e.g. DNA or RNA) of interest into a host to treat or prevent a genetic or acquired disease or condition or phenotype.
• the genetic material of interest encodes a product (e.g. a protein, polypeptide, peptide, functional RNA, antisense) whose production in vivo is desired.
• the genetic material of interest can encode a hormone, receptor, enzyme, polypeptide or peptide of therapeutic value.
• ex vivo and (2) in vivo gene therapy Two basic approaches to gene therapy have evolved: (1) ex vivo and (2) in vivo gene therapy.
• ex vivo gene therapy cells are removed from a patient, and while being cultured are treated in vitro.
• a functional replacement gene is introduced into the cell via an appropriate gene delivery vehicle/method (transfection, transduction, homologous recombination, etc.) and an expression system as needed and then the modified cells are expanded in culture and returned to the host/patient.
• These genetically reimplanted cells have been shown to express the transfected genetic material in situ.
• the cells may be autologous or non-autologous to the subject. Since non- autologous cells are likely to induce an immune reaction when administered to the body several approaches have been developed to reduce the likelihood of rejection of non-autologous cells.
• target cells are not removed from the subject rather the genetic material to be transferred is introduced into the cells of the recipient organism in situ, that is within the recipient. These genetically altered cells have been shown to express the transfected genetic material in situ.
• nucleic acid constructs used to express the amino acids in the first and second amino acids are identical to those used to express the amino acids in the second amino acid sequence.
• RASA2 of the present invention comprise cell-specific promoter sequence elements.
• Recombinant viral vectors are useful for in vivo expression of the RASA2 of the present invention since they offer advantages such as lateral infection and targeting specificity.
• Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny.
• Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
• the agents used to up-regulate RASA2 may be provided per se or as part of a pharmaceutical composition.
• a "pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
• the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
• active ingredient refers to the agent which up-regulates RASA2, accountable for the biological effect.
• pharmaceutically acceptable carrier refers to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
• An adjuvant is included under these phrases.
• excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.
• excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
• Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal, or intraocular injections.
• neurosurgical strategies e.g., intracerebral injection or intracerebroventricular infusion
• molecular manipulation of the agent e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB
• pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers)
• the transitory disruption of the integrity of the BBB by hyperosmotic disruption resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide).
• each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method.
• compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
• compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
• the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
• physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
• penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
• the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
• Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
• Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
• Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
• disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
• Dragee cores are provided with suitable coatings.
• suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
• Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
• compositions which can be used orally include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
• the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
• the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
• stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
• compositions may take the form of tablets or lozenges formulated in conventional manner.
• the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro- tetrafluoroethane or carbon dioxide.
• a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro- tetrafluoroethane or carbon dioxide.
• the dosage unit may be determined by providing a valve to deliver a metered amount.
• Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
• compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
• Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
• the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
• compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran.
• the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
• the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
• a suitable vehicle e.g., sterile, pyrogen-free water based solution
• compositions of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
• compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (RAS2 upregulating agent) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., skin cancer) or prolong the survival of the subject being treated.
• RAS2 upregulating agent an amount of active ingredients (RAS2 upregulating agent) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., skin cancer) or prolong the survival of the subject being treated.
• the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.
• a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
• Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
• the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
• the dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p. l).
• Dosage amount and interval may be adjusted individually to provide blood or brain levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC).
• MEC minimum effective concentration
• the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations
• dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
• compositions to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
• RAS pathway inhibitor It is expected that during the life of a patent maturing from this application many relevant RAS pathway inhibitors will be developed and the scope of the term RAS pathway inhibitor is intended to include all such new technologies a priori.
• compositions, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
• method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
• treating includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
• sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
• Tumor tissues All DNA samples used in this study were derived from metastases. Samples used for whole-exome capture were extracted from cell lines established directly from patient tumors as described previously 17. DNA subjected to whole-genome sequencing was extracted from OCT embedded specimens as described previously 17. Tissue was further collected and cell lines established at QIMR Berghofer Medical Research Institute. All cell lines were established as described previously with informed patient consent under a protocol approved by the QIMR Berghofer Medical Research Institute Human Research Ethics Committee.
• PCR and sequencing of RASA2 was done as previously described 18. Sequence traces were analyzed using the Mutation Surveyor software package (SoftGenetics). Primers used are listed in Table 1, herein below.
• CytoScan array processing and analysis Samples were prepared according to Affymetrix protocols (Affymetrix, Inc). DNA quality and quantity was ensured using Bioanalyzer (Agilent, Inc) and NanoDrop (Thermo Scientific, Inc) respectively. Per DNA labeling, 200 nanograms of genomic DNA were used in conjunction with the Affymetrix recommended protocol for CytoScan HD array kit and reagents (catalog# 901835).
• the hybridization cocktail containing the fragmented and labeled DNAs was hybridized to The Affymetrix CytoScan HD GeneChip.
• the chips were washed and stained by the Affymetrix Fluidics Station using the standard format and protocols as described by Affymetrix.
• the probe arrays were stained with streptavidin phycoerythrin solution (Molecular Probes, Carlsbad, CA) and enhanced by using an antibody solution containing 0.5 mg/mL of biotinylated anti- streptavidin (Vector Laboratories, Burlingame, CA).
• An Affymetrix Gene Chip Scanner 3000 was used to scan the probe arrays.
• the (dot)Cel files were generated from the scanned images using Affymetrix AGCC software and the (dot)cyhd(dot)cychp files were generated by the Chromosome Analysis Suite (ChAS) Version 2.1 software. All the analyses were done with ChAS default parameters for LOH and Copy Number State (CNS).
• ChAS Chromosome Analysis Suite
• RASA2 cDNA Human RASA2 cDNA (NM_006506) was cloned from HEK293T cDNA using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies, Santa Clara, CA) according to manufacturers' instructions and the following forward and reverse primers respectively; 5'-atcatctagagccaccatggattacaaggatgacgac- gataaggcggcggcggcgcctgc-3' (SEQ ID NO: 47) and 5'-tggtcagcggccgctaagatgctttcccaacaattgg- attttcc-3' (SEQ ID NO: 48).
• a FLAG tag was introduced onto the N-terminus of RASA2 during the cloning procedure.
• PCR products were cloned into the pCDFl-MCS2-EFl-Puro vector (Systems Biosciences, Inc., Mountain View, CA) via the Xbal and Notl restriction sites.
• the p.S400F mutation was introduced using fusion PCR site directed mutagenesis and the p.R310X mutation was created by using an alternative reverse primer to introduce the relevant nonsense mutation/stop codon.
• RASA2 immunohistochemistry was performed on AJCC Stage III melanoma tumor microarrays (TMAs). It was performed using rabbit polyclonal anti-RASA2 antibody from Sigma-Aldrich (HPA035375) on a DAKO IHC autostainer using DAKO EnVison FLEX+ detection system as per manufactures instructions (high pH antigen retrieval, primary antibody dilution 1: 100 for 60min).
• Resultant predominant IHC signal was cytoplasmic. Cases were scored as percent of cytoplasmic positive tumor cells (0-100) and overall tumor staining intensity
• TMA cohort description Samples eligible for this TMA were obtained at the
• Extracts were centrifuged for 10 minutes at 14,000 rpm at 4°C. Proteins (50 ⁇ g) were resolved on 10% SDS-polyacrylamide gels and transferred to nitrocellulose membranes (Biorad). Western blots were probed with the following antibodies anti-FLAG (M2) (Sigma-Aldrich) and GAPDH (Millipore). Ras-GTP levels were determined using a RAS activation Assay Kit (EMD Millipore).
• RASA2 constructs were co- transfected into HEK 293T cells seeded at 2.5X10 6 per T75 flask with pVSV-G and pFIV-34N (kind gifts from Todd Waldman, Georgetown University) helper plasmids using Lipofectamine 2000 as described by the manufacturer.
• Virus-containing media was harvested 60hr after transfection, filtered, aliquoted and stored at -80 C.
• 501Mel, A375 and 108T cells were grown in RPMI-1640 (Biological Industries) and supplemented with 10% fetal bovine serum (HyClone, Logan, UT).
• Lentivirus for RASA2 WT, R310X and S400F
• empty vector control were used to infect the cells as previously described 19 .
• Stable expression of RASA2 proteins was determined by SDS-PAGE analysis followed by immunoblotting with anti-FLAG and anti-GAPDH to show equivalent expression among pools.
• siRNA depletion of endogenous RASA2 Specific siRNA pool (ON-Targetplus) designed using siRNA design program for human RASA2 was purchased from Dharmacon (Thermo Fisher Scientific). A mixture of four siRNAs was used to transiently deplete RASA2 in malignant melanoma cells. Using DharmaFECT transfection reagent #1 (specific for siRNA), melanoma cells were transfected with 50 nM siRNA Smart pool in the presence of OptiMEM-I medium. Cells were incubated for 72 h post-transfection before checking RAS-GTP levels by the RAS Activation Assay Kit (Millipore).
• DharmaFECT transfection reagent #1 specific for siRNA
• melanoma cells were transfected with 50 nM siRNA Smart pool in the presence of OptiMEM-I medium. Cells were incubated for 72 h post-transfection before checking RAS-GTP levels by the RAS Activation Assay Kit (Millipore).
• melanoma cell lines (501 Mel, A375 and 108T) stably infected with either vector, WT RASA2, R310X mutant or S400F mutant RASA2 were seeded into 96 well plates at 500-2000 cells per well and incubated for 7-17 days. Samples were analyzed every 48 hrs by lysing cells in 50 ⁇ 0.2% SDS/well and incubating for 2 hour at 37°C prior to addition of 150 ⁇ /well of SYBR Green I solution (1:750 SYBR Green I (Invitrogen-Molecular Probes) diluted in d3 ⁇ 40).
• Soft agar assay A375 and 501Mel pooled RASA2 clones were plated in duplicate at 1000 cells/well in top plugs consisting of sterile 0.33% Bacto-Agar (BD, Sparks, MD) and 10% , 5% or 2.5% fetal bovine serum (HyClone, Logan, UT) in a 24- well plate.
• the lower plug contained sterile 0.5% Bacto-Agar and 10%, 5% or 2.5% fetal bovine serum. After one week, the colonies were counted.
• NIH 3T3 cells were infected with shRNA for each condition (vector control and two independent mouse ?A5A2-specific shRNAs) and selected.
• the shRNA constructs used in this study were: sh50 (TRCN0000034350) and sh51 (TRCN0000034351).
• 3D Ras-RASA2 model prediction The complex between human HRAS bound to guanosine triphosphatase (GTPase)-activating domain of the human GTPase- activating protein pl20GAP (GAP-334), lWQl.pdb [Scheffzek, K. et al. Science (New York, N Y ) 277, 333-8 (1997)], both RASA2 (1WQ1 chain G, GAP-334) and Mg 2+ - NRAS-GTP (1WQ1 chain R, HRAS) models.
• GAP-334 sequence present in the PDB file is shorter than RASA2, but it covers the binding interface, is bound to RAS, and has high similarity with the query.
• the present inventors compiled somatic mutation data from 501 melanoma whole exome/genome sequencing sources which included The Cancer Genome Atlas (TCGA) 2 3. Data were analyzed as previously described 8 (The data for RASA2 is presented in Table 2, herein below). Table 2
• Coding bases (just coding) 2550
• Genes were ranked based on the non- synonymous mutation frequency, number of mutations per megabase and mutation rate (taking into account the base coverage), as previously described 9 .
• the present inventors identified genes with deleterious alterations (nonsense or frameshift mutations) in at least 20% of the cases, a suggested threshold for this type of gene 10 .
• the highest ranking genes were the well documented melanoma tumor suppressors TP53, NFl, ARID2, CDKN2A, and PTEN. After excluding these, RASA2 was identified, for which 27% of tumors harbored loss of function (LOF) mutations (Table 3).
• Genes were ranked based on the non-synonymous frequency, mutations per megabase, mutation rate (taking into account the base coverage) and presence of deleterious (nonsense or frameshift) mutations in at least 20% of the cases.
• RASA2 is a potential tumor suppressor gene in melanoma (Table 3, Table 4, and Figure 8). As noted in Table 4, the genes adjacent to RASA2 are not significantly affected, suggesting RASA2 specific events. The distribution of the 35 non-synonymous mutations identified in RASA2 is shown schematically in Figure 1A.
• Tumor suppressor gene ARID2 0 0.6
• RASA2 encodes a member of the GAP1 family of GTPase-activating proteins, the RAS p21 protein activator 2.
• the gene product stimulates the GTPase activity of wild-type (WT) RAS p21 but not its oncogenic form. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS 11 ' 12.
• WT wild-type
• NF1 which also encodes a RAS -specific GAP, has recently been shown to be mutated and to play a central role in melanoma 2 ' 3 ' 13.
• RASA2 is a tumor suppressor in melanoma
• its expression was knocked down in immortalized, non-tumorigenic NIH3T3 cells, using two short hairpin RNA (shRNA) constructs.
• shRNA short hairpin RNA
• RASA2 was considered to be an attractive candidate tumor suppressor gene in melanoma.
• R310X which causes RASA2 truncation
• S400F in the catalytic RAS- GAP domain. They established stable pooled clones expressing vector control, WT or mutant (R310X and S400F) RASA2.
• the melanoma cell lines A375 (BRAF V600E), 501Mel (BRAF V600E) and 108T (WT BRAF) and 55T (BRAF WT, NRAS WT, NF1 mutant) were selected as they express WT RASA2.
• RASA2 protein in A375, 501Mel and 108T stable clone cell lines were detected ( Figure 3). Since RASA2 encodes a RAS GTPase activating protein (RasGAP), it was hypothesized that RASA2 mutation or loss would alleviate RAS suppression. Indeed, modeling the RASA2 mutants on the structure of pl20GAP predicts that the RASA2 p.Arg310* mutant is unable to bind to Ras as it lacks the RAS-GAP, PH and BTK domains.
• RasGAP RAS GTPase activating protein
• RNA interference (RNAi) -mediated suppression of RASA2 lead to the activation of RAS (Figs. ICii, ICiii and Figure 4B).
• RASA2 immunohistochemistry was performed on a cohort of AJCC stage III melanomas by tissue microarray (TMA) ( Figures 7A-B) 15 16 . Cases were scored as percent of cytoplasmic positive tumor cells (0-100) and overall tumor staining intensity (0 - 4). It was found that RASA2 expression was completely absent in 34% (27 of 80) of cases and was substantially decreased in another 31% (25 of 80) of human melanomas ( Figure

Abstract

Description

USE OF RASA2 AS A PROGNOSTIC AND THERAPEUTIC MARKER FOR

MELANOMA

FIELD AND BACKGROUND OF THE INVENTION

The invention relates to approaches and methods useful for the assessment, characterization and treatment of melanoma, based upon the presence or absence of mutations in the Ras GTPase-Activating Protein (RASA2) gene.

Cutaneous melanoma, whose incidence rates continued to increase, represents a significant health problem worldwide. Recently, melanoma has been the subject of extensive genomic studies. These have enabled the discovery of several novel driver genes and the development of targeted drugs, which show promising clinical responses in melanoma patients. However, despite these successes, responses are rarely durable. Furthermore, there remain a significant number of melanoma patients without a targetable mutation. Therefore, there is an urgent need to identify novel targetable alterations in melanoma.

Importantly, most clinically approved drugs that target genetically altered proteins in cancer are towards kinases ⁶. However, a majority of the proteins mutated in cancer are tumor suppressors which cannot be re-activated by small molecules. As drugs usually interfere with protein function, these drivers cannot be targeted. A possible solution is exploiting the fact that tumor suppressor gene inactivation may result in the activation of a downstream growth signal pathway. For example, PTEN mutations lead to increased activity of the downstream kinase AKT .

Additional background art includes WO 2012068468 and Chen et al., Proc. Natl. Acad. Sci. USA Aug 5, 2014; 111(31): 11473-11478.

SUMMARY OF THE INVENTION

According to an aspect of some embodiments of the present invention there is provided a method of diagnosing melanoma in a subject in need thereof comprising analyzing Ras GTPase-Activating Protein (RASA2) or a gene encoding said RASA2 in a sample of the subject, wherein a decrease in the amount and/or activity of said RASA2 beyond a predetermined level with respect to a control sample of a healthy subject or the presence of a RASA2 mutation is indicative of a subject having melanoma.

According to an aspect of some embodiments of the present invention there is provided a method of determining the probability of survival of a subject having melanoma, comprising analyzing RASA2 or a gene encoding said RASA2 in a sample of the subject, wherein a decrease in the amount and/or activity of said RASA2 beyond a predetermined level with respect to a control sample of a healthy subject or the presence of a RASA2 mutation is indicative of the probability of survival.

According to an aspect of some embodiments of the present invention there is provided a method of determining a treatment course of a subject afflicted with or suspected to be afflicted with melanoma, the method comprising analyzing RASA2 or a gene encoding said RASA2 in a sample of the subject, wherein an amount and/or activity of said RASA2, or the presence or absence of a RASA2 mutation is indicative of the treatment course.

According to an aspect of some embodiments of the present invention there is provided a method of treating melanoma in a subject in need thereof comprising:

(a) analyzing an amount and/or activity of RASA2 or for the presence or absence of a RASA2 mutation in a sample of the subject; and

(b) selecting a treatment course for the subject based on the results of step (a), thereby treating melanoma in the subject.

According to an aspect of some embodiments of the present invention there is provided a method of treating melanoma in a subject in need thereof comprising administering to the subject a polynucleotide agent which encodes RASA2, thereby treating melanoma in the subject.

According to some embodiments of the invention, the sample comprises a tumor sample.

According to some embodiments of the invention, the sample comprises a skin sample.

According to some embodiments of the invention, the analyzing is effected on the protein level.

According to some embodiments of the invention, the analyzing is effected by immunohistochemistry. According to some embodiments of the invention, the analyzing is effected on the RNA level.

According to some embodiments of the invention, the analyzing is effected on the gene level.

According to some embodiments of the invention, the method further comprises amplifying nucleic acid obtained from the sample prior to said analyzing.

According to some embodiments of the invention, the analyzing is effected using any of the primer pairs as set forth in Table 1.

According to some embodiments of the invention, the method further comprises performing an additional test so as to corroborate the results of the analyzing.

According to some embodiments of the invention, the mutation is selected from the group consisting of a frameshift mutation, a nonsense mutation and a mis sense mutation.

According to some embodiments of the invention, the mutation is selected from the group consisting of S82F, P96L, C180 frameshift (Fs), H181L, L199Fs, G201S, P219L, I248Fs, L291P, R310* (codon stop), R355*, P363A, K387*, R397K, S400F, D496N, R511C, P530S, S590P, E608K, L764F, G780*, P796S, P843S and G846E.

According to some embodiments of the invention, the method further comprises determining if the sample contains a mutation in a gene selected from the group consisting of BRAF, NRAS and NF1.

According to some embodiments of the invention, the method further comprises determining if the sample contains a mutation in the NF1 gene.

According to some embodiments of the invention, when said amount and/or activity of RASA2 is below a predetermined level, the treatment course comprises a RAS pathway inhibitor or an agent which up-regulates an amount and/or activity of RASA2.

According to some embodiments of the invention, when a mutation is identified in said gene encoding said RASA2, the treatment course comprises a RAS pathway inhibitor or an agent which up-regulates an amount and/or activity of RASA2.

According to some embodiments of the invention, the RAS pathway inhibitor comprises a MEK inhibitor. According to some embodiments of the invention, the MEK inhibitor is a small molecule or a MEK neutralizing antibody.

According to some embodiments of the invention, the MEK inhibitor is selected from the group consisting of Trametinib, cobimetinib, pimasertib, and MEK- 162.

According to some embodiments of the invention, the RAS pathway inhibitor comprises an ERK inhibitor.

According to some embodiments of the invention, the RAS pathway inhibitor comprises a B-RAF inhibitor.

According to some embodiments of the invention, the B-RAF inhibitor comprises Vemurafenib or Dabrafenib.

Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

In the drawings:

FIGs. 1A-G describe the effects of RASA2 mutations on RAS activity, growth and patient survival. (A) Human RASA2 protein, conserved domains indicated as blocks: C2 domain first repeat (C2 1); C2 domain second repeat (C2 2); Ras-GTPase activating domain (RAS -GAP); Plekstrin homology domain (PH); Bruton's tyrosine kinase Cys-rich motif (BTK). Somatic mutations indicated with arrows and amino acid changes. Red triangles indicate deleterious mutations (frameshift, nonsense and other deleterious mutations based on SIFT analysis). The underlined mutations were used in this study. (B) Distribution of somatic mutations in BRAF, NRAS, NF1 and RASA2 in melanoma. (C) Immunoblot of RAS-GTP levels in (i) 501Mel cells expressing the indicated constructs, (ii) 501Mel cells and (iii) 108T cells depleted for RASA2 using siRNA. RAS-GTP levels were assessed by RAS pull-down assay and the RAS- GTP/RAS ratio was calculated and normalized to the vector control (lower panel). (D) 501Mel pooled clones expressing WT, R310X, S400F or vector alone were seeded in 96-well plates in the presence of reduced serum (2.5% FBS). Average cell number at each time point was measured by SYBR Green I. Error bars, standard deviation (S.D.). (E) Anchorage-independent proliferation of 501Mel pooled RASA2 clones expressing WT, R310X, S400F or vector alone was assessed by measuring colony formation in soft agar in the presence of reduced serum (2.5%). Graph indicates number of colonies observed after 7 days of growth. **P < 0.005 for WT vs. vector and ***P < 0.0001 for WT vs mutants (determined by Students i-tests). (F) RASA2 expression in melanoma patient samples. The number and percentages of tumors with absent (0), low (1), intermediate (2 and 3), or high (4) RASA2 protein expression are indicated. (G) Kaplan- Meier curve showing overall survival of AJCC stage III melanoma patients with high or low RASA2 expression (log rank p = 0.024).

FIG. 2 is a graph summarizing non- synonymous mutations in RASA2 across different tumor types from COSMIC. NS: not specified.

FIG. 3 is photograph illustrating expression of the different RASA2 forms in different melanoma cells. Detection of RASA2 protein expression by immunoblot analysis in A375, 108T and 501Mel melanoma cells stably infected with an empty vector, human WT RASA2, the truncated mutant RASA2 (R310X) or the mutant RASA2 (S400F). Lysates from the different clones were immunoblotted with FLAG antibody. The lysates were analyzed in parallel using anti-GAPDH for normalization.

FIGs. 4A-B illustrate that RASA2 mutations and RNAi-mediated suppression of RASA2 result in the activation of RAS. Immunoblot of RAS-GTP levels in (A) 108T cells expressing the indicated constructs. (B) A375 cells depleted for RASA2 using siRNA. RAS-GTP levels were assessed by RAS pull-down assay. The RAS-GTP/RAS ratio was calculated and normalized to the control in the right panels. FIGs. 5A-B illustrate the effects of RASA2 mutations on cell growth (A) Somatic alterations in RASA2 cause increased proliferation in reduced serum. A375, 501Mel or 108T pooled clones expressing wild-type, R310X, S400F or vector alone RASA2 were seeded in complete normal (10% FBS) or low serum (2.5% or 5% FBS) in 96-well plates and incubated over a 7-17 day period. Plates were harvested and analyzed by SYBR Green I. Error bars, standard deviation (S.D). (B) Somatic alterations in RASA2 cause increased anchorage independent growth. Anchorage- independent proliferation of A375 (left) and 501Mel (right) pooled RASA2 clones expressing wild-type, R310X, S400F or vector alone were assessed in complete normal (10% FBS) or low serum (5% FBS) by measuring colony formation in soft agar. Graph indicates the mean number of colonies + S.D observed after 7 days of growth. Students i-tests in all instances showed a **P < 0.005.

FIG. 6 illustrates that RASA2 mutations increase migration in vitro. A375, 501Mel and 108T pooled clones expressing mutant RASA2 R310X or S400F show increased cell migration compared to cells expressing wild type RASA2. We seeded A375, 501Mel or 108T clones expressing the indicated vectors in blind well chemotaxis chambers and assessed them for their ability to migrate 24h later. We analyzed stained filters using a Nikon Eclipse TS 100 microscope lOx lens and counted them with ImageJ software. Quantification made from 2 independent experiments, each done in triplicates. Error bars, S.D. Students i-tests comparing WT to vector and WT to mutants (R310X and S400F) showed a ***P < 0.0001 and a **P < 0.005.

FIGs. 7A-B illustrate that RASA2 expression is lost / low in melanoma patients and low RASA2 expression is associated with reduced overall survival. (A) Metastatic melanoma immunohistochemical images staining for RASA2: (a) negative, (b) weak, (c) strong. (B) RASA2 immunohistochemistry (IHC) performed on different melanoma tumor microarrays (TMAs). There is a negative survival effect of RASA2 loss. This expression profiling was generated for optimal calculation of survival effects with balanced good, moderate and bad outcome patients.

FIG. 8 is a graph illustrating the copy number status (CNS) in RASA2 as identified by CHAS software in three melanoma samples. Arrows indicate loss. Copy number is represented on the y-axis and chromosomal position on the x-axis. FIGs. 9A-C illustrate that RASA2 acts as a tumor suppressor in NIH3T3 cells. (A) NIH3T3 cells were infected with lentiviral shRNAs that target RASA2 or control and were assessed by RAS pull-down assay. The RAS-GTP/RAS ratio of two independent experiments was calculated and normalized in the right panel. Error bars, standard deviation (S.D). (B) RASA2 knockdown increases proliferation. NIH3T3 cells were infected with lentiviral shRNAs that target RASA2, or control and were seeded in 96-well plates and incubated over a 10 day period. Plates were harvested and average cell number at each time point was measured by assessing DNA content using SYBR Green I. Error bars, standard deviation (S.D). (C) RASA2 knockdown increased anchorage independent growth. Anchorage-independent proliferation of NIH3T3 pooled RASA2 clones infected with lentiviral shRNAs that target RASA2 or control were assessed by measuring colony formation in soft agar. Graph indicates the mean number of colonies + S.D observed after 7 days of growth. Students i-tests in all instances showed a ***P < 0.00015.

FIGs. lOA-C are pictures of a 3D Ras-RASA2 model. A. Complex of NRAS (in yellow) and GTP (in ribbon diagram) with RASA2 RAS-GAP domain (in green). Helices a6c and a7c, and loops Lie and L6c of RASA2 are colored in orange, magenta, red and blue, respectively. Wild-type RASA2 interacts with RAS via helices a6c (residues 498-518), a7c (residues 532-550), and loops Lie (residues 388-401) and L6c (residues 551-561), and stabilizes NRAS Switch I and Switch II regions (residues 44- 54, and 74-84, respectively). B. Zoom-in on S400 in the wild-type RASA2. S400 is located at the end of Lie loop and establishes an H-bond interaction with D385 in helix ale. C. Zoom-in on F400 in the point mutated RASA2.

FIG. 11 illustrates that wild-type but not mutant RASA2 inhibits Ras activation. Immunoblot of RAS-GTP levels in melanoma cells that harbor RASA2 mutations (C084 and 76T) expressing WT RASA2 or vector control. RAS-GTP levels were assessed by RAS pull-down assay. The RAS-GTP/RAS ratio of two independent experiments were calculated and normalized in the lower panel. Error bars, standard deviation (S.D).

FIGs. 12A-C are graphs illustrating the effects of wild-type and mutant RASA2 on cell growth. (A-B) 76T or C084 pooled clones expressing wild-type RASA2 or vector alone were seeded in low serum (2.5% FBS) in 96-well plates and incubated over a 15-17 day period. Plates were harvested and average cell number at each time point was measured by assessing DNA content using SYBR Green I. Error bars, standard deviation (S.D). (C) Somatic alterations in RASA2 fail to decrease anchorage independent growth, (i) Anchorage-independent growth of 108T (left) and 55T (right) pooled RASA2 clones expressing wild-type, R310X, S400F or vector alone were assessed in low serum by measuring colony formation in soft agar. Graph indicates the mean number of colonies + S.D observed after 7 days of growth. Students i-tests showed *P < 0.05 or **P < 0.005. (ii) Anchorage-independent growth of 76T (left) and C084 (right) pooled RASA2 clones expressing wild-type RASA2 or vector alone were assessed in low serum by measuring colony formation in soft agar. Graph indicates the mean number of colonies + S.D observed after 7 days of growth. Students i-tests in all instances showed a **P < 0.005.

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

The invention relates to approaches and methods useful for the assessment, characterization and treatment of melanoma, based upon the presence or absence of mutations in the Ras GTPase-Activating Protein (RASA2) gene.

Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

In order to identify novel tumor suppressor genes in melanoma, the present inventors compiled and analyzed somatic mutation data from 501 melanoma whole exome/genome sequencing sources. RASA2 was identified to be mutated in 5% of melanoma patients with more than 27% deleterious mutations.

To characterize the tumorigenic effects of RASA2, two recurrent RASA2 mutations were functionally characterized: R310X, which causes RASA2 truncation, and S400F in the catalytic RAS-GAP domain. Stable pooled clones expressing vector control, WT or mutant (R310X and S400F) RASA2 were established. Overexpression of WT RASA2 substantially suppressed RAS-GTP levels; in contrast both RASA2 mutants increased RAS-GTP levels (Figure ICi and Figure 4A). Conversely in melanoma cells that retain RASA2 expression, RNA interference (RNAi)-mediated suppression of RASA2 lead to the activation of RAS (Figure ICii, ICiii and Figure 4B). It was further shown that in reduced serum concentration, WT clones grew at a lower rate than mutant clones (Figure ID and Figure 5A). Further, cells expressing mutant RASA2 formed a significantly higher number of colonies compared to WT or empty vector (Figure IE and Figure 5B; P < 0.005 i-test), consistent with the notion that RASA2 mutations play a causal role in melanoma.

Whilst further reducing the present invention to practice the present inventors performed RASA2 immunohistochemistry (IHC) on a cohort of AJCC stage III melanomas so as to analyze the extent to which RASA2 protein expression is lost in human melanoma tumors and to assess its association with prognosis. As shown in Figure IF, RASA2 expression was decreased or absent in the majority of human melanomas. Furthermore, Kaplan-Meier plot and log-rank tests showed that loss of RASA2 expression was significantly associated with poor survival (Figure 1G).

Thus, according to one aspect of the present invention there is provided a method of diagnosing melanoma in a subject in need thereof comprising analyzing Ras GTPase- Activating Protein (RASA2) or a gene encoding said RASA2 in a sample of the subject, wherein a decrease in the amount and/or activity of said RASA2 beyond a predetermined level with respect to a control sample of a healthy subject or the presence of a mutation in the gene encoding the RASA2 is indicative of a subject having melanoma.

The term "melanoma" as used herein, refers to a cancer of the skin in which malignant melanocytes are involved. The melanoma may be at any stage e.g. IA, IB, IIA, IIB, IIC, IIIA, IIIB, IIIC and IV.

As used herein the term "diagnosing" refers to classifying a melanoma, determining a severity of melanoma (grade or stage), monitoring melanoma progression, forecasting an outcome of the melanoma and/or prospects of recovery.

The subject may be a healthy subject (e.g., human) undergoing a routine well- being check up. Alternatively, the subject may be at risk of having melanoma (e.g., a genetically predisposed subject, a subject with medical and/or family history of cancer, a subject who has been exposed to carcinogens, occupational hazard, environmental hazard) and/or a subject who exhibits suspicious clinical signs of melanoma (e.g., a change in the appearance of a mole). Ras GTPase-Activating Protein (RASA2; Swiss prot No. Q15283, SEQ ID NO: 49) refers to the protein encoded by the RASA2 gene. This protein is member of the GAP1 family of GTPase-activating proteins. The protein stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Human RASA2 cDNA is set forth in NM_006506 (SEQ ID NO: 50).

The sample which is analyzed typically comprises melanocytes and may be obtained for example by taking a skin cell biopsy (surgical biopsy including incisional or excisional biopsy, fine needle aspirates and the like). Methods of biopsy retrieval are well known in the art. The cell sample may comprise cells of the primary tumor and/or metastatic effusion thereof. Thus, the cell sample may be a peripheral blood sample, lymph sample. Single cells may be used in accordance with the teachings of the present invention as well as a plurality of cells.

It will be appreciated that the control sample which is used for the sake of comparison also comprises melanocytes and is typically obtained from a healthy subject (or at least one not having a melanoma) or from the same subject prior to the onset of the cancer. It is preferable that the non-cancerous control sample come from a subject of the same species and age and from the same sub-population (e.g. smoker/nonsmoker). Alternatively, control data may be taken from databases and literature. It will be appreciated that the control sample may also be taken from the diseased subject at a particular time-point, in order to analyze the progression of the disease.

Measuring the amount and/or activity of RASA2 may be effected on the protein and/or RNA level.

In order to detect expression of RASA2 on the RNA level, typically polynucleotide probes (e.g. oligonucleotides or primers) are used that are capable of specifically hybridizing with RASA2 RNA or cDNA generated therefrom.

Preferably, the oligonucleotide probes and primers utilized by the various hybridization techniques described hereinabove are capable of hybridizing to the RASA2 under stringent hybridization conditions. By way of example, hybridization of short nucleic acids (below 200 bp in length, e.g. 17-40 bp in length) can be effected by the following hybridization protocols depending on the desired stringency; (i) hybridization solution of 6 x SSC and 1 % SDS or 3 M TMAC1, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), 0.5 % SDS, 100 μg/ml denatured salmon sperm DNA and 0.1 % nonfat dried milk, hybridization temperature of 1 - 1.5 °C below the Tm, final wash solution of 3 M TMAC1, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), 0.5 % SDS at 1 - 1.5 °C below the Tm (stringent hybridization conditions) (ii) hybridization solution of 6 x SSC and 0.1 % SDS or 3 M TMACI, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), 0.5 % SDS, 100 μg/ml denatured salmon sperm DNA and 0.1 % nonfat dried milk, hybridization temperature of 2 - 2.5 °C below the Tm, final wash solution of 3 M TMACI, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), 0.5 % SDS at 1 - 1.5 °C below the Tm, final wash solution of 6 x SSC, and final wash at 22 °C (stringent to moderate hybridization conditions); and (iii) hybridization solution of 6 x SSC and 1 % SDS or 3 M TMACI, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), 0.5 % SDS, 100 μg/ml denatured salmon sperm DNA and 0.1 % nonfat dried milk, hybridization temperature at 2.5-3 °C below the Tm and final wash solution of 6 x SSC at 22 °C (moderate hybridization solution).

It will be appreciated that in order to avoid detection of only one of the two isoforms of RASA2, it is preferable that the polynucleotide probe/primer hybridizes with RASA2 at a nucleic acid sequence which is shared by the two isoforms. Below is a list of techniques which may be used to detect RASA2 on the RNA level.

Northern Blot analysis: This method involves the detection of a particular RNA i.e. RASA2RNA in a mixture of RNAs. An RNA sample is denatured by treatment with an agent (e.g., formaldehyde) that prevents hydrogen bonding between base pairs, ensuring that all the RNA molecules have an unfolded, linear conformation. The individual RNA molecules are then separated according to size by gel electrophoresis and transferred to a nitrocellulose or a nylon-based membrane to which the denatured RNAs adhere. The membrane is then exposed to labeled DNA probes. Probes may be labeled using radio-isotopes or enzyme linked nucleotides. Detection may be using autoradiography, colorimetric reaction or chemiluminescence. This method allows both quantitation of an amount of particular RNA molecules and determination of its identity by a relative position on the membrane which is indicative of a migration distance in the gel during electrophoresis.

RT-PCR analysis: This method uses PCR amplification of relatively rare RNAs molecules. First, RNA molecules are purified from the cells and converted into complementary DNA (cDNA) using a reverse transcriptase enzyme (such as an MMLV-RT) and primers such as, oligo dT, random hexamers or gene specific primers. Then by applying gene specific primers and Taq DNA polymerase, a PCR amplification reaction is carried out in a PCR machine. Those of skills in the art are capable of selecting the length and sequence of the gene specific primers and the PCR conditions (i.e., annealing temperatures, number of cycles and the like) which are suitable for detecting specific RNA molecules. It will be appreciated that a semi-quantitative RT- PCR reaction can be employed by adjusting the number of PCR cycles and comparing the amplification product to known controls.

RNA in situ hybridization stain: In this method DNA or RNA probes are attached to the RNA molecules present in the cells. Generally, the cells are first fixed to microscopic slides to preserve the cellular structure and to prevent the RNA molecules from being degraded and then are subjected to hybridization buffer containing the labeled probe. The hybridization buffer includes reagents such as formamide and salts (e.g., sodium chloride and sodium citrate) which enable specific hybridization of the DNA or RNA probes with their target mRNA molecules in situ while avoiding nonspecific binding of probe. Those of skills in the art are capable of adjusting the hybridization conditions (i.e., temperature, concentration of salts and formamide and the like) to specific probes and types of cells. Following hybridization, any unbound probe is washed off and the slide is subjected to either a photographic emulsion which reveals signals generated using radio-labeled probes or to a colorimetric reaction which reveals signals generated using enzyme-linked labeled probes.

In situ RT-PCR stain: This method is described in Nuovo GJ, et al. [Intracellular localization of polymerase chain reaction (PCR)-amplified hepatitis C cDNA. Am J Surg Pathol. 1993, 17: 683-90] and Komminoth P, et al. [Evaluation of methods for hepatitis C virus detection in archival liver biopsies. Comparison of histology, immunohistochemistry, in situ hybridization, reverse transcriptase polymerase chain reaction (RT-PCR) and in situ RT-PCR. Pathol Res Pract. 1994, 190: 1017-25]. Briefly, the RT-PCR reaction is performed on fixed cells by incorporating labeled nucleotides to the PCR reaction. The reaction is carried on using a specific in situ RT-PCR apparatus such as the laser-capture microdissection PixCell I LCM system available from Arcturus Engineering (Mountainview, CA).

Oligonucleotide microarray - In this method oligonucleotide probes capable of specifically hybridizing with the polynucleotides of the present invention are attached to a solid surface (e.g., a glass wafer). Each oligonucleotide probe is of approximately 20- 25 nucleic acids in length. To detect the expression pattern of the polynucleotides of the present invention in a specific cell sample (e.g., blood cells), RNA is extracted from the cell sample using methods known in the art (using e.g., a TRIZOL solution, Gibco BRL, USA). Hybridization can take place using either labeled oligonucleotide probes (e.g., 5'-biotinylated probes) or labeled fragments of complementary DNA (cDNA) or RNA (cRNA). Briefly, double stranded cDNA is prepared from the RNA using reverse transcriptase (RT) (e.g., Superscript II RT), DNA ligase and DNA polymerase I, all according to manufacturer's instructions (Invitrogen Life Technologies, Frederick, MD, USA). To prepare labeled cRNA, the double stranded cDNA is subjected to an in vitro transcription reaction in the presence of biotinylated nucleotides using e.g., the BioArray High Yield RNA Transcript Labeling Kit (Enzo, Diagnostics, Affymetix Santa Clara CA). For efficient hybridization the labeled cRNA can be fragmented by incubating the RNA in 40 mM Tris Acetate (pH 8.1), 100 mM potassium acetate and 30 mM magnesium acetate for 35 minutes at 94 °C. Following hybridization, the microarray is washed and the hybridization signal is scanned using a confocal laser fluorescence scanner which measures fluorescence intensity emitted by the labeled cRNA bound to the probe arrays.

For example, in the Affymetrix microarray (Affymetrix®, Santa Clara, CA) each gene on the array is represented by a series of different oligonucleotide probes, of which, each probe pair consists of a perfect match oligonucleotide and a mismatch oligonucleotide. While the perfect match probe has a sequence exactly complimentary to the particular gene, thus enabling the measurement of the level of expression of the particular gene, the mismatch probe differs from the perfect match probe by a single base substitution at the center base position. The hybridization signal is scanned using the Agilent scanner, and the Microarray Suite software subtracts the non-specific signal resulting from the mismatch probe from the signal resulting from the perfect match probe.

Methods of detecting RASA2 on the protein level

Determining expression of RASA2on the protein level is typically effected using an antibody capable of specifically interacting with RASA2. Since RASA2 is an intracellular protein, preferably efforts are undertaken to allow for the antibody to permeabilize the membrane, when whole cells (and not cell extracts) are used. Methods of detecting RASA2 include immunoassays which include but are not limited to competitive and non-competitive assay systems using techniques such as Western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, and immunoprecipitation assays and immunohistochemical assays as detailed herein below.

It will be appreciated that in order to avoid detection of only one of the two isoforms of RASA2, it is preferable that the antibody recognizes an epitope of RASA2 which is shared by the two isoforms.

Below is a list of techniques which may be used to determine the level of RASA2 on the protein level.

Enzyme linked immunosorbent assay (ELISA): This method involves fixation of a sample (e.g., fixed cells or a proteinaceous solution) containing a protein substrate to a surface such as a well of a microtiter plate. A substrate specific antibody coupled to an enzyme is applied and allowed to bind to the substrate. Presence of the antibody is then detected and quantitated by a colorimetric reaction employing the enzyme coupled to the antibody. Enzymes commonly employed in this method include horseradish peroxidase and alkaline phosphatase. If well calibrated and within the linear range of response, the amount of substrate present in the sample is proportional to the amount of color produced. A substrate standard is generally employed to improve quantitative accuracy.

Western blot: This method involves separation of a substrate from other protein by means of an acrylamide gel followed by transfer of the substrate to a membrane (e.g., nylon or PVDF). Presence of the substrate is then detected by antibodies specific to the substrate, which are in turn detected by antibody binding reagents. Antibody binding reagents may be, for example, protein A, or other antibodies. Antibody binding reagents may be radiolabeled or enzyme linked as described hereinabove. Detection may be by autoradiography, colorimetric reaction or chemiluminescence. This method allows both quantitation of an amount of substrate and determination of its identity by a relative position on the membrane which is indicative of a migration distance in the acrylamide gel during electrophoresis.

Radio-immunoassay (RIA): In one version, this method involves precipitation of the desired protein (i.e., the substrate) with a specific antibody and radiolabeled antibody binding protein (e.g., protein A labeled with I 125 ) immobilized on a precipitable carrier such as agarose beads. The number of counts in the precipitated pellet is proportional to the amount of substrate.

In an alternate version of the RIA, a labeled substrate and an unlabelled antibody binding protein are employed. A sample containing an unknown amount of substrate is added in varying amounts. The decrease in precipitated counts from the labeled substrate is proportional to the amount of substrate in the added sample.

Fluorescence activated cell sorting (FACS): This method involves detection of a substrate in situ in cells by substrate specific antibodies. The substrate specific antibodies are linked to fluorophores. Detection is by means of a cell sorting machine which reads the wavelength of light emitted from each cell as it passes through a light beam. This method may employ two or more antibodies simultaneously.

Immunohistochemical analysis: This method involves detection of a substrate in situ in fixed cells by substrate specific antibodies. The substrate specific antibodies may be enzyme linked or linked to fluorophores. Detection is by microscopy and subjective or automatic evaluation. If enzyme linked antibodies are employed, a colorimetric reaction may be required. It will be appreciated that immunohistochemistry is often followed by counterstaining of the cell nuclei using for example Hematoxyline or Giemsa stain.

In situ activity assay: According to this method, a chromogenic substrate is applied on the cells containing an active enzyme and the enzyme catalyzes a reaction in which the substrate is decomposed to produce a chromogenic product visible by a light or a fluorescent microscope. It will be appreciated that the method of the present invention may also be performed by measuring an activity of RASA2 (via its activation of RAS, using kits known in the art).

As mentioned, the diagnosis is carried out by analyzing an amount or activity of RASA2 in a cell sample of the subject, wherein a decrease in an amount or activity of RASA2 beyond a predetermined threshold with respect to a control cell sample is indicative of the disease. The present inventors have shown that the expression level of RASA2 correlates with the progression of the disease. Thus, low expression levels indicate a later stage of the disease with a poorer prognosis, whereas high expression levels indicate an early stage of the disease with a better prognosis.

Typically, the decrease in expression and/or activity of RASA2 is statistically significant.

Preferably, the difference is at least 10 %, 20 %, 30 %, 40 %, 50 %, 80 %, 100 % (i.e., two-fold), 3 fold, 5 fold or 10 fold different as compared to the control cells.

It will be appreciated that RASA2 may also be analyzed for the presence or absence of mutations. Mutations in the RASA2 gene (and/or protein) as compared to the wild type gene are indicative that the subject may have melanoma. The protein or gene may have one mutation, or a plurality of mutations.

The mutant RASA2 polypeptides may include, but are not limited to, allelic valiants, splice variants, derivative variants, substitution variants, deletion valiants, and/or insertion variants, fusion polypeptides, orthologs, and interspecies homologs. In certain embodiments, a mutant RASA2 polypeptide includes additional residues at the C- or N-terminus, such as, but not limited to, leader sequence residues, targeting residues, amino terminal methionine residues, lysine residues, tag residues and/or fusion protein residues.

The mutations may be frameshift mutation, a nonsense mutation or a missense mutation.

Additionally, mutant RASA2 include polypeptides or gene encoding a polypeptide in which part of all of the polypeptide or gene encoding the polypeptide is deleted or absent from the cell. For example, a RASA2 protein may be produced by a cell in a truncated form. A deletion may mean the absence of all or part of a gene or protein encoded by a gene. According to a particular embodiment, the mutation is selected from the group consisting of S82F, P96L, C180 frameshift (Fs), H181L, L199Fs, G201S, P219L, I248Fs, L291P, R310* (codon stop), R355*, P363A, K387*, R397K, S400F, D496N, R511C, P530S, S590P, E608K, L764F, G780*, P796S, P843S and G846E.

The term "wild type" (WT) as used herein refers to a polypeptide or polynucleotide sequence that occurs in a native population without genetic modification. As is also understood in the art, a "mutant" includes a polypeptide or polynucleotide sequence having at least one modification to an amino acid or nucleic acid compared to the corresponding amino acid or nucleic acid found in a wild type polypeptide or polynucleotide, respectively. Included in the term mutant is Single Nucleotide Polymorphism (SNP) where a single base pair distinction exists in the sequence of a nucleic acid strand compared to the most prevalently found (wild type) nucleic acid strand.

As used herein, "genotyping" a ceil including a tumor cell from a subject (or DNA or other biological sample) for a mutation or a polymorphic allele of a gene(s) means detecting which allelic or polymorphic form(s) and/or wild type or somatically mutated form(s) of the gene(s) or gene expression products (e.g., hnRNA, mRNA or protein) are present or absent in a subject (or a sample). Related RNA or protein expressed from suc gene may also be used to detect polymorphic variation. For purposes of the present invention, "genotyping" includes the determination of somatic as well as genotypic mutations from a sample. As used herein, an allele may be 'detected' when other possible allelic variants have been ruled out; e.g., where a specified nucleic acid position is found to be neither adenine (A), thymine (T) or cytosine (C), it can be concluded that guanine (G) is present at that position (i.e., G is 'detected' or 'diagnosed' in a subject). Sequence variations may be detected directly (by, e.g. sequencing, for example, EST sequencing or partial or full genome sequencing) or indirectly (e.g., by restriction fragment length polymorphism analysis, or detection of the hybridization of a probe of known sequence, or reference strand conformation polymorphism), or by using other known methods.

The term "at least one mutation" in a polypeptide or a gene encoding a polypeptide refers to a polypeptide or gene encoding a polypeptide having one or more allelic variants, splice variants, derivative variants, substitution variants, deletion variants, truncation variants, and/or insertion variants, fusion polypeptides, orthologs, and/or interspecies homo logs. By way of example, at least one mutation of RASA2 protein would include a RASA2 protein in which part of all of the sequence of a polypeptide or gene encoding the RASA2 protein is absent or not expressed in the cell for at least one RASA2 protein produced in the cell. For example, a RASA2 protein may be produced by a cell in a truncated form and the sequence of the truncated form may be wild type over the sequence of the truncate. A deletion may mean the absence of ail or part of a gene or protein encoded by a gene. Additionally, some of a protein expressed in or encoded by a cell may be mutated while other copies of the same protein produced in the same cell may be wild type. By way of another example a mutation in a RASA2 protein would include a RASA2 protein having one or more amino acid differences in its amino acid sequence compared with wild type of the same RASA2 protein.

As used herein "genetic abnormality" is meant a deletion, substitution, addition, translocation, amplification and the like relative to the normal native nucleic acid content of a ceil of a subject. The terms "polypeptide" and "protein" are used interchangeably and are used herein as a generic term to refer to native protein, fragments, peptides, or analogs of a polypeptide sequence. Hence, native protein, fragments, and analogs are species of the polypeptide genus. The terminology "X#Y" in the context of a mutation in a polypeptide sequence is art-recognized, where "#" indicates the location of the mutation in terms of the amino acid number of the polypeptide, "X" indicates the amino acid found at that position in the wild-type amino acid sequence, and "Y" indicates the mutant amino acid at that position. For example, the notation "S4G0F" with reference to the RASA2 indicates that there is a serine at amino acid number 400 of the wild-type RASA2 sequence, and that serine is replaced with a phenylalanine in the mutant RASA2 sequence. The notation "R310X" or "R310*" with reference to RASA2 indicates that there is an arginine at amino acid number 310 of the wild type RASA2 sequence, and that arginine is replaced by a codon stop that gives rise to a truncated R AS A2 protein.

As used herein the term "amplification" refers to the presence of one or more extra gene copies in a chromosome complement. Ei certain embodiments the gene encoding R S A2 protein may be amplified in a cell. The sequence of any nucleic acid including a gene or PCR product or a fragment or portion thereof may be sequenced by any method known in the art (e.g., chemical sequencing or enzymatic sequencing). "Chemical sequencing" of DNA may denote methods such as that of Maxam and Gilbert (1977) (Proc. Natl. Acad. Sci. USA 74:560), in which DNA is randomly cleaved using individual base-specific reactions. "Enzymatic sequencing" of DNA may denote methods such as that of Sanger (Sanger, et al., (1977) Proc. Natl. Acad. Sci. USA 74:5463).

Conventional molecular biology, microbiology, and recombinant DNA techniques including sequencing techniques are well known among those skilled in the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (herein "Sambrook, et al., 1989"); DNA Cloning: A Practical Approach, Volumes I and II (D. N. Glover ed. 1985); Oligonucleotide Synthesis (M. J. Gait ed. 1984); Nucleic Acid Hybridization (B. D. Haraes & S. J. Higgins eds. (1985)); Transcription And Translation (B. D. Hames & S. J. Higgins, eds. (1984)); Animal Cell Culture (R. I. Freshney, ed. (1986)); Immobilized Cells And Enzymes (IRL Press, (1986)); B. Perbal, A Practical Guide To Molecular Cloning (1984).

To determine sequence alterations in the RASA2 gene, DNA is first obtained from a biological sample of the tested subject.

Once the sample is obtained, DNA is extracted using methods which are well known in the art, involving tissue mincing, cell lysis, protein extraction and DNA precipitation using 2 to 3 volumes of 100% ethanol, rinsing in 70% ethanol, pelleting, drying and resuspension in water or any other suitable buffer (e.g., Tris-EDTA). Preferably, following such procedure, DNA concentration is determined such as by measuring the optical density (OD) of the sample at 260 nm (wherein 1 unit OD=50 μg/ml DNA).

To determine the presence of proteins in the DNA solution, the OD 260/OD 280 ratio is determined. Preferably, only DNA preparations having an OD 260/OD 280 ratio between 1.8 and 2 are used in the following procedures described hereinbelow. The sequence alteration (or SNP) of some embodiments of the invention can be identified using a variety of methods. One option is to determine the entire gene sequence of a PCR reaction product (see sequence analysis, hereinbelow).

Alternatively, a given segment of nucleic acid may be characterized on several other levels. At the lowest resolution, the size of the molecule can be determined by electrophoresis by comparison to a known standard run on the same gel. A more detailed picture of the molecule may be achieved by cleavage with combinations of restriction enzymes prior to electrophoresis, to allow construction of an ordered map. The presence of specific sequences within the fragment can be detected by hybridization of a labeled probe, or the precise nucleotide sequence can be determined by partial chemical degradation or by primer extension in the presence of chain- terminating nucleotide analogs.

Restriction fragment length polymorphism (RFLP): This method uses a change in a single nucleotide (the SNP nucleotide) which modifies a recognition site for a restriction enzyme resulting in the creation or destruction of an RFLP. Single nucleotide mismatches in DNA heteroduplexes are also recognized and cleaved by some chemicals, providing an alternative strategy to detect single base substitutions, generically named the "Mismatch Chemical Cleavage" (MCC) (Gogos et al., Nucl. Acids Res., 18:6807-6817, 1990). However, this method requires the use of osmium tetroxide and piperidine, two highly noxious chemicals which are not suited for use in a clinical laboratory.

The DNA sample is preferably amplified prior to determining sequence alterations, since many genotyping methods require amplification of the DNA region carrying the sequence alteration of interest.

In any case, once DNA is obtained, determining the presence of a sequence alteration in the RASA2 gene is effected using methods which typically involve the use of oligonucleotides which specifically hybridize with the nucleic acid sequence alterations in the RASA2 gene, such as those described in Table 1 in the Examples section herein below.

Preferred methods of detecting sequence alterations involve directly determining the identity of the nucleotide at the alteration site by a sequencing assay, an enzyme- based mismatch detection assay, or a hybridization assay. The following is a description of some preferred methods which can be utilized by some embodiments of the invention.

Sequencing analysis - The isolated DNA is subjected to automated dideoxy terminator sequencing reactions using a dye-terminator (unlabeled primer and labeled di-deoxy nucleotides) or a dye -primer (labeled primers and unlabeled di-deoxy nucleotides) cycle sequencing protocols. For the dye-terminator reaction, a PCR reaction is performed using unlabeled PCR primers followed by a sequencing reaction in the presence of one of the primers, deoxynucleotides and labeled di-deoxy nucleotide mix. For the dye-primer reaction, a PCR reaction is performed using PCR primers conjugated to a universal or reverse primers (one at each direction) followed by a sequencing reaction in the presence of four separate mixes (correspond to the A, G, C, T nucleotides) each containing a labeled primer specific the universal or reverse sequence and the corresponding unlabeled di-deoxy nucleotides.

Microsequencing analysis - This analysis can be effected by conducting microsequencing reactions on specific regions of the RASA2 gene which may be obtained by amplification reaction (PCR) such as mentioned hereinabove. Genomic or cDNA amplification products are then subjected to automated microsequencing reactions using ddNTPs (specific fluorescence for each ddNTP) and an appropriate oligonucleotide microsequencing primer which can hybridize just upstream of the alteration site of interest. Once specifically extended at the 3' end by a DNA polymerase using a complementary fluorescent dideoxynucleotide analog (thermal cycling), the primer is precipitated to remove the unincorporated fluorescent ddNTPs. The reaction products in which fluorescent ddNTPs have been incorporated are then analyzed by electrophoresis on sequencing machines (e.g., ABI 377) to determine the identity of the incorporated base, thereby identifying the sequence alteration in the RASA2 gene of some embodiments of the invention.

It will be appreciated that the extended primer may also be analyzed by MALDI- TOF Mass Spectrometry. In this case, the base at the alteration site is identified by the mass added onto the microsequencing primer [see Haff and Smirnov, (1997) Nucleic Acids Res. 25(18):3749-50].

Solid phase microsequencing reactions can be utilized as an alternative to the microsequencing approach described above. Solid phase microsequencing reactions employ oligonucleotide micro sequencing primers or PCR-amplified products of the DNA fragment of interest which are immobilized. Immobilization can be carried out, for example, via an interaction between biotinylated DNA and streptavidin-coated microtitration wells or avidin-coated polystyrene particles.

In such solid phase microsequencing reactions, incorporated ddNTPs can either be radiolabeled [see Syvanen, (1994),] Clin Chim Acta 1994;226(2):225-236] or linked to fluorescein (see Livak and Hainer, (1994) Hum Mutat 1994;3(4):379-385]. The detection of radiolabeled ddNTPs can be achieved through scintillation-based techniques. The detection of fluorescein-linked ddNTPs can be based on the binding of antifluorescein antibody conjugated with alkaline phosphatase, followed by incubation with a chromogenic substrate (such asp-nitrophenyl phosphate).

Other reporter-detection conjugates include: ddNTP linked to dinitrophenyl (DNP) and anti-DNP alkaline phosphatase conjugate [see Harju et al., (1993) Clin Chem 39:2282-2287]; and biotinylated ddNTP and horseradish peroxidase-conjugated streptavidin with o-phenylenediamine as a substrate (see WO 92/15712).

A diagnostic kit based on fluorescein-linked ddNTP with antifluorescein antibody conjugated with alkaline phosphatase is commercially available from GamidaGen Ltd (PRONTO).

Other modifications of the microsequencing protocol are described by Nyren et al. (1993) Anal Biochem 208(1): 171-175 and Pastinen et al. (1997) Genome Research 7:606-614.

Mismatch detection assays based on polymerases and ligases - The

"Oligonucleotide Ligation Assay" (OLA) uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of target molecules. One of the oligonucleotides is biotinylated, and the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their termini abut, and create a ligation substrate that can be captured and detected. OLA is capable of detecting single nucleotide polymorphisms and may be advantageously combined with PCR as described by Nickerson et al. (1990) Proc. Natl. Acad. Sci. U.S.A. 87:8923-8927. In this method, PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA. Other amplification methods which are particularly suited for the detection of single nucleotide polymorphism include LCR (ligase chain reaction), Gap LCR (GLCR). LCR uses two pairs of probes to exponentially amplify a specific target. The sequences of each pair of oligonucleotides, is selected to permit the pair to hybridize to abutting sequences of the same strand of the target. Such hybridization forms a substrate for a template-dependent ligase. In accordance with some embodiments of the invention, LCR can be performed with oligonucleotides having the proximal and distal sequences of the same strand of a biallelic marker site. In one embodiment, either oligonucleotide will be designed to include the biallelic marker site. In such an embodiment, the reaction conditions are selected such that the oligonucleotides can be ligated together only if the target molecule either contains or lacks the specific nucleotide that is complementary to the biallelic marker on the oligonucleotide. In an alternative embodiment, the oligonucleotides will not include the biallelic marker, such that when they hybridize to the target molecule, a "gap" is created as described in WO 90/01069. This gap is then "filled" with complementary dNTPs (as mediated by DNA polymerase), or by an additional pair of oligonucleotides. Thus at the end of each cycle, each single strand has a complement capable of serving as a target during the next cycle and exponential allele- specific amplification of the desired sequence is obtained.

Ligase/Polymerase-mediated Genetic Bit Analysis™ is another method for determining the identity of a nucleotide at a preselected site in a nucleic acid molecule (WO 95/21271). This method involves the incorporation of a nucleoside triphosphate that is complementary to the nucleotide present at the preselected site onto the terminus of a primer molecule, and their subsequent ligation to a second oligonucleotide. The reaction is monitored by detecting a specific label attached to the reaction's solid phase or by detection in solution.

Hybridization Assay Methods - Hybridization based assays which allow the detection of single base alterations rely on the use of oligonucleotide which can be 10, 15, 20, or 30 to 100 nucleotides long preferably from 10 to 50, more preferably from 40 to 50 nucleotides. Typically, the oligonucleotide includes a central nucleotide complementary to a polymorphic site of the RASA2 gene and flanking nucleotide sequences spanning on each side of the central nucleotide and substantially complementary to the nucleotide sequences of the RASA2 gene spanning on each side of the polymorphic site. Sequence alteration can be detected by hybridization of the oligonucleotide of some embodiments of the invention to the template sequence under stringent hybridization reactions, as described herein above.

The detection of hybrid duplexes can be carried out by a number of methods. Typically, hybridization duplexes are separated from unhybridized nucleic acids and the labels bound to the duplexes are then detected. Such labels refer to radioactive, fluorescent, biological or enzymatic tags or labels of standard use in the art. A label can be conjugated to either the oligonucleotide probes or the nucleic acids derived from the biological sample (target). For example, oligonucleotides of some embodiments of the invention can be labeled subsequent to synthesis, by incorporating biotinylated dNTPs or rNTP, or some similar means (e.g., photo-cross-linking a psoralen derivative of biotin to RNAs), followed by addition of labeled streptavidin (e.g., phycoerythrin- conjugated streptavidin) or the equivalent.

Alternatively, when fluorescently-labeled oligonucleotide probes are used, fluorescein, lissamine, phycoerythrin, rhodamine (Perkin Elmer Cetus), Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX (Amersham) and others [e.g., Kricka et al. (1992), Academic Press San Diego, Calif] can be attached to the oligonucleotides.

Traditional hybridization assays include PCR, RT-PCR, RNase protection, in- situ hybridization, primer extension, Southern blot, Northern Blot and dot blot analysis.

Those skilled in the art will appreciate that wash steps may be employed to wash away excess target DNA or probe as well as unbound conjugate. Further, standard heterogeneous assay formats are suitable for detecting the hybrids using the labels present on the oligonucleotide primers and probes.

Two recently developed assays allow hybridization-based allele discrimination with no need for separations or washes [see Landegren U. et al., (1998) Genome Research, 8:769-776]. The TaqMan assay takes advantage of the 5' nuclease activity of Taq DNA polymerase to digest a DNA probe annealed specifically to the accumulating amplification product. TaqMan probes are labeled with a donor-acceptor dye pair that interacts via fluorescence energy transfer. CI cleavage of the TaqMan probe by the advancing polymerase during amplification dissociates the donor dye from the quenching acceptor dye, greatly increasing the donor fluorescence. All reagents necessary to detect two allelic variants can be assembled at the beginning of the reaction and the results are monitored in real time [see Livak et al., 1995 Hum Mutat 3(4):379- 385]. In an alternative homogeneous hybridization based procedure, molecular beacons are used for allele discriminations. Molecular beacons are hairpin- shaped oligonucleotide probes that report the presence of specific nucleic acids in homogeneous solutions. When they bind to their targets they undergo a conformational reorganization that restores the fluorescence of an internally quenched fluorophore (Tyagi et al., (1998) Nature Biotechnology. 16:49].

It will be appreciated that a variety of controls may be usefully employed to improve accuracy of hybridization assays. For instance, samples may be hybridized to an irrelevant probe and treated with RNAse A prior to hybridization, to assess false hybridization.

U.S. Patent No. 5,451,503 provides several examples of oligonucleotide configurations which can be utilized to detect SNPs in template DNA or RNA.

Hybridization to oligonucleotide arrays - The chip/array technology has already been applied with success in numerous cases. For example, the screening of mutations has been undertaken in the BRCAl gene, in S. cerevisiae mutant strains, and in the protease gene of HIV-1 virus [see Hacia et al., (1996) Nat Genet 1996;14(4):441-447; Shoemaker et al., (1996) Nat Genet 1996;14(4):450-456; Kozal et al., (1996) Nat Med 1996;2(7):753-759].

The nucleic acid sample which includes the candidate region to be analyzed is isolated, amplified and labeled with a reporter group. This reporter group can be a fluorescent group such as phycoerythrin. The labeled nucleic acid is then incubated with the probes immobilized on the chip using a fluidics station. For example, Manz et al. (1993) Adv. in Chromatogr 1993; 33: 1-66 describe the fabrication of fluidics devices and particularly microcapillary devices, in silicon and glass substrates.

Once the reaction is completed, the chip is inserted into a scanner and patterns of hybridization are detected. The hybridization data is collected, as a signal emitted from the reporter groups already incorporated into the nucleic acid, which is now bound to the probes attached to the chip. Probes that perfectly match a sequence of the nucleic acid sample generally produce stronger signals than those that have mismatches. Since the sequence and position of each probe immobilized on the chip is known, the identity of the nucleic acid hybridized to a given probe can be determined. For single-nucleotide polymorphism analyses, sets of four oligonucleotide probes (one for each base type), preferably sets of two oligonucleotide probes (one for each base type of the biallelic marker) are generally designed that span each position of a portion of the candidate region found in the nucleic acid sample, differing only in the identity of the polymorphic base. The relative intensity of hybridization to each series of probes at a particular location allows the identification of the base corresponding to the polymorphic base of the probe.

It will be appreciated that the use of direct electric field control improves the determination of single base mutations (Nanogen). A positive field increases the transport rate of negatively charged nucleic acids and results in a 10-fold increase of the hybridization rates. Using this technique, single base pair mismatches are detected in less than 15 sec [see Sosnowski et al., (1997) Proc Natl Acad Sci U S A 1997;94(4): 1119-1123].

Integrated Systems - Another technique which may be used to analyze sequence alterations includes multicomponent integrated systems, which miniaturize and compartmentalize processes such as PCR and capillary electrophoresis reactions in a single functional device. An example of such technique is disclosed in U.S. Pat. No. 5,589,136, which describes the integration of PCR amplification and capillary electrophoresis in chips.

Integrated systems are preferably employed along with microfluidic systems.

These systems comprise a pattern of microchannels designed onto a glass, silicon, quartz, or plastic wafer included on a microchip. The movements of the samples are controlled by electric, electro-osmotic or hydrostatic forces applied across different areas of the microchip to create functional microscopic valves and pumps with no moving parts. Varying the voltage controls the liquid flow at intersections between the micro-machined channels and changes the liquid flow rate for pumping across different sections of the microchip.

When identifying sequence alterations, a microfluidic system may integrate nucleic acid amplification, microsequencing, capillary electrophoresis and a detection method such as laser-induced fluorescence detection. In a first step, the DNA sample is amplified, preferably by PCR. The amplification product is then subjected to automated microsequencing reactions using ddNTPs (specific fluorescence for each ddNTP) and the appropriate oligonucleotide micro sequencing primers which hybridize just upstream of the targeted polymorphic base. Once the extension at the 3' end is completed, the primers are separated from the unincorporated fluorescent ddNTPs by capillary electrophoresis. The separation medium used in capillary electrophoresis can for example be polyacrylamide, polyethyleneglycol or dextran. The incorporated ddNTPs in the single-nucleotide primer extension products are identified by fluorescence detection. This microchip can be used to process 96 to 384 samples in parallel. It can use the typical four-color laser induced fluorescence detection of ddNTPs.

It will be appreciated that when utilized along with automated equipment, the above described detection methods can be used to screen multiple samples for the RASA2 alterations of some embodiments of the invention both rapidly and easily.

Allele specific oligonucleotide (ASO): In this method an allele- specific oligonucleotides (ASOs) is designed to hybridize in proximity to the polymorphic nucleotide, such that a primer extension or ligation event can be used as the indicator of a match or a mis-match. Hybridization with radioactively labeled allelic specific oligonucleotides (ASO) also has been applied to the detection of specific SNPs (Conner et al, Proc. Natl. Acad. Sci., 80:278-282, 1983). The method is based on the differences in the melting temperature of short DNA fragments differing by a single nucleotide. Stringent hybridization and washing conditions can differentiate between mutant and wild-type alleles.

Denaturing/Temperature Gradient Gel Electrophoresis (DGGE/TGGE): Two other methods rely on detecting changes in electrophoretic mobility in response to minor sequence changes. One of these methods, termed "Denaturing Gradient Gel Electrophoresis" (DGGE) is based on the observation that slightly different sequences will display different patterns of local melting when electrophoretically resolved on a gradient gel. In this manner, variants can be distinguished, as differences in melting properties of homoduplexes versus heteroduplexes differing in a single nucleotide can detect the presence of SNPs in the target sequences because of the corresponding changes in their electrophoretic mobilities. The fragments to be analyzed, usually PCR products, are "clamped" at one end by a long stretch of G-C base pairs (30-80) to allow complete denaturation of the sequence of interest without complete dissociation of the strands. The attachment of a GC "clamp" to the DNA fragments increases the fraction of mutations that can be recognized by DGGE (Abrams et al, Genomics 7:463-475, 1990). Attaching a GC clamp to one primer is critical to ensure that the amplified sequence has a low dissociation temperature (Sheffield et al, Proc. Natl. Acad. Sci., 86:232-236, 1989; and Lerman and Silverstein, Meth. Enzymol., 155:482-501, 1987). Modifications of the technique have been developed, using temperature gradients (Wartell et al., Nucl. Acids Res., 18:2699-2701, 1990), and the method can be also applied to RNA:RNA duplexes (Smith et al, Genomics 3:217-223, 1988).

Limitations on the utility of DGGE include the requirement that the denaturing conditions must be optimized for each type of DNA to be tested. Furthermore, the method requires specialized equipment to prepare the gels and maintain the needed high temperatures during electrophoresis. The expense associated with the synthesis of the clamping tail on one oligonucleotide for each sequence to be tested is also a major consideration. In addition, long running times are required for DGGE. The long running time of DGGE was shortened in a modification of DGGE called constant denaturant gel electrophoresis (CDGE) (Borrensen et al., Proc. Natl. Acad. Sci. USA 88:8405, 1991). CDGE requires that gels be performed under different denaturant conditions in order to reach high efficiency for the detection of SNPs.

A technique analogous to DGGE, termed temperature gradient gel electrophoresis (TGGE), uses a thermal gradient rather than a chemical denaturant gradient (Scholz, et al, Hum. Mol. Genet. 2:2155, 1993). TGGE requires the use of specialized equipment which can generate a temperature gradient perpendicularly oriented relative to the electrical field. TGGE can detect mutations in relatively small fragments of DNA therefore scanning of large gene segments requires the use of multiple PCR products prior to running the gel.

Single-Strand Conformation Polymorphism (SSCP): Another common method, called "Single-Strand Conformation Polymorphism" (SSCP) was developed by Hayashi, Sekya and colleagues (reviewed by Hayashi, PCR Meth. AppL, 1:34-38, 1991) and is based on the observation that single strands of nucleic acid can take on characteristic conformations in non-denaturing conditions, and these conformations influence electrophoretic mobility. The complementary strands assume sufficiently different structures that one strand may be resolved from the other. Changes in sequences within the fragment will also change the conformation, consequently altering the mobility and allowing this to be used as an assay for sequence variations (Orita, et al, Genomics 5:874-879, 1989; Orita et al. 1989, Proc. Natl. Acad. Sci. U.S.A. 86:2776-2770).

The SSCP process involves denaturing a DNA segment (e.g., a PCR product) that is labeled on both strands, followed by slow electrophoretic separation on a non- denaturing polyacrylamide gel, so that intra-molecular interactions can form and not be disturbed during the run. This technique is extremely sensitive to variations in gel composition and temperature. A serious limitation of this method is the relative difficulty encountered in comparing data generated in different laboratories, under apparently similar conditions.

Dideoxy fingerprinting (ddF): The dideoxy fingerprinting (ddF) is another technique developed to scan genes for the presence of mutations (Liu and Sommer, PCR Methods Appli., 4:97, 1994). The ddF technique combines components of Sanger dideoxy sequencing with SSCP. A dideoxy sequencing reaction is performed using one dideoxy terminator and then the reaction products are electrophoresed on nondenaturing polyacrylamide gels to detect alterations in mobility of the termination segments as in SSCP analysis. While ddF is an improvement over SSCP in terms of increased sensitivity, ddF requires the use of expensive dideoxynucleotides and this technique is still limited to the analysis of fragments of the size suitable for SSCP (i.e., fragments of 200-300 bases for optimal detection of mutations).

In addition to the above limitations, all of these methods are limited as to the size of the nucleic acid fragment that can be analyzed. For the direct sequencing approach, sequences of greater than 600 base pairs require cloning, with the consequent delays and expense of either deletion sub-cloning or primer walking, in order to cover the entire fragment. SSCP and DGGE have even more severe size limitations. Because of reduced sensitivity to sequence changes, these methods are not considered suitable for larger fragments. Although SSCP is reportedly able to detect 90 % of single-base substitutions within a 200 base-pair fragment, the detection drops to less than 50 % for 400 base pair fragments. Similarly, the sensitivity of DGGE decreases as the length of the fragment reaches 500 base-pairs. The ddF technique, as a combination of direct sequencing and SSCP, is also limited by the relatively small size of the DNA that can be screened. Pyrosequencing™ analysis (Pyrosequencing, Inc. Westborough, MA, USA): This technique is based on the hybridization of a sequencing primer to a single stranded, PCR-amplified, DNA template in the presence of DNA polymerase, ATP sulfurylase, luciferase and apyrase enzymes and the adenosine 5' phosphosulfate (APS) and luciferin substrates. In the second step the first of four deoxynucleotide triphosphates (dNTP) is added to the reaction and the DNA polymerase catalyzes the incorporation of the deoxynucleotide triphosphate into the DNA strand, if it is complementary to the base in the template strand. Each incorporation event is accompanied by release of pyrophosphate (PPi) in a quantity equimolar to the amount of incorporated nucleotide. In the last step the ATP sulfurylase quantitatively converts PPi to ATP in the presence of adenosine 5' phosphosulfate. This ATP drives the luciferase-mediated conversion of luciferin to oxyluciferin that generates visible light in amounts that are proportional to the amount of ATP. The light produced in the luciferase-catalyzed reaction is detected by a charge coupled device (CCD) camera and seen as a peak in a pyrogram™. Each light signal is proportional to the number of nucleotides incorporated.

Acycloprime™ analysis (Perkin Elmer, Boston, Massachusetts, USA): This technique is based on fluorescent polarization (FP) detection. Following PCR amplification of the sequence containing the SNP of interest, excess primer and dNTPs are removed through incubation with shrimp alkaline phosphatase (SAP) and exonuclease I. Once the enzymes are heat inactivated, the Acycloprime-FP process uses a thermostable polymerase to add one of two fluorescent terminators to a primer that ends immediately upstream of the SNP site. The terminator(s) added are identified by their increased FP and represent the allele(s) present in the original DNA sample. The Acycloprime process uses AcycloPol™, a novel mutant thermostable polymerase from the Archeon family, and a pair of Acyclo Terminators™ labeled with R110 and TAMRA, representing the possible alleles for the SNP of interest. Acyclo Terminator™ non-nucleotide analogs are biologically active with a variety of DNA polymerases. Similarly to 2', 3 '-dideoxynucleotide-5' -triphosphates, the acyclic analogs function as chain terminators. The analog is incorporated by the DNA polymerase in a base- specific manner onto the 3 '-end of the DNA chain, and since there is no 3'-hydroxyl, is unable to function in further chain elongation. It has been found that AcycloPol has a higher affinity and specificity for derivatized AcycloTerminators than various Taq mutant have for derivatized 2',3'-dideoxynucleotide terminators.

Reverse dot blot: This technique uses labeled sequence specific oligonucleotide probes and unlabeled nucleic acid samples. Activated primary amine-conjugated oligonucleotides are covalently attached to carboxylated nylon membranes. After hybridization and washing, the labeled probe, or a labeled fragment of the probe, can be released using oligomer restriction, i.e., the digestion of the duplex hybrid with a restriction enzyme. Circular spots or lines are visualized colorimetrically after hybridization through the use of streptavidin horseradish peroxidase incubation followed by development using tetramethylbenzidine and hydrogen peroxide, or via chemiluminescence after incubation with avidin alkaline phosphatase conjugate and a luminous substrate susceptible to enzyme activation, such as CSPD, followed by exposure to x-ray film.

It will be appreciated that advances in the field of SNP detection have provided additional accurate, easy, and inexpensive large-scale SNP genotyping techniques, such as dynamic allele- specific hybridization (DASH, Howell, W.M. et al., 1999. Dynamic allele- specific hybridization (DASH). Nat. Biotechnol. 17: 87-8), microplate array diagonal gel electrophoresis [MADGE, Day, I.N. et al., 1995. High-throughput genotyping using horizontal polyacrylamide gels with wells arranged for microplate array diagonal gel electrophoresis (MADGE). Biotechniques. 19: 830-5], the TaqMan system (Holland, P.M. et al., 1991. Detection of specific polymerase chain reaction product by utilizing the 5'— »3' exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci U S A. 88: 7276-80), as well as various DNA "chip" technologies such as the GeneChip microarrays (e.g., Affymetrix SNP chips) which are disclosed in U.S. Pat. Appl. No. 6,300,063 to Lipshutz, et al. 2001, which is fully incorporated herein by reference, Genetic Bit Analysis (GBA™) which is described by Goelet, P. et al. (PCT Appl. No. 92/15712), peptide nucleic acid (PNA, Ren B, et al., 2004. Nucleic Acids Res. 32: e42) and locked nucleic acids (LNA, Latorra D, et al., 2003. Hum. Mutat. 22: 79-85) probes, Molecular Beacons (Abravaya K, et al., 2003. Clin Chem Lab Med. 41: 468-74), intercalating dye [Germer, S. and Higuchi, R. Single- tube genotyping without oligonucleotide probes. Genome Res. 9:72-78 (1999)], FRET primers (Solinas A et al., 2001. Nucleic Acids Res. 29: E96), AlphaScreen (Beaudet L, et al., Genome Res. 2001, 11(4): 600-8), SNPstream (Bell PA, et al., 2002. Biotechniques. Suppl.: 70-2, 74, 76-7), Multiplex minisequencing (Curcio M, et al., 2002. Electrophoresis. 23: 1467-72), SnaPshot (Turner D, et al., 2002. Hum Immunol. 63: 508-13), MassEXTEND (Cashman JR, et al., 2001. Drug Metab Dispos. 29: 1629- 37), GOOD assay (Sauer S, and Gut IG. 2003. Rapid Commun. Mass. Spectrom. 17: 1265-72), Microarray minisequencing (Liljedahl U, et al., 2003. Pharmacogenetics. 13: 7-17), arrayed primer extension (APEX) (Tonisson N, et al., 2000. Clin. Chem. Lab. Med. 38: 165-70), Microarray primer extension (O'Meara D, et al., 2002. Nucleic Acids Res. 30: e75), Tag arrays (Fan JB, et al., 2000. Genome Res. 10: 853-60), Template- directed incorporation (TDI) (Akula N, et al., 2002. Biotechniques. 32: 1072-8), fluorescence polarization (Hsu TM, et al., 2001. Biotechniques. 31: 560, 562, 564-8), Colorimetric oligonucleotide ligation assay (OLA, Nickerson DA, et al., 1990. Proc. Natl. Acad. Sci. USA. 87: 8923-7), Sequence-coded OLA (Gasparini P, et al., 1999. J. Med. Screen. 6: 67-9), Microarray ligation, Ligase chain reaction, Padlock probes, Rolling circle amplification, Invader assay (reviewed in Shi MM. 2001. Enabling large- scale pharmacogenetic studies by high-throughput mutation detection and genotyping technologies. Clin Chem. 47: 164-72), coded microspheres (Rao KV et al., 2003. Nucleic Acids Res. 31: e66) MassArray (Leushner J, Chiu NH, 2000. Mol Diagn. 5: 341-80), heteroduplex analysis, mismatch cleavage detection, and other conventional techniques as described in Sheffield et al.(1991), White et al.(1992), Grompe et al.(1989 and 1993), exonuclease-resistant nucleotide derivative (U.S. Pat. No. 4,656,127).

Sequence alterations can also be determined at the protein level. While chromatography and electrophoretic methods are preferably used to detect large variations in RASA2 molecular weight, such as detection of a truncated RASA2 protein, immunodetection assays such as ELISA and western blot analysis, immunohistochemistry and the like, which may be effected using antibodies specific to RASA2 sequence alterations are preferably used to detect point mutations and subtle changes in molecular weight.

Thus, the invention according to some embodiments thereof also envisages the use of serum immunoglobulins, polyclonal antibodies or fragments thereof, (i.e., immunoreactive derivatives thereof), or monoclonal antibodies or fragments thereof for analyzing the amino acid sequence of RASA2 protein. Monoclonal antibodies or purified fragments of the monoclonal antibodies having at least a portion of an antigen- binding region, including the fragments described hereinbelow, chimeric or humanized antibodies and complementarily determining regions (CDR).

On obtaining the results of the analysis, the subject is typically informed. Additional diagnostic tests may also be performed so as to corroborate the results of the diagnosing (e.g. gold standard tests, assessing the aggressiveness of the tumor, the patient's health and susceptibility to treatment, etc.).

Imaging studies such as CT and/or MRI may be obtained to further diagnose the cancer/metastasis .

In addition, the diagnosis or choice of therapy may be determined by further assessing the size of the tumor, or the lymph node stage or both, optionally together or in combination with other risk factors. Other factors which may of course be assessed for determining the choice of therapy may include family history, skin shade etc. Other markers which may be analyzed include for example tyrosinase, MART-1, lactate dehydrogenase, S 100, TA90, and C-reactive protein.

Other genes may also be analyzed for the presence of mutations. Such genes include BRAF, NRAS and/or NF1. If mutations are found both on RASA2 and one of the above, then there is an increased probability that the subject has melanoma.

It will be appreciated that the tools necessary for diagnosing cancer may be provided as a kit, such as an FDA-approved kit, which may contain one or more unit dosage form containing the active agent (e.g. antibody or probe) for detection of at least one marker of the present invention. The kit may be accompanied by instructions for administration. The kit may also be accompanied by a notice in a form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions for human or veterinary administration. Such notice, for example, may include labeling approved by the U.S. Food and Drug Administration.

The information obtained by analyzing RASA2 may also be used by the clinician to recommend a suitable treatment.

Thus, if a melanoma is found to express a mutated RASA2 (or a decreased level of expression or activity of RASA2), a suitable treatment may include a RAS pathway inhibitor or an agent which up-regulates an amount and/or activity of RASA2. If mutations are found both on RASA2 and at least one of BRAF, NRAS and NF1, then a RAS pathway inhibitor or an agent which up-regulates an amount and/or activity of RASA2 for treating the melanoma may be recommended.

According to a particular embodiment, the RAS pathway inhibitor is a MEK inhibitor.

The term "MEK inhibitor" (MEKi) as used herein refers to small molecule drug compounds or neutralizing antibodies which can inhibit or interrupt the MEK step on the MAP kinase pathway. Examples of suitable MEKi may include, but are not limited to, those described as MEKi-623, MEKi-973, or GSK1120212.

Other MEK inhibitors include, but are not limited to consisting of Trametinib, cobimetinib, pimasertib, and MEK- 162.

According to another embodiment, the RAS pathway inhibitor comprises an ERK inhibitor.

The term "ERK inhibitor" as used herein, refers to an inhibitor of ERK kinase activity. An ERK inhibitor may be any type of molecule, including, but not limited to, small molecules and expression modulators (such as antisense molecules, microRNAs, siRNAs, etc.), and may act directly on the ERK protein, may interfere with expression of the ERK protein (e.g., transcription, splicing, translation, and/or post-translational processing), and/or may prevent proper intracellular localization of the ERK protein. A nonlimiting exemplary ERK inhibitor is AEZS -131.

According to another embodiment, the RAS pathway inhibitor comprises RAF inhibitor.

The term "Raf inhibitor," as used herein, refers to an inhibitor of b-Raf kinase activity and/or c-Raf kinase activity. A Raf inhibitor may be any type of molecule, including, but not limited to, small molecules and expression modulators (such as antisense molecules, microRNAs, siRNAs, etc.), and may act directly on the Raf protein, may interfere with expression of the Raf protein (e.g., transcription, splicing, translation, and/or post-translational processing), and/or may prevent proper intracellular localization of the Raf protein. Nonlimiting exemplary Raf inhibitors include sorafenib tosylate, GDC-0879, PLX-4720, regorafenib, PLX-4032, SB-590885-R, RAF265, GW5074, XL281, and GSK2118436.

Other exemplary B-RAF inhibitors include Vemurafenib or Dabrafenib. According to a particular embodiment, the agent used for treating a melanoma patient (which has a mutation in RASA2 or a decreased level of expression or activity of RASA2) is one which upregulates an amount and/or activity of wild-type RASA2.

Such agents include those which are capable of increasing the transcription (for example a transcription factor known to interact with the 5'untranslated region of RASA2) of RASA2, the translation of RASA2 or the stability of RASA2.

Additionally, the agent which increases the amount of wild-type RASA2, may be a polynucleotide which encodes RASA2, the protein itself or an active peptide thereof.

As mentioned, the RASA2 may be administered to the subject in need thereof as polynucleotides where they are expressed in vivo i.e. gene therapy.

The phrase "gene therapy" as used herein refers to the transfer of genetic material (e.g. DNA or RNA) of interest into a host to treat or prevent a genetic or acquired disease or condition or phenotype. The genetic material of interest encodes a product (e.g. a protein, polypeptide, peptide, functional RNA, antisense) whose production in vivo is desired. For example, the genetic material of interest can encode a hormone, receptor, enzyme, polypeptide or peptide of therapeutic value. For review see, in general, the text "Gene Therapy" (Advanced in Pharmacology 40, Academic Press, 1997).

Two basic approaches to gene therapy have evolved: (1) ex vivo and (2) in vivo gene therapy. In ex vivo gene therapy cells are removed from a patient, and while being cultured are treated in vitro. Generally, a functional replacement gene is introduced into the cell via an appropriate gene delivery vehicle/method (transfection, transduction, homologous recombination, etc.) and an expression system as needed and then the modified cells are expanded in culture and returned to the host/patient. These genetically reimplanted cells have been shown to express the transfected genetic material in situ. The cells may be autologous or non-autologous to the subject. Since non- autologous cells are likely to induce an immune reaction when administered to the body several approaches have been developed to reduce the likelihood of rejection of non-autologous cells. These include either suppressing the recipient immune system or encapsulating the non-autologous cells in immunoisolating, semipermeable membranes before transplantation. In in vivo gene therapy, target cells are not removed from the subject rather the genetic material to be transferred is introduced into the cells of the recipient organism in situ, that is within the recipient. These genetically altered cells have been shown to express the transfected genetic material in situ.

To confer specificity, preferably the nucleic acid constructs used to express the

RASA2 of the present invention comprise cell-specific promoter sequence elements.

Recombinant viral vectors are useful for in vivo expression of the RASA2 of the present invention since they offer advantages such as lateral infection and targeting specificity. Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny. Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.

The agents used to up-regulate RASA2 may be provided per se or as part of a pharmaceutical composition.

As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

Herein the term "active ingredient" refers to the agent which up-regulates RASA2, accountable for the biological effect.

Hereinafter, the phrases "physiologically acceptable carrier" and

"pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.

Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.

Techniques for formulation and administration of drugs may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.

Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal, or intraocular injections.

Conventional approaches for drug delivery to the central nervous system (CNS) include: neurosurgical strategies (e.g., intracerebral injection or intracerebroventricular infusion); molecular manipulation of the agent (e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB) in an attempt to exploit one of the endogenous transport pathways of the BBB; pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers); and the transitory disruption of the integrity of the BBB by hyperosmotic disruption (resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide). However, each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method.

Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient. Pharmaceutical compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

Pharmaceutical compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.

For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

For administration by nasal inhalation, the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro- tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran.

Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.

The pharmaceutical composition of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.

Pharmaceutical compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (RAS2 upregulating agent) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., skin cancer) or prolong the survival of the subject being treated.

Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p. l). Dosage amount and interval may be adjusted individually to provide blood or brain levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.

The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

It is expected that during the life of a patent maturing from this application many relevant RAS pathway inhibitors will be developed and the scope of the term RAS pathway inhibitor is intended to include all such new technologies a priori.

As used herein the term "about" refers to ± 10 %.

The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to".

The term "consisting of means "including and limited to".

The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging/ranges between" a first indicate number and a second indicate number and "ranging/ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

As used herein, the term "treating" includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.

When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES

Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.

Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley- Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference. MATERIALS AND METHODS

Tumor tissues: All DNA samples used in this study were derived from metastases. Samples used for whole-exome capture were extracted from cell lines established directly from patient tumors as described previously 17. DNA subjected to whole-genome sequencing was extracted from OCT embedded specimens as described previously 17. Tissue was further collected and cell lines established at QIMR Berghofer Medical Research Institute. All cell lines were established as described previously with informed patient consent under a protocol approved by the QIMR Berghofer Medical Research Institute Human Research Ethics Committee.

PCR, sequencing and mutational analysis: PCR and sequencing of RASA2 was done as previously described 18. Sequence traces were analyzed using the Mutation Surveyor software package (SoftGenetics). Primers used are listed in Table 1, herein below.

Table 1

Prime Primer

r Coverag

Name e Forward Primer Sequence Reverse Primer Sequence

Rasa2 CATTAATATGTTCTTTCAGA TTCTCAGCACAACTCTGCA

_seq_2 Exon 2 TTGAAGT (SEQ ID NO: 1) CT (SEQ ID NO: 2)

Rasa2 GAAGGGGAGCATCACACA GCCTCCCTGAGAAAGTGT

_seq_3 Exon 3 CT (SEQ ID NO: 3) CA (SEQ ID NO: 4)

Rasa2 TTCAAAATGACCCAGACAA CAGAGAATCAAGACAGAC

_seq_4 Exon 4 ATG (SEQ ID NO: 5) AAAATCA (SEQ ID NO: 6)

Rasa2 AATGCTGGTTTATCTTCTGG CCCTTATCCTTAATGCCCA

_seq_5 Exon 5 AAA (SEQ ID NO: 7) TA (SEQ ID NO: 8)

Rasa2 CTGCAGACACATGGAAAAC TCAGCAGTTTTTCTACAGT

_seq_6 Exon 6 AA (SEQ ID NO: 9) TGGA (SEQ ID NO: 10)

Rasa2 CAACATAGATGAAGGTGCT GGTAAGGGAGGGTGCAAA

_seq_7 Exon 7 CTAAATC (SEQ ID NO: 11) G (SEQ ID NO: 12)

Rasa2 TTCCTCTGCTTTTATCCACA GTTAACATCACACCTACA

_seq_8 Exon 8 A (SEQ ID NO: 13) CATGC (SEQ ID NO: 14)

Rasa2 AGTGAGGTATGTATATGGT GGGTGTGGTGAAGGAAGA

_seq_9 Exon 9 GTTGCTAA (SEQ ID NO: 15) AC (SEQ ID NO: 16)

Rasa2

_seq_l TGTAATATCTATGCTTTTTG CTGTTCAATCACTAGCCTG

0 Exon 10 TTTCCTG (SEQ ID NO: 17) TAAAA (SEQ ID NO: 18)

Rasa2

_seq_l AAGGATATGATTTAACACG AAGGTAGGTGAATACTGT

1 Exon 11 AAACG (SEQ ID NO: 19) TTGATAGC (SEQ ID NO: 20)

Rasa2 GCAAGCTTTTAAATAAATG TTCTAAGTAGTCTGACAA

_seq_l Exon 12 GTAAAAAT (SEQ ID NO: 21) AATGAAAAT (SEQ ID NO: 2 22)

Rasa2 AAATAGACTGAACACTTTA

_seq_l GAAGCAAAT (SEQ ID NO: AGCCCAAAGGAATGGCTA

3 Exon 13 23) GA (SEQ ID NO: 24)

Rasa2

_seq_l TGAATGAGTTTGGAAAAGG CACGCCTGTAATCCCAGA

4 Exon 14 GTAA (SEQ ID NO: 25) AA (SEQ ID NO: 26)

Rasa2

_seq_l TCTTCTTGCAGGTGAGGAA CCCCTTTGTACTCATCACC

5 Exon 15 AG (SEQ ID NO: 27) A (SEQ ID NO: 28)

Rasa2

_seq_l AATTCCTTAGGCTGGTGAG TTTAAAACTTCTAGAGAC

6 Exon 16 TTG (SEQ ID NO: 29) AGGGTCTT (SEQ ID NO: 30)

Rasa2

_seq_l CAAGAGAGCCTAGTAAGG GCTGTCAAAACAGGGGCA

7 Exon 17 AGGTG (SEQ ID NO: 31) TA (SEQ ID NO: 32)

Rasa2

_seq_l TCATTTGTAAATTAGGGAT TTTTGCTATCCATGACTGT

8 Exon 18 TTCCTC (SEQ ID NO: 33) TGC (SEQ ID NO: 34)

Rasa2

_seq_l GGGGGAACCACTCATTTGA AGTTAAAGAAACTCCCAT

9 Exon 19 C (SEQ ID NO: 35) GTTCTAA (SEQ ID NO: 36)

Rasa2

_seq_2 TGGTCACTTTAGAAGACAA TGGACAGATAGCTTGGGA

0 Exon 20 TCAAAAT (SEQ ID NO: 37) CTG (SEQ ID NO: 38)

Rasa2

_seq_2 AACAATTCCCTCCCTTTATT TCAGATAATACGTGGCCTT

1 Exon 21 CTT (SEQ ID NO: 39) TATGA (SEQ ID NO: 40)

Rasa2

_seq_2 AGTCACATAACAACCAAAA GAATAATCATCAGGCTCTT

2 Exon 22 CTCTCC (SEQ ID NO: 41) TCTGT (SEQ ID NO: 42)

Rasa2

_seq_2 AGAGGCATTTTTCATTGAC ACAAAGAGCACTTGGAGT

3 Exon 23 ATTC (SEQ ID NO: 43) GG (SEQ ID NO: 44)

Rasa2

_seq_2 TGATGGCAAGGGTTTTCTT GCAGGCACTGATGGTAGT

4 Exon 24 G (SEQ ID NO: 45) GA (SEQ ID NO: 46)

Statistical analyses: To evaluate whether the frequency of somatic mutations is significantly higher than would be expected if the mutations were neutral, a statistical test was performed. The null hypothesis was that the probability of a mutation at a specific base is the neutral rate of 11.4 mutations/Mb (i.e. p=11.4e-6). The present inventors computed a one-sided p-value using the pbinom function in the R statistical software. To determine whether the ratio of nonsynonymous to synonymous mutations observed was statistically significant, the exact binomial test was used, with an expected ratio of 2.5: 1 ⁹. All the statistical calculations were performed in the R statistical environment. Further statistical analyses were performed using Microsoft Excel to generate p-values to determine significance (two-tailed t-test). Red arrows in Figures 1A-G include frameshift, nonsense and deleterious mutations based on SIFT analysis.

CytoScan array processing and analysis: Samples were prepared according to Affymetrix protocols (Affymetrix, Inc). DNA quality and quantity was ensured using Bioanalyzer (Agilent, Inc) and NanoDrop (Thermo Scientific, Inc) respectively. Per DNA labeling, 200 nanograms of genomic DNA were used in conjunction with the Affymetrix recommended protocol for CytoScan HD array kit and reagents (catalog# 901835).

The hybridization cocktail containing the fragmented and labeled DNAs was hybridized to The Affymetrix CytoScan HD GeneChip. The chips were washed and stained by the Affymetrix Fluidics Station using the standard format and protocols as described by Affymetrix. The probe arrays were stained with streptavidin phycoerythrin solution (Molecular Probes, Carlsbad, CA) and enhanced by using an antibody solution containing 0.5 mg/mL of biotinylated anti- streptavidin (Vector Laboratories, Burlingame, CA). An Affymetrix Gene Chip Scanner 3000 was used to scan the probe arrays. The (dot)Cel files were generated from the scanned images using Affymetrix AGCC software and the (dot)cyhd(dot)cychp files were generated by the Chromosome Analysis Suite (ChAS) Version 2.1 software. All the analyses were done with ChAS default parameters for LOH and Copy Number State (CNS).

Construction of wild-type and mutant RASA2 expression vectors: Human RASA2 cDNA (NM_006506) was cloned from HEK293T cDNA using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies, Santa Clara, CA) according to manufacturers' instructions and the following forward and reverse primers respectively; 5'-atcatctagagccaccatggattacaaggatgacgac- gataaggcggcggcggcgcctgc-3' (SEQ ID NO: 47) and 5'-tggtcagcggccgcctaagatgctttcccaacaattgg- attttcc-3' (SEQ ID NO: 48). A FLAG tag was introduced onto the N-terminus of RASA2 during the cloning procedure. PCR products were cloned into the pCDFl-MCS2-EFl-Puro vector (Systems Biosciences, Inc., Mountain View, CA) via the Xbal and Notl restriction sites. The p.S400F mutation was introduced using fusion PCR site directed mutagenesis and the p.R310X mutation was created by using an alternative reverse primer to introduce the relevant nonsense mutation/stop codon.

RASA2 immunohistochemistry: RASA2 immunohistochemistry (IHC) was performed on AJCC Stage III melanoma tumor microarrays (TMAs). It was performed using rabbit polyclonal anti-RASA2 antibody from Sigma-Aldrich (HPA035375) on a DAKO IHC autostainer using DAKO EnVison FLEX+ detection system as per manufactures instructions (high pH antigen retrieval, primary antibody dilution 1: 100 for 60min).

Resultant predominant IHC signal was cytoplasmic. Cases were scored as percent of cytoplasmic positive tumor cells (0-100) and overall tumor staining intensity

(0 - 4). Typically in positive samples, there was homogeneous staining across all tumor cells. The intensity of staining ranged from weak to strong.

TMA cohort description: Samples eligible for this TMA were obtained at the

Melanoma Institute Australia Biospecimen Bank from AJCC stage-Ill (lymph node) metastatic melanoma specimens in which macroscopic tumor was observed, from patients believed to be without distant metastases at the time of tumor banking based on clinical examination and computerized axial tomographic scanning of the brain, chest, abdomen, and pelvis. Key covariates were balanced in this cohort to permit survival analysis.

Western blotting: 501Mel cells stables with RASA2-FLAG (WT, mutant or empty vector) were gently washed 2X in PBS and then lysed using 1.0 ml 1% NP-40 lysis buffer (1% NP-40, 50 mM Tris-HCl pH 7.5, 150 mM NaCl, Complete Protease Inhibitor tablet, EDTA-free (Roche, Indianapolis, IN), ΙμΜ sodium orthovanadate, 1 mM sodium fluoride, and 0.1% β-mercaptoethanol) per T-75 flask for 20 minutes on ice. Lysed cells were scraped and transferred into a 1.5 mL microcentrifuge tube. Extracts were centrifuged for 10 minutes at 14,000 rpm at 4°C. Proteins (50 μg) were resolved on 10% SDS-polyacrylamide gels and transferred to nitrocellulose membranes (Biorad). Western blots were probed with the following antibodies anti-FLAG (M2) (Sigma-Aldrich) and GAPDH (Millipore). Ras-GTP levels were determined using a RAS activation Assay Kit (EMD Millipore).

Pooled stable expression: To produce lentivirus, RASA2 constructs were co- transfected into HEK 293T cells seeded at 2.5X10⁶ per T75 flask with pVSV-G and pFIV-34N (kind gifts from Todd Waldman, Georgetown University) helper plasmids using Lipofectamine 2000 as described by the manufacturer. Virus-containing media was harvested 60hr after transfection, filtered, aliquoted and stored at -80 C.

501Mel, A375 and 108T cells were grown in RPMI-1640 (Biological Industries) and supplemented with 10% fetal bovine serum (HyClone, Logan, UT). Lentivirus for RASA2 (WT, R310X and S400F) and empty vector control were used to infect the cells as previously described ¹⁹. Stable expression of RASA2 proteins (WT and mutants) was determined by SDS-PAGE analysis followed by immunoblotting with anti-FLAG and anti-GAPDH to show equivalent expression among pools.

siRNA depletion of endogenous RASA2: Specific siRNA pool (ON-Targetplus) designed using siRNA design program for human RASA2 was purchased from Dharmacon (Thermo Fisher Scientific). A mixture of four siRNAs was used to transiently deplete RASA2 in malignant melanoma cells. Using DharmaFECT transfection reagent #1 (specific for siRNA), melanoma cells were transfected with 50 nM siRNA Smart pool in the presence of OptiMEM-I medium. Cells were incubated for 72 h post-transfection before checking RAS-GTP levels by the RAS Activation Assay Kit (Millipore).

Proliferation assays: To examine cell growth, melanoma cell lines (501 Mel, A375 and 108T) stably infected with either vector, WT RASA2, R310X mutant or S400F mutant RASA2 were seeded into 96 well plates at 500-2000 cells per well and incubated for 7-17 days. Samples were analyzed every 48 hrs by lysing cells in 50 μΐ 0.2% SDS/well and incubating for 2 hour at 37°C prior to addition of 150 μΐ/well of SYBR Green I solution (1:750 SYBR Green I (Invitrogen-Molecular Probes) diluted in d¾0).

Soft agar assay: A375 and 501Mel pooled RASA2 clones were plated in duplicate at 1000 cells/well in top plugs consisting of sterile 0.33% Bacto-Agar (BD, Sparks, MD) and 10% , 5% or 2.5% fetal bovine serum (HyClone, Logan, UT) in a 24- well plate. The lower plug contained sterile 0.5% Bacto-Agar and 10%, 5% or 2.5% fetal bovine serum. After one week, the colonies were counted.

Lentiviral shRNA: All shRNA expression constructs were obtained from Open

Biosystems. NIH 3T3 cells were infected with shRNA for each condition (vector control and two independent mouse ?A5A2-specific shRNAs) and selected. The shRNA constructs used in this study were: sh50 (TRCN0000034350) and sh51 (TRCN0000034351).

3D Ras-RASA2 model prediction: The complex between human HRAS bound to guanosine triphosphatase (GTPase)-activating domain of the human GTPase- activating protein pl20GAP (GAP-334), lWQl.pdb [Scheffzek, K. et al. Science (New York, N Y ) 277, 333-8 (1997)], both RASA2 (1WQ1 chain G, GAP-334) and Mg²⁺- NRAS-GTP (1WQ1 chain R, HRAS) models. GAP-334 sequence present in the PDB file is shorter than RASA2, but it covers the binding interface, is bound to RAS, and has high similarity with the query. Sequence alignment and homology modeling were performed with Prime (version 4.0, Schrodinger, LLC, New York, NY, 2014). The initial X-ray structure 1WQ1 contains the substrate GDP-A1F3 bound to HRAS. A1F3 molecule, that is thought to mimic the 24

γ-phosphate moiety of GTP , was manually replaced with the γ- phosphate group bound to GDP.

Hydrogen atoms and side chain orientations of the GTP-NRAS-RASA2 complex were optimized with the Protein Preparation Wizard tool from Schrodinger at physiological pH. Side chains were refined with the Predict Side Chains tool available in Prime. The complex GTP-NRAS-(WT)RASA2 was used as input for DUET server [Pires, D.E.V., Ascher, D.B. & Blundell, T.L. Nucleic acids research 42, W314-9 (2014)]. Both complexes GTP-NRAS-(WT)RASA2 and GTP-NRAS-(S400F)RASA2 were then minimized to a derivative convergence of 0.05 kJ/mol-A using the Polak- Ribiere Conjugate Gradient (PRCG) minimization algorithm, the OPLS2005 force field and the GB/SA water solvation model implemented in MacroModel (version 10.8, Schrodinger, LLC, New York, NY, 2014): the finger loop was set to be free to move, a shell 5 A around the loop minimized applying a force constant of 200 kJ/molA , and another shell of 5 A with a constant force of 300 kJ/molA .

RESULTS

The present inventors compiled somatic mutation data from 501 melanoma whole exome/genome sequencing sources which included The Cancer Genome Atlas (TCGA) 2 3. Data were analyzed as previously described 8 (The data for RASA2 is presented in Table 2, herein below). Table 2

Gene name RASA2

Total (cDNA size includes UTR) 2592

Coding bases (just coding) 2550

3'UTR

5'Flank

5'UTR

Frame_Shift_Del 1

Frame_Shift_Ins 2

IGR

In_Frame_Del

In_Frame_Ins

Intron 5

Mis sense_Mutation 21

Nonsense_Mutation 6

Nonstop_Mutation

RNA

Silent 3

Splice_Site

Translation_S tart_S ite

cDNA mutations 33 coding mutations 33 cDNA mutations/MB (includes UTR) 25.41213869

Coding mutations/MB 25.83069156

Total All mutation 38

All coding mutations 33

All coding mutations - Silent 30

LOF mutations 9

% of tumors with mutation 6.39

% of tumors with coding mutation 5.99

% of tumors with coding mutation - silent 5.39

% of tumors with LOF mutation 1.40

% of tumors with Nonsense Mutation 1.00

% LOF of all mutations 23.68

% LOF of all coding mutations 27.27

% LOF of all coding mutations - Silent 30.00

% nonsense of all mutations 15.79

% nonsense of all coding mutations 18.18

% nonsense of all coding -Silent 20.00

% nonsense of all LOF mutations 66.67 exome coverage X 501 samples 749997

All Mut/Mb 44

NS Mut/Mb 40

Nonsynonymous total 30

Synonymous total 3

NS:S Ratio 10.0

NS:S p value 2 to 1 0.001284845

Mutational frequency p value 0.000131808

Genes were ranked based on the non- synonymous mutation frequency, number of mutations per megabase and mutation rate (taking into account the base coverage), as previously described ⁹. To search for new potential tumor suppressor genes within this list, the present inventors identified genes with deleterious alterations (nonsense or frameshift mutations) in at least 20% of the cases, a suggested threshold for this type of gene ¹⁰. As expected, the highest ranking genes were the well documented melanoma tumor suppressors TP53, NFl, ARID2, CDKN2A, and PTEN. After excluding these, RASA2 was identified, for which 27% of tumors harbored loss of function (LOF) mutations (Table 3).

Table 3

Melanoma driver genes that harbor at least 20% loss of function mutations

Genes were ranked based on the non-synonymous frequency, mutations per megabase, mutation rate (taking into account the base coverage) and presence of deleterious (nonsense or frameshift) mutations in at least 20% of the cases.

The copy number landscape of 22 samples was profiled using the CytoScan High Definition array (Affymetrix) and 3 focal deletions were found (13.6%). Thus, RASA2 is a potential tumor suppressor gene in melanoma (Table 3, Table 4, and Figure 8). As noted in Table 4, the genes adjacent to RASA2 are not significantly affected, suggesting RASA2 specific events. The distribution of the 35 non-synonymous mutations identified in RASA2 is shown schematically in Figure 1A.

Table 4 - Examination of the percentage of null gene events in the TCGA dataset.

Category Gene Null fractions (%) p-value

Tumor suppressor gene RASA2 1 0.05

Tumor suppressor gene PTEN 6.6 0.0003

Tumor suppressor gene TP 53 1 0.01

Tumor suppressor gene NF1 0 0.6

Tumor suppressor gene CDKN2A 29 2.07E-05

Tumor suppressor gene SETD2 0 0.6

Tumor suppressor gene ARID2 0 0.6

Gene adjacent to RASA2 ZBTB38 0.6 0.12

Gene adjacent to RASA2 RNF7 0.3 0.3

Gene adjacent to RASA2 GRK7 0.3 0.3

Gene adjacent to RASA2 ACPL2 0.3 0.3 p-value normalized to the total number of events per sample

RASA2 encodes a member of the GAP1 family of GTPase-activating proteins, the RAS p21 protein activator 2. The gene product stimulates the GTPase activity of wild-type (WT) RAS p21 but not its oncogenic form. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS 11 ' 12. Notably, NF1, which also encodes a RAS -specific GAP, has recently been shown to be mutated and to play a central role in melanoma 2 ' 3 ' 13. Mutations in RASA2 and NF1 co-occur strongly (p- value: 0.000011 [Fisher's Exact Test], suggesting that they have non-overlapping functions (Figure IB). Examination of RASA2 mutations in publicly available databases revealed that RASA2 is mutated in several other tumor types (Figure 2).

To test whether RASA2 is a tumor suppressor in melanoma, its expression was knocked down in immortalized, non-tumorigenic NIH3T3 cells, using two short hairpin RNA (shRNA) constructs. RASA2 knockdown resulted in RAS activation (Figure 9A), leading to increased cell growth on plastic and in soft agar (Figure 9B).

Based on the compiled genetic data, RASA2 was considered to be an attractive candidate tumor suppressor gene in melanoma. To characterize the tumorigenic effects of RASA2, the present inventors functionally characterized two recurrent RASA2 mutations: R310X, which causes RASA2 truncation, and S400F in the catalytic RAS- GAP domain. They established stable pooled clones expressing vector control, WT or mutant (R310X and S400F) RASA2. The melanoma cell lines A375 (BRAF V600E), 501Mel (BRAF V600E) and 108T (WT BRAF) and 55T (BRAF WT, NRAS WT, NF1 mutant) were selected as they express WT RASA2. Similar levels of RASA2 protein in A375, 501Mel and 108T stable clone cell lines were detected (Figure 3). Since RASA2 encodes a RAS GTPase activating protein (RasGAP), it was hypothesized that RASA2 mutation or loss would alleviate RAS suppression. Indeed, modeling the RASA2 mutants on the structure of pl20GAP predicts that the RASA2 p.Arg310* mutant is unable to bind to Ras as it lacks the RAS-GAP, PH and BTK domains. Although the RASA2 p.Ser400Phe mutant is expected to bind Ras, the mutation is likely to affect the stabilization of its catalytic site, which may disturb structural changes necessary for GAP catalysis, leading to increased Ras activity (Figures lOA-C).

To test this hypothesis, both gain and loss-of-function studies were performed. Overexpression of WT RASA2 substantially suppressed RAS-GTP levels; in contrast both RASA2 mutants increased RAS-GTP levels (Figure ICi and Figure 4A). Conversely in melanoma cells that retain RASA2 expression, RNA interference (RNAi) -mediated suppression of RASA2 lead to the activation of RAS (Figs. ICii, ICiii and Figure 4B).

Importantly, re-introduction of WT RASA2 into melanoma cells that harbor

RASA2 mutations (76T: p.Arg310* and C084: p.Ser400Phe) inhibited RAS activation (Figure 11).

To examine the effects of RASA2 mutations on proliferation and colony forming ability, cell growth in vitro was investigated. In the presence of media containing 10% serum, all clones grew similarly (Figure 5A). However, in reduced serum concentration, WT clones grew at a lower rate than mutant clones (Figure ID and Figure 5A). This difference in cell growth was also observed when the cells were assessed for anchorage independence, where cells expressing mutant RASA2 formed a significantly higher number of colonies compared to WT or empty vector (Figure IE and Figure 5B; P < 0.005 t-test), consistent with the notion that RASA2 mutations play a causal role in melanoma. In agreement with the tumor suppressor role of RASA2, overexpression of WT RASA2 in melanoma cells that harbor RASA2 mutations (C084 and 76T) led to reduced cell growth (Figures 12A-B) and diminished anchorage independent growth (Figure 12C).

As previous studies reported that activation of RAS increases cell migration ¹⁴ , the present inventors examined whether mutated RASA2 also affects cell migration after seeding A375, 108T or 501Mel pooled clones in serum-free medium. Mutant RASA2 expression increased migration compared to WT RASA2 or cells containing an empty vector (Figure 6; P < 0.0001 t-test).

To validate the extent to which RASA2 protein expression is lost in human melanoma tumors and to assess its association with prognosis, RASA2 immunohistochemistry (IHC) was performed on a cohort of AJCC stage III melanomas by tissue microarray (TMA) (Figures 7A-B) ^{15 16}. Cases were scored as percent of cytoplasmic positive tumor cells (0-100) and overall tumor staining intensity (0 - 4). It was found that RASA2 expression was completely absent in 34% (27 of 80) of cases and was substantially decreased in another 31% (25 of 80) of human melanomas (Figure

IF) . Kaplan-Meier plot and log-rank tests showed that loss of RASA2 expression was significantly associated with poorer survival, HR = 0.36 (0.14-0.91), p = 0.024 (Figure

IG) . These results further emphasize the role of RASA2 loss in melanoma progression and indicate it has prognostic relevance.

The present discovery of the high frequency of inactivating somatic mutations in RASA2 together with the functional data indicating its effect on cell growth and migration, suggests that RASA2 is an important tumor suppressor in human melanoma. Particularly important is the fact that RASA2 suppression provides an alternative mechanism of RAS activation in melanoma. Despite decades of research on GAPs, this is the first study that demonstrates that melanomas have previously uncharacterized somatic mutations in the RASA2 gene, leading to impaired RASA2 activity and constitutive activation of RAS signaling.

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

REFERENCES

1. Siegel, R., Naishadham, D. & Jemal, A. CA Cancer J Clin 62, 283-98 (2012).

2. Hodis, E. et al. Cell 150, 251-63 (2012).

3. Krauthammer, M. et al. Nat Genet 44, 1006- 14 (2012).

4. Flaherty, K.T. et al. N Engl J Med 363, 809-19 (2010).

5. Chapman, P.B. et al. N Engl J Med 364, 2507-16 (2011).

6. Lemmon, M.A. & Schlessinger, J. Cell 141, 1117-34 (2010).

7. Vivanco, I. & Sawyers, C.L. Nat Rev Cancer 2, 489-501 (2002).

8. Dutton-Regester, K. et al. Oncotarget 5, 2912-7 (2014).

9. Sjoblom, T. et al. Science 314, 268-74 (2006).

10. Vogelstein, B. et al. Science 339, 1546-58 (2013).

11. Abdellatif, M. & Schneider, M.D. Journal of Biological Chemistry! 272, 525-533 (1997).

12. Clark, G.J., Westwick, J.K. & Der, C.J. Journal of Biological Chemistry 272,

1677-1681 (1997).

13. Maertens, O. et al. Cancer Discov 3, 338-49 (2013).

14. Fang, J.Y. & Richardson, B.C. Lancet Oncol 6, 322-7 (2005).

15. Mann, G.J. et al. J Invest Dermatol 133, 509- 17 (2013).

16. Jayawardana, K. et al. Int J Cancer 136, 863-74 (2015).

17. Wei, X. et al. Nat Genet 43, 442-6 (2011).

18. Palavalli, L.H. et al. Nat Genet 41, 518-20 (2009).

19. Solomon, D.A. et al. Cancer Res 68, 10300-6 (2008).

Claims

Applications Claiming Priority (4)

Publications (1)

Family

ID=55361914

Family Applications (1)

Country Status (1)

Cited By (1)

Citations (32)

• 2016
  • 2016-01-21 WO PCT/IL2016/050068 patent/WO2016116935A1/en active Application Filing

Patent Citations (33)

Non-Patent Citations (114)

Similar Documents

Legal Events