WO2016177774A1

WO2016177774A1 - Method of quantifying mirnas using normalization

Info

Publication number: WO2016177774A1
Application number: PCT/EP2016/059988
Authority: WO
Inventors: Sara Johanna Pinto-Sietsma; Esther Elisa Johanna Maria Creemers; Josephus Cornelis Maria Meijers; Maayke Guda Maria KOK; Pieter MOERLAND
Original assignee: Academisch Medisch Centrum
Priority date: 2015-05-04
Filing date: 2016-05-04
Publication date: 2016-11-10
Also published as: EP3292214A1

Abstract

The invention relates to methods for quantification of the amount of target mi RNA in biological samples using normalization. In particular, the invention relates to methods for quantifying mi RNAs in serum, whole bold or platelets samples. The invention further relates to kits for quantifying the amount of a target mi RNA in a biological sample.

Description

TITLE METHOD OF QUANTIFYING MIRNAS USING NORMALIZATION

TECHNICAL FIELD OF THE INVENTION

The invention relates to methods for quantification of the amount of target miRNA in biological samples using normalization. In particular, the invention relates to methods for quantifying miRNAs in serum, whole blood or platelets samples. The invention further relates to kits for quantifying the amount of a target miRNA in a biological sample.

BACKGROUND OF THE INVENTION

MicroRNAs (miRNAs) are 18 to 25 nucleotides long, noncoding RNAs that regulate gene expression post-transcriptionally by targeting the 3 '-untranslated region of specific mRNAs. Hereby, several biological processes, like cell differentiation and apoptosis, are affected. The past decade, many studies have shown the pathophysiological involvement of miRNAs, and several miRNAs were reported as useful biomarkers for specific diseases.

Because of its high sensitivity, specificity and reproducibility, quantitative polymerase chain reaction (qPCR) is the most commonly used method to detect specific miRNAs. To obtain reliable qPCR results, normalization is a necessity to correct for possible processing variations between samples. To date, many ways of miRNA data normalization are known; however there is no consensus on an appropriate method yet. The three most commonly used strategies are: normalization to the geometrical mean of all detected miRNAs, normalization to a single endogenous control (for example RNU6b, miR-16), and the use of a spike-in. Pros and cons have been described for all these normalization methods, but none of them seems ideal for universal use in qPCR experiments.

Therefore, the inventors believe it is necessary to develop a standardized method for the normalization of qPCR experiments on circulating miRNAs.

The rapid increase in publications reporting the use of circulating miRNAs as biomarker has fuelled the debate on how to properly perform miRNA detection experiments. It is widely accepted that RT- qPCR is the technique of choice for quantification, because of its high specificity and accuracy. However, the accuracy of the test results is completely dependent on proper data normalization. Therefore, the best method of data normalization remains point of discussion. The three most commonly used strategies for normalization of miRNA qPCR experiments are: normalization to the geometrical mean of all detected miRNAs, normalization to a single endogenous control (RNU6b, miR-16), and the use of a spike-in. Concerning the first normalisation method, normalization to the geometrical mean, this method is not sensitive enough. Normalisation to the geometrical mean requires the detection of many miRNAs, whereas in most experiments too few miRNAs are detected, to reliably use this method. Concerning the normalisation method of spike-in, this method has some major draw backs. Several investigators report the use of a synthetic spike-in. Although this method starts with an equal amount of spike-in for each sample, it only corrects for either extraction or reverse transcription efficiency, depending on the moment when the spike-in is added to the sample. Since it is virtually impossible to add the spike-in exactly at the same time in all samples, especially when a large samples size is used, the actual time of adding the spike-in will already influence the results. As such, the use of a spike -in does not correct for all experimental variability, and is therefore a less reliable normalization method. Normalization to a endogenous control seems to overcome these problems. However, the reliability is completely dependent on which miRNA is selected for the normalization. Initially, small RNAs such as RNU6B are often used to normalize, but increasing evidence reveals the regulation of these molecules in pathology. Furthermore, these RNAs are either related to pathology or not stably expressed at a high enough level to serve as a reliable for use in normalization of miRNA qPCR.

EP2354246A1 discloses a method a method for diagnosing a disease, comprising the steps (a) determining an expression profile of a predetermined set of miRNAs in a biological sample from a patient; and (b) comparing said expression profile to a reference expression profile (from a healthy subject), wherein the comparison of said determined expression profile to said reference expression profile allows for the diagnosis of the disease. According to [0043], the reference expression profile is the expression profile of the same set of miRNAs in a biological sample originating from the same source as the biological sample from a patient but obtained from a healthy subject. The disadvantage of using the same miRNA as a reference control is that there is no correction for inter sample variation.

It is an object of the invention to present a method of normalization which overcomes one or more drawbacks of the known normalisation methods.

SUMMARY OF THE INVENTION

Herein, the inventors propose a novel, more standardized method for the normalization of RT-qPCR experiments on circulating miRNAs. The invention is based on the surprising finding of a miRNA panel comprising miRNAs that are stably expressed in the circulation of healthy individuals and which are not related to a disease. These miRNA may therefore be used as normalization panel which can be universally used for miRNA qPCR experiments on circulating miRNAs.

Candidate miRNAs with a stable expression were selected from miRNA microarray experiments from the GEO database of either whole blood, isolated platelet' s or serum array experiments. For each sample type the inventors selected those miRNAs that were least variable and sufficiently highly expressed in available array experiments, performed on at least two different platforms. The stability of these candidate normalization miRNAs was further assessed using the geNorm and Normfinder algorithms in a qPCR cohort of 10 patients with coronary artery disease and 10 healthy controls, resulting in a suitable normalization panel. The inventors constructed normalization panels for the normalization of miRNA qPCR experiments which are specifically suitable for use in whole blood, isolated platelets and serum samples. Furthermore, in a series of additional validation experiments in whole blood, the inventors confirmed that the performance of the whole blood normalization panel is superior to other frequently used normalization methods on precision and reproducibility measures. Herein, the inventors further show that the use of RNU6B for the normalization of qPCR experiments on circulating miRNAs is not feasible, since RNU6B is not reliably detectable in the circulation. Besides, Mir- 16, which was apart from our normalisation panel the best normalisation candidate, showed les precision and less accuracy as normalisation miRNA as compared to the different normalisation panels. Although it has been reported that specific miRNAs that can be used for normalisation, their use is limited to the diseased population in which they were studied and by no means can be viewed of as a universal normalisation method. To overcome the problem of using disease specific miRNAs for normalization the inventors selected data on healthy controls from multiple microarray experiments studying a variety of diseases. Exclusion of candidate miRNAs that were reported to be regulated in any disease and the use of the geNorm and Normfinder algorithms resulted in a panel of stably expressed normalization miRNAs. Thus, the combination of including different miRNA micro-array experiments in the selection procedure and the use of two independent algorithms to select the most stable normalization miRNAs has led to the selection of reliable normalization panels for circulating miRNAs that can universally be used.

The invention provides a method of quantifying the amount of a target microRNA (miRNA) in a biological sample, the method comprising: determining the amount of the target miRNA in the biological sample; determining the amount of at least a first reference miRNA selected from the group consisting of miR-1280 , miR-1260a miR-718, miR-484, MiR-130b-3p, miR-342-3p miR-151-3p, miR-28-5p, miR-331-3p, miR-29c-3p, miR-148b-3p and miR-18a-5p, in the biological sample; and normalizing the target miRNA measurement based on the amount of at least said first reference miRNA. Preferably, said first reference miRNA and said target miRNA are not the same. In a preferred embodiment said group consists of miR-130b-3p, miR-342-3p, miR-1280, miR- 1260a, miR- 718, miR-151a-3p, miR-331-3p, miR-29c-3p, miR-148b-3p and miR-18a-5p.

In a preferred embodiment, said method further comprises measuring a second reference miRNA of said group in the biological sample and normalizing the target miRNA levels to the first miRNA and the second reference miRNA. Preferably, said second reference miRNA and said target miRNA are not the same. Preferably, said method further comprises amplifying the target miRNA and the at least one reference miRNA in the reaction volume. Said amplification preferably includes realtime polymerase chain reaction amplification. In a preferred embodiment, said first and second reference miRNA is selected from the group consisting of miR-130b-3p and miR-342-3p. An advantage of these miRNAs is that they are very stable in biological samples comprising whole blood. In a preferred embodiment, said first and second reference miRNA is selected from the group consisting of miR-1280, miR-1260a miR-718, miR-484, more preferably miR-1280 and miR-1260a. An advantage of these miRNAs is that they are very stable in biological samples of serum. In another preferred embodiment, said first and second reference miRNA are said first and second reference miRNA is selected from the group consisting of miR-151a-3p, miR-28-5p, miR-331-3p, miR-29c-3p, miR-148b-3p and miR-18a-5p, more preferably miR-148b-3p and miR-18a-5p. An advantage thereof is that these miRNAs are very stable in biological samples comprising isolated platelets. In another preferred embodiment, a combination of 6 miRNAs (miR-151a-3p, miR-28-5p, miR-331-3p, miR- 29c-3p, miR-148b-3p and miR-18a-5p) is used for normalization, as this combination has the lowest V value.

In a preferred embodiment of the method of the invention said biological sample comprises serum, whole blood or platelets.

The invention further provides a kit for quantifying the amount of a target miRNA in a biological sample comprising an amplification primer set, comprising at least one primer comprising a sequence that is complementary to a portion of said first reference miRNA as defined above.

Preferably, said amplification primer set further comprises a sequence that is complementary to a portion of said second reference miRNA as defined above. Preferably, the kit of the invention further comprises a second amplification primer set, wherein at least one primer comprises a sequence that is complementary to a portion of a target miRNA. Preferably, the kit according to the invention further comprises a first probe comprising a sequence that is complementary to a portion of the target miRNA and a second probe comprising a sequence that is complementary to a portion of the reference miRNA, wherein the first and second probes are distinguishably detectable. BRIEF DESCRIPTION OF THE FIGURES

Figure 1 (A) shows the ranking of candidate normalization miRNAs according to average expression stability. In a stepwise manner, the least stable miRNAs with the highest M values were excluded until miR-130b-3p and miR-342-3p remained. Figure 1(B) shows the determination of the optimal number of normalization miRNAs. The optimal normalization panel consists of the number of miRNAs with the lowest V value. In this case the optimal V value is achieved when using 2 normalization miRNAs.

Figure 2 shows the precision of two normalisation methods, either normalisation with MIR- 16 or with the normalisation panel. Figure 2 (A) shows the correlation between two identical qPCR

measurements of miR-494 measured in whole blood on the same sample and normalised for the whole blood normalization panel. This shows a significant correlation of 0.68. Figure 2 (B) shows the correlation between two identical qPCR measurements of miR-494 measured in whole blood on the same sample and normalised for miR-16. This shows worse results with a correlation of 0.27.

Figure 3shows the accuracy analysis of the isolated platelet normalization panel. Previous miRNA microarray experiments showed that variable X is positively correlated with miR-A expression. (A) Using qPCR without any normalization method the inventors were not able to confirm these data. (B) When qPCR data was normalized for the whole blood normalization panel the correlation between variable X and miR-A expression could be confirmed.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

As used herein, the term "microRNA" (miRNA) includes human miRNAs, mature single stranded miRNAs, precursor miRNAs, and variants thereof, which may be naturally occurring or synthetic. Synthetic or naturally occurring miRNAs may be modified to include chemical groups other than hydroxy or phosphate at their 5' termini, sugar, and/or base modifications. In some instances the term "miRNA" also includes primary miRNA transcripts and duplex miRNAs. The term includes target miRNAs, miRNAs, and reference miRNAs (see below). The term "mature," when modifying miRNA or a specific miRNA, refers to the mature sequence(s) processed from the corresponding pre- miRNA sequence that are present in a biological sample. The sequences for particular miRNAs, including human mature and precursor sequences, are reported in the miRBase: Sequences Database (http:/microrna.sanger.ac.uk; Griffiths-Jones et al., Nucleic Acids Research, 2006, 34, Database Issue, D140-D144; Griffiths-Jones, Nucleic Acids Research, 2004, 32, Database Issue, D109-D111). The skilled artisan will appreciate that scientific consensus regarding the precise nucleic acid sequence for a given miRNA, in particular for mature forms of the miRNAs, may change with time. MiRNAs detected by assays of this application include naturally occurring sequences for the miRNAs.

The terms miR-1280, miR-1260a, miR-718, miR-484, MiR-130b-3p, miR-342-3p miR-151- 3p, miR-28-5p, miR-331-3p, miR-29c-3p, miR-148b-3p, miR-18a-5p and so on as used herein refer to the miRNAs as retrieved in miRBase version 21. Exemplary sequences of the miRNAs are listed in Table 1.

Table. 1 : Overview of the miRNAs and their sequences

1. miR- ■1260a AUCCCACCUCUGCCACCA

2. miR- ^■1280 UCCCACCGCUGCCACCC

3. miR- ^■130b-3p CAGUGCAAUGAUGAAAGGGCAU

4. miR- ■29c-3p UAGCACCAUUUGAAAUCGGUUA

5. miR- ^■148b-3p UCAGUGCAUCACAGAACUUUGU

6. miR- ^■18a-5p UAAGGUGCAUCUAGUGCAGAUAG

7. miR- ■548e-3p AAAAACUGAGACUACUUUUGCA

8. miR- ^■ 19b- 1 -5p: AGUUUUGC AGGUUUGC AUCCAGC

9. miR- -1271 : CUUGGC ACCU AGC A AGC ACUC A

10. miR- ^■1537-5p: AGCUGUAAUUAGUCAGUUUUCU

11. miR- ^■151-3p: CUAGACUGAAGCUCCUUGAGG

12. miR- ^■28-5p: AAGGAGCUCACAGUCUAUUGAG

13. miR- ■331-3p: GCCCCUGGGCCUAUCCUAGAA

14. miR- ■29c: UAGCACCAUUUGAAAUCGGUUA 15. miR-1225-3p: UGAGCCCCUGUGCCGCCCCCAG

16. miR-587: UUUCCAUAGGUGAUGAGUCAC

17. miR-718: CUUCCGCCCCGCCGGGCGUCG

18. miR-484: UCAGGCUCAGUCCCCUCCCGAU

19. miR-342-3p: UCUCACACAGAAAUCGCACCCGU

The term "target miRNA" refers to any miRNA of interest.

Detailed description of the embodiments

I. Methods to Determine the Amount of a miRNA

Many methods of quantifying miRNAs are contemplated. Any reliable, sensitive, and specific method can be used. In some embodiments provided, a target miRNA or reference miRNA is preferably amplified prior to or during quantification. In other embodiments, the miRNA is not amplified as part of the quantification process.

A. Amplification Reactions Many methods exist for amplifying miRNA nucleic acid sequences such as mature miRNAs, precursor miRNAs, and primary miRNAs. Suitable nucleic acid polymerization and amplification techniques include reverse transcription (RT), polymerase chain reaction (PCR), real-time PCR (quantitative PCR (q-PCR)), nucleic acid sequence-base amplification (NASBA), ligase chain reaction, multiplex ligatable probe amplification, invader technology (Third Wave), rolling circle amplification, in vitro transcription (IVT), strand displacement amplification, transcription-mediated amplification (TMA), RNA (Eberwine) amplification, and other methods that are known to persons skilled in the art. In certain preferred embodiments, more than one amplification method is used, such as reverse transcription followed by real time PCR (Chen et al., Nucleic Acids Research, 33(20):el79 (2005)).

A typical PCR reaction includes multiple amplification steps, or cycles that selectively amplify target nucleic acid species. A typical PCR reaction includes three steps: a denaturing step in which a target nucleic acid is denatured; an annealing step in which a set of PCR primers (forward and reverse primers) anneal to complementary DNA strands; and an elongation step in which a thermostable DNA polymerase elongates the primers. By repeating these steps multiple times, a DNA fragment is amplified to produce an amplicon, corresponding to the target DNA sequence. Typical PCR reactions include 20 or more cycles of denaturation, annealing, and elongation. In many cases, the annealing and elongation steps can be performed concurrently, in which case the cycle contains only two steps. Since mature miRNAs are single-stranded, a reverse transcription reaction (which produces a complementary cDNA sequence) is performed prior to PCR reactions. Reverse transcription reactions include the use of, e.g., a RNA -based DNA polymerase (reverse transcriptase) and a primer.

In PCR and q-PCR methods, for example, a set of primers is used for each target sequence. In certain embodiments, the lengths of the primers depends on many factors, including, but not limited to, the desired hybridization temperature between the primers, the target nucleic acid sequence, and the complexity of the different target nucleic acid sequences to be amplified. In preferred

embodiments, a primer is about 15 to about 35 nucleotides in length. In other preferred embodiments, a primer is equal to or fewer than 15, 20, 25, 30, or 35 nucleotides in length. In additional preferred embodiments, a primer is at least 35 nucleotides in length.

In preferred embodiments of the invention, a forward primer can comprise at least one sequence that anneals to a target miRNA and alternatively can comprise an additional 5' non- complementary region. In another embodiment, a reverse primer can be designed to anneal to the complement of a reverse transcribed miRNA. The reverse primer may be independent of the target miRNA or reference miRNA sequence, and multiple target miRNAs or reference miRNAs may be amplified using the same reverse primer. Alternatively, a reverse primer may be specific for a target miRNA.

In some preferred embodiments, two or more miRNAs are amplified in a single reaction volume (one or more target miRNAs and one, two, three, or more reference miRNAs, for example). Normalization may alternatively be performed in separate reaction volumes. One preferred embodiment includes multiplex q-PCR, such as qRT-PCR, which enables simultaneous amplification and quantification of at least one miRNA of interest and at least one reference miRNA in one reaction volume by using more than one pair of primers and/or more than one probe. The primer pairs may comprise at least one amplification primer that uniquely binds each miRNA, and the probes are preferably labeled such that they are distinguishable from one another, thus allowing simultaneous quantification of multiple miRNAs. Multiplex qRT-PCR has research and diagnostic uses, including but not limited to detection of miRNAs for diagnostic, prognostic, and therapeutic applications.

A single combined reaction for q-PCR, is desirable for several reasons: (1) decreased risk of experimenter error, (2) reduction in assay-to-assay variability, (3) decreased risk of target or product contamination, and (4) increased assay speed. The qRT-PCR reaction may further be combined with the reverse transcription reaction by including both a reverse transcriptase and a DNA -based thermostable DNA polymerase. When two polymerases are used, a "hot start" approach may be used to maximize assay performance (U.S. Pat. Nos. 5,411 ,876 and 5,985,619). For example, the components for a reverse transcriptase reaction and a PCR reaction may be sequestered using one or more thermoactivation methods or chemical alteration to improve polymerization efficiency (U.S. Pat. Nos. 5,550,044, 5,413,924, and 6,403,341). B. Detection of miRNAs

In preferred embodiments, labels, dyes, or labeled probes and/or primers are used to detect amplified or unamplified miRNAs. Depending on the sensitivity of the detection method and the abundance of the target, for example, amplification may or may not be required prior to detection. One skilled in the art will recognize the detection methods where miRNA amplification is preferred.

A probe or primer may include Watson-Crick bases or modified bases. Modified bases include, but are not limited to, the AEGIS bases (from Eragen Biosciences), which have been described, e.g., in U.S. Pat. Nos. 5,432,272, 5,965,364, and 6,001,983. In certain preferred embodiments, bases are joined by a natural phosphodiester bond or a different chemical linkage. Different chemical linkages include, but are not limited to, a peptide bond or a Locked Nucleic Acid (LNA) linkage, which is described, e.g., in U.S. Pat. No. 7,060,809.

In a preferred embodiment, oligonucleotide probes or primers present in a multiplex amplification are suitable for monitoring the amount of amplification product produced as a function of time. In certain preferred embodiments, probes having different single stranded versus double stranded character are used to detect the nucleic acid. Probes include, but are not limited to, the 5'- exonuclease assay (e.g., TaqMan(TM)) probes (see U.S. Pat. No. 5,538,848), stem-loop molecular beacons (see, e.g., U.S. Pat. Nos. 6,103,476 and 5,925,517), stemless or linear beacons (see, e.g., WO 9921881, U.S. Pat. Nos. 6,485,901 and 6,649,349), peptide nucleic acid (PNA) Molecular Beacons (see, e.g., U.S. Pat. Nos. 6,355,421 and 6,593,091), linear PNA beacons (see, e.g. U.S. Pat. No.

6,329,144), non-FRET probes (see, e.g., U.S. Pat. No. 6,150,097),

Sunrise(TM)/AmplifluorB(TM)probes (see, e.g., U.S. Pat. No. 6,548,250), stem-loop and duplex Scorpion(TM) probes (see, e.g., U.S. Pat. No. 6,589,743), bulge loop probes (see, e.g., U.S. Pat. No. 6,590,091), pseudo knot probes (see, e.g., U.S. Pat. No. 6,548,250), cyclicons (see, e.g., U.S. Pat. No. 6,383,752), MGB Eclipse(TM) probe (Epoch Biosciences), hairpin probes (see, e.g., U.S. Pat. No. 6,596,490), PNA light-up probes, antiprimer quench probes (Li et al., Clin. Chem. 53:624-633 (2006)), self-assembled nanoparticle probes, and ferrocene-modified probes described, for example, in U.S. Pat. No. 6,485,901.

In certain preferred embodiments, one or more of the primers in an amplification reaction can include a label. In yet further embodiments, different probes or primers comprise detectable labels that are distinguishable from one another. In some preferred embodiments a nucleic acid, such as the probe or primer, may be labeled with two or more distinguishable labels.

In preferred embodiments, a label is attached to one or more probes and has one or more of the following properties: (i) provides a detectable signal; (ii) interacts with a second label to modify the detectable signal provided by the second label, e.g., FRET (Fluorescent Resonance Energy Transfer); (iii) stabilizes hybridization, e.g., duplex formation; and (iv) provides a member of a binding complex or affinity set, e.g., affinity, antibody-antigen, ionic complexes, hapten-ligand (e.g., biotin-avidin). In still other embodiments, use of labels can be accomplished using any one of a large number of known techniques employing known labels, linkages, linking groups, reagents, reaction conditions, and analysis and purification methods.

MiRNAs can be detected by direct or indirect methods. In a direct detection method, one or more miRNAs are detected by a detectable label that is linked to a nucleic acid molecule. In such methods, the miRNAs may be labeled prior to binding to the probe. Therefore, binding is detected by screening for the labeled miRNA that is bound to the probe. The probe is optionally linked to a bead in the reaction volume.

In certain preferred embodiments, nucleic acids are detected by direct binding with a labeled probe, and the probe is subsequently detected. In one preferred embodiment of the invention, the nucleic acids, such as amplified miRNAs, are detected using FlexMAP Microspheres (Luminex) conjugated with probes to capture the desired nucleic acids. Some methods may involve detection with polynucleotide probes modified with fluorescent labels or branched DNA (bDNA) detection, for example.

In other preferred embodiments, nucleic acids are detected by indirect detection methods. In such an embodiment, it is preferred that a biotinylated probe is combined with a streptavidin- conjugated dye to detect the bound nucleic acid. The streptavidin molecule binds a biotin label on amplified miRNA, and the bound miRNA is detected by detecting the dye molecule attached to the streptavidin molecule. In one embodiment, the streptavidin-conjugated dye molecule comprises

Phycolink(R) Streptavidin R-Phycoerythrin (PROzyme). Other conjugated dye molecules are known to persons skilled in the art.

Labels include, but are not limited to: light-emitting, light-scattering, and light-absorbing compounds which generate or quench a detectable fluorescent, chemiluminescent, or bioluminescent signal (see, e.g., Kricka, L., Nonisotopic DNA Probe Techniquies, Academic Press, San Diego (1992) and Garman A., Non-Radioactive Labeling, Academic Press (1997).). Fluorescent reporter dyes useful as labels include, but are not limited to, fluoresceins (see, e.g., U.S. Pat. Nos. 5,188,934, 6,008,379, and 6,020,481), rhodamines (see, e.g., U.S. Pat. Nos. 5,366,860, 5,847,162, 5,936,087, 6,051,719, and 6,191,278), benzophenoxazines (see, e.g., U.S. Pat. No. 6,140,500), energy-transfer fluorescent dyes, comprising pairs of donors and acceptors (see, e.g., U.S. Pat. Nos. 5,863,727; 5,800,996; and

5,945,526), and cyanines (see, e.g., WO 9745539), lissamine, phycoerythrin, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX (Amersham), Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY -TMR, BODIPY-TRX, Cascade Blue, Cy3, Cy5, 6- FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, Tetramethylrhodamine, and/or Texas Red, as well as any other fluorescent moiety capable of generating a detectable signal. Examples of fluorescein dyes include, but are not limited to, 6- carboxyfluorescein; 2',4',1,4,-tetrachlorofluorescein; and 2',4',5',7',1,4-hexachlorofluorescein. In certain preferred embodiments, the fluorescent label is selected from SYBR-Green, 6- carboxyfluorescein ("FAM"), TET, ROX, VIC(TM), and JOE. For example, in certain preferred embodiments, labels are different fluorophores capable of emitting light at different, spectrally- resolvable wavelengths (e.g., 4-differently colored fluorophores); certain such labeled probes are known in the art and described above, and in U.S. Pat. No. 6,140,054. A dual labeled fluorescent probe that includes a reporter fluorophore and a quencher fluorophore is used in some preferred embodiments. It will be appreciated that pairs of fluorophores are chosen that have distinct emission spectra so that they can be easily distinguished.

In still a further preferred embodiment, labels are hybridization-stabilizing moieties which serve to enhance, stabilize, or influence hybridization of duplexes, e.g., intercalators and intercalating dyes (including, but not limited to, ethidium bromide and SYBR-Green), minor-groove binders, and cross-linking functional groups (see, e.g., Blackburn et al., eds. "DNA and RNA Structure" in Nucleic Acids in Chemistry and Biology (1996)).

In further preferred embodiments, methods relying on hybridization and/or ligation to quantify miRNAs may be used, including oligonucleotide ligation (OLA) methods and methods that allow a distinguishable probe that hybridizes to the target nucleic acid sequence to be separated from an unbound probe. As an example, HARP-like probes, as disclosed in U.S. Publication No.

2006/0078894 (incorporated herein by reference) may be used to measure the quantity of miRNAs. In such methods, after hybridization between a probe and the targeted nucleic acid, the probe is modified to distinguish the hybridized probe from the unhybridized probe. Thereafter, the probe may be amplified and/or detected. In general, a probe inactivation region comprises a subset of nucleotides within the target hybridization region of the probe. To reduce or prevent amplification or detection of a HARP probe that is not hybridized to its target nucleic acid, and thus allow detection of the target nucleic acid, a post-hybridization probe inactivation step is carried out using an agent which is able to distinguish between a HARP probe that is hybridized to its targeted nucleic acid sequence and the corresponding the unhybridized HARP probe. The agent is able to inactivate or modify unhybridized HARP probe such that it cannot be amplified.

In an additional preferred embodiment of the method, a probe ligation reaction may be used to quantify miRNAs. In a Multiplex Ligation-dependent Probe Amplification (MLPA) technique

(Schouten et al., Nucleic Acids Research 30:e57 (2002)) pairs of probes which hybridize immediately adjacent to each other on the target nucleic acid are ligated to each other only in the presence of the target nucleic acid. In some preferred embodiments, MLPA probes have flanking PCR primer binding sites. MLPA probes can only be amplified if they have been ligated, thus allowing for detection and quantification of target miRNA or reference miRNA.

II. Normalization Methods of normalization and kits for normalizing miRNA detection assays are provided herein. The methods correct for sample-to-sample variability by comparing a target measurement in a sample to one or more internal controls. Normalization of miRNA quantification assays reduces systematic (non-biological) and non-systematic differences between samples, and is critical for accurate measurement of differential miRNA expression, for example.

The accurate measurement of biologically hardwired differential expression between two groups of samples is the goal of many miRNA qRT-PCR assays. Yet, miRNA levels in qRT-PCR reactions can vary from one sample to the next for reasons that may be technical or biological.

Technical reasons may include variabilities in tissue procurement or storage, inconsistencies in RNA extraction or quantification, or differences in the efficiency of the reverse transcription and/or PCR steps. Biological reasons may include sample-to-sample heterogeneity in cellular populations, differences in bulk transcriptional activity, or alterations in specific miRNA expression that is linked to an aberrant biological program (e.g., a disease state). Given the multiplicity of sources that can contribute to differences in miRNA quantification, results from qRT-PCR assays should be normalized against a relevant endogenous target or targets to minimize controllable variation, and permit definitive interpretations of nominal differences in miRNA expression.

Preferred embodiments comprise multiplex methods for quantifying and normalizing the amount of target miRNA in a biological sample. In a preferred embodiment of the invention, the amount of one or more target miRNAs is measured in a reaction volume, and the amount of at least said first reference miRNA measured in the reaction volume. The amount of target miRNA is normalized based on the amount of at least said first reference miRNA. In some preferred embodiments, two or three reference further miRNAs are measured. In other preferred embodiments, further reference miRNAs are measured. In other embodiments, the one or more target miRNA measurements are normalized to the measurement of two, three, four, or more reference miRNAs. For example, Luminex technology allows for detection of as many as 100 unique analytes in one sample. As such, a much larger number of normalizers can potentially be exploited in Luminex miRNA assays. Indeed, the FlexMir assay includes 4 snoRNAs as controls for signal normalization. In additional embodiments, the relative expression of a target miRNA in two or more biological samples can be quantified and normalized to the amount of a reference miRNA.

For experiments using only one miRNA for normalization, the data are normalized to the measured quantity of said one reference miRNA. When two or more reference miRNAs are used as normalizers, a mean of the normalizers (e.g. arithmetic mean or geometric mean) is preferably used, depending on the nature of the quantification data. For example, the threshold cycle (Ct) values obtained from q-PCR experiments may be normalized to the geometric mean of two or more normalizers. Data represented on a linear scale (absolute expression data) may be normalized to an arithmetic mean of normalizers. Additional methods of combining normalizers are also contemplated, such as weighted averages.

In some embodiments, expression levels may be normalized using a comparative Ct method for relative quantification between samples or sample types. The general methods for conducting such assays are described, e.g., in Real-Time PCR Systems: Applied Biosystems 7900HT Fast Real-Time PCR System, and 7300/7500 Real-Time PCR Systems, Chemistry Guide, Applied Biosystems, 2005, Part No. 4348358.

Many additional methods of normalization are well known to those skilled in the art, and all normalization methods are contemplated. Those skilled in the art will recognize the appropriate normalization methods for each quantification and detection method described herein.

III. Reference MiRNAs

Preferred embodiments of the invention include measuring the amount of at least one reference miRNA, and normalizing the amount of a target miRNA to the amount of at least one miRNA(s). Further normalizers suitable for use in the claimed methods are stably expressed and do not show significant differential expression in healthy or in diseased individuals.

In preferred embodiments, said normalizers are identified using the NormFinder (Andersen et al., Cancer Res. 64 (15):5245-5250 (2004)) or geNorm (Vandesompele et. al., Genome Biol. 3(7): research 0034.1 -0034.11 (2002)) algorithms based on various qRT-PCR data from human cell and tissue collections. Additional statistical methods are known in the art for identifying stably expressed members of a group, and are also contemplated for use to identify miRNA normalizers. In certain embodiments, normalizers are identified by using the NormFinder or geNorm algorithms to analyze data from normal and disease tissue samples. There are many suitable reference samples that can be used to identify reference miRNAs. In preferred embodiments, normalizers are identified using both NormFinder and geNorm.

Preferred embodiments include measuring the amount of a target miRNA and a reference miRNA, and normalizing the target miRNA level to the reference miRNAs. Additional preferred embodiments include measuring the amount of a first and a second reference miRNA, and normalizing the target miRNA level to the first and second miRNAs. Further preferred embodiments include quantifying the relative expression of target miRNAs between biological samples by (a) measuring the amount of a target miRNA and a first reference miRNA in a first biological sample, (b) measuring the amount of a target miRNA sequence and the first reference miRNA in a second biological sample, and (c) normalizing the target miRNA level to the reference miRNA level for the first and second sample.

In the methods described herein, the one or more reference miRNA(s) is/are chosen from miR-

1280, miR-1260a miR-718, miR-484, MiR-130b-3p, miR-342-3p miR-151a-3p, miR-28-5p, miR-331- 3p, miR-29c-3p, miR-148b-3p and miR-18a-5p. In a preferred embodiment, the one or more reference miRNA(s) is/are chosen from miR- miR-1280, miR- 1260a miR-718 and miR-484. These miRNAs have been found to be highly suitable for normalization of miRNAs in serum samples. In a highly preferred embodiment, the one or more reference miRNA(s) is/are chosen from miR- miR-1280 and miR-1260a, as this combination has an excellent stability value.

In another preferred embodiment, the one or more reference miRNA(s) is/are chosen from MiR-130b-3p, miR-342-3p. These miRNAs have been found to be highly suitable for normalization of miRNAs in whole blood samples.

In a yet another preferred embodiment, the one or more reference miRNA(s) is/are chosen from miR- miR-151a-3p, miR-28-5p, miR-331-3p, miR-29c-3p, miR-148b-3p and miR-18a-5p. These miRNAs have been found to be highly suitable for normalization of miRNAs in platelets samples. In a highly preferred embodiment, the one or more reference miRNA(s) is/are chosen from , miR-148b-3p and miR-18a-5p, as this combination has an excellent stability value.

In all aspects of the invention it is preferred not to include more than 6 miRNAs for normalization. In other preferred embodiments, not more than 5, 4, 3 or 2 miRNAs.

IV Biological samples

In the normalization methods provided herein, the amount of target miRNA in a biological sample is normalized to the amount of at least one reference miRNA in the biological sample.

A "biological sample" is any sample or specimen derived from a human. For example, the biological sample may be a patient sample. A "patient sample" is any biological specimen from a patient. The term includes, but is not limited to, biological fluids such as blood, serum, plasma, urine, cerebrospinal fluid, tears, saliva, lymph, dialysis fluid, lavage fluid, semen, and other liquid samples, as well as cells and tissues of biological origin. The term also includes cells isolated from a human or cells derived therefrom, including cells in culture, cell supernatants, and cell lysates. It further includes organ or tissue culture-derived fluids, tissue biopsy samples, tumor biopsy samples, stool samples, and fluids extracted from physiological tissues, as well as cells dissociated from solid tissues, tissue sections, and cell lysates. A biological sample may be obtained or derived from tissue types including but not limited to lung, liver, placenta, bladder, brain, heart, colon, thymus, ovary, adipose, stomach, prostate, uterus, skin, muscle, cartilage, breast, spleen, pancreas, kidney, eye, bone, intestine, esophagus, lymph nodes and glands. The term "biological sample" encompasses samples that have been manipulated in any way after their procurement, such as by treatment with preservatives, cellular disruption agents (e.g. lysing agents), solubilization, purification, or enrichment for certain components, such as polynucleotides, in certain aspects. Also, derivatives and fractions of patient samples are included. A sample may be obtained or derived from a patient having, suspected of having, or recovering from a disease or pathological condition. Diseases and pathological conditions include, but are not limited to, proliferative, inflammatory, immune, metabolic, infectious, and ischemic diseases. Diseases (e.g. cancers) also include neural, immune system, muscular, reproductive, gastrointestinal, pulmonary, cardiovascular, and renal diseases, disorders, and conditions. In a preferred embodiment said biological sample comprises serum, whole blood or platelets

V. Kits

In another aspect, the invention provides kits of reagents and macromolecules for carrying out the normalization assays provided herein. In one embodiment, the invention provides a kit for quantifying a target miRNA sequence and a reference miRNA sequence in a reaction volume. The kits include nucleic acid sequences that are identical or complementary to a portion of at least one target miRNA and at least one reference miRNA as defined above, for the detection of the target miRNA and the reference miRNA. In one embodiment, the kits comprise at least one primer for the detection of a reference miRNA and a target miRNA. In another embodiment, the kits comprise at least one probe specific to a reference miRNA and a target miRNA. The sequence-specific primers or probes are distinguishably labeled, allowing detection of at least one reference miRNA and at least one target miRNA in a single reaction volume.

The kits further optionally comprise an enzyme for carrying out the method described herein, including but not limited to a polymerase such as a reverse transcriptase or a DNA polymerase, or a ligase. In certain embodiments, the kits preferably include nucleic acid molecules that are identical or complementary to a target miRNA and/or a reference miRNA. Such molecules may serve as absolute standards for creating standard curves to quantify the unknown levels of target in the sample of interest.

In various embodiments, the kits preferably comprises multiple amplification primer sets, wherein at least one of the primers in each of the primer sets comprises a sequence that is

complementary to a portion of at least two miRNAs, such as a target miRNA and a reference miRNA, or two reference miRNAs, for example. In other embodiments, the kits preferably further comprise at least two probes complementary to a portion of at least two miRNAs. The kit preferably also comprises reagents for reverse transcribing RNA to a DNA template and/or reagents, including primers, for amplification of the target DNA. Such a kit preferably includes one or more buffers, such as a reaction, amplification, and/or a transcription buffer, compounds for preparing a RNA sample, for preparing a DNA sample, and components for isolating and/or detecting an amplification product, such as a probe or label, for example.

In some embodiments, kits of the invention preferably include one or more of the following (consistent with methods, reagents, and compositions discussed above): components for sample purification, including a lysis buffer with a chaotropic agent; a glass-fiber filter or column; an elution buffer; a wash buffer; an alcohol solution; and a nuclease inhibitor. The components of the kits may be packaged either in aqueous media or in lyophilized form, for example, and will be provided in a suitable container. The components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container. The container will generally include at least one vial, test tube, flask, bottle, syringe, and/or other container means, into which the solvent is placed, optionally aliquoted. The kits may also comprise a second container means for containing a sterile, pharmaceutically acceptable buffer and/or other solvent.

Where there is more than one component in the kit, the kit also will generally contain a second, third, or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a container. The kits of the present invention will also typically include a means for containing the RNA, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained. When the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred.

Such kits may also include components that preserve or maintain DNA or RNA, such as reagents that protect against nucleic acid degradation. Such components may be nuclease or RNase- free or protect against RNases, for example. Any of the compositions or reagents described herein may be components in a kit.

In a non-limiting example, reagents in a kit for reverse transcription and q-PCR of a target miRNA and a reference miRNA include reverse transcriptase, a reverse transcriptase primer, corresponding PCR primer sets, a thermostable DNA polymerase, and two distinguishable detection reagents which may include scorpion probes, probes for a fluorescent 5' nuclease assay, molecular beacon probes, single dye primers or fluorescent dyes specific to double-stranded DNA (e.g. ethidium bromide). The kit may also include multiple reverse transcriptase primers to one or more additional miRNAs, such as a target miRNA and/or a second reference miRNA. Additional materials may include a suitable reaction container, a barrier composition, reaction mixtures for reverse transcriptase and PCR stages (including buffers and reagents such as dNTPs), nuclease- or RNAse-free water, RNase inhibitor, and/or any additional buffers, compounds, co-factors, ionic constituents, proteins, enzymes, polymers, and the like that may be used in reverse transcriptase and/or PCR stages of the reactions.

The above disclosure generally describes the present invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as those commonly understood by one of ordinary skill in the art to which this invention belongs. A more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only, and are not intended to limit the scope of the invention. EXAMPLE SECTION

Methods Data selection

Candidate miRNAs were selected from previously performed studies that reported miRNA microarray data in the Gene Expression Omnibus (GEO). PubMed en GEO were extensively searched for studies in which miRNA microarrays were performed on whole blood, platelet, or serum samples. Microarray experiments were included if they reported individual miRNA expression of at least ten healthy controls. The inventors excluded two colour arrays, array experiments that reported ratio or Z transformed data, arrays on data of pooled individuals and arrays of which normalized data was not available. Furthermore, experiments with low miRNA expression levels were also excluded.

In silico analysis

From each study the inventors selected the healthy controls, to minimize influences of disease on the stability of expression of the candidate miRNAs. Data on miRNA expression of these control subjects was extracted from the GEO database. Candidate miRNAs were selected per microarray experiment using two filters to analyse the data. First, the variance coefficient of the selected miRNA had to be below the 35^th percentile in the specific microarray. Second, the expression level of the candidate miRNA had to be between the 50^th and the 97.5^th percentile in the specific microarray to exclude miRNAs with background expression levels. For each sample type the inventors selected the candidate miRNAs that met both selection criteria in n-1 arrays. Candidate reference miRNAs that were reported to be involved in any diseased state were excluded from this list. Real-time qPCR

Stability of the in silico selected candidate miRNAs was analyzed in a cohort of ten patients with coronary artery disease (CAD) and ten healthy controls. Detailed information on these subjects as well as on sample collection can be found in the supplementary methods. For each miRNA, gene-specific reverse transcription was performed from lOOng of purified total RNA using the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Gent, Belgium). Real time RT-PCR reactions were carried out on a LightCycler 480 system II (Roche). Data were analyzed using LinRegPCR quantitative PCR data analysis software, version 11.

Panel selection Stability of RT-qPCR expression of the candidate normalisation miRNAs was analysed using the NormFinder (Andersenet al. 2004 Normalization of Real-Time Quantitative Reverse Transcription- PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for

Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Research 64: 5245-5250.) and geNorm (Vandesompele et al. 2002 Genome Biol [Internet]. 2002;3:RESEARCH00347) algorithms to obtain the final miRNA normalisation panels. Normfinder identifies the optimal normalisation miRNA by ranking all candidate miRNAs in terms of stability in a given sample set (Andersen et al. 2004). Additionally, it identifies the optimal pair of miRNAs that can be used for normalisation. GeNorm uses a stability measure that quantifies to what extent the expression ratio of two candidate miRNAs is identical in all samples. For every candidate miRNA the algorithm determines the pairwise variation with all other candidates and determines the stability measure M (Vandesompele et al. 2002 Genome Biol [Internet]. 2002;3:RESEARCH00347). GeNorm also determines a V-value, that is the pairwise variation between two consecutive normalisation miRNAs starting with the candidate miRNA with the lowest M value. The combination of miRNAs that resulted in the lowest V-value was selected as the optimal set of normalisation miRNAs (Mestdagh et al. Genome Biol [Internet]. 2009 [cited 2013 Mar 6] ;10:R64.). The final normalisation panels consisted of those candidate miRNAs selected by both geNorm and Normfinder. If both algorithms selected different normalisation panels, both panels were combined in the final normalisation panel. Validation of the whole blood normalization panel

To show the robustness of the selection method, the inventors tested the precision of the final whole blood and serum normalization panel, whereas it only tested both precision and accuracy of the final platelet normalisation panel. Precision

Precision of the whole blood normalization panel was tested by investigating the correlation of 2 identical PCR runs of miR-494 either normalised for mir-16 or the whole blood normalisation panel. In a cohort of 37 patients with subclinical atherosclerosis and 53 healthy controls the inventors identified the highest expressed miRNA, which was miR-494 and used this as the references miRNA. Subsequently, the inventors performed 2 qPCR runs on miR-494 in the same sample. The results of these 2 runs were correlated either normalised for either RNU6B, miR-16 or the whole blood normalisation panel. MiR-16 or RNU6B, are frequently used normalization methods in the literature.

Accuracy

The accuracy of the normalization panel was analysed in isolated platelets of 25 healthy volunteers, in which the inventors previously determined the expression level of a target miRNA on micro array. Accuracy of the normalization panel was analysed by comparing the PCR results of the expression of miR-A with the array results, according to the different normalisation methods, either the platelet normalisation panel, RNU6B or miR-16. The normalisation method which best reproduced the array results of this study was supposed to be the best normalisation method.

Statistical analyses

Differences in expression levels between candidate miRNAs, for the normalization panels, were analysed using the Mann-Whitney U test.

In the validation experiments the candidate miRNAs for the precision and accuracy analyses were divided by the geometrical mean of the miRNAs included in the normalization panel. The Spearman's rank test was used to analyse the different correlations in the validation studies. All analyses were performed using SPSS for Windows 19.0. A p-value <0.05 was considered to be significant. Results

Whole blood

In silico analysis revealed that from a wide selection of miRNAs, five miRNAs met the selection criteria for candidate normalization miRNAs in all four array experiments. An additional 9 miRNAs met the inclusion criteria in three out of four arrays, always including the Illumina array, resulting in a total of 14 candidate normalisation miRNAs. The inventors were able to perform RT-qPCR on 7 of the 14 candidate miRNAs. Expression levels of those 7 miRNAs were not significantly different between patients and controls in the test cohort, suggesting stable expression independent of disease state. The expression of the candidate normalization miRNAs was further evaluated by Normfinder and geNorm software. Normfinder selected miR-130b-3p as the most stable miRNA with a stability value of 0.108. MiR-130b-3p and miR-342-3p were selected as the best combination of genes with a stability value of 0.085. The geNorm analysis confirmed that miR-130b-3p was the most stable (figure la). No combination of reference miRNAs reached a V-value<0.15 (figure lb). Therefore, the inventors selected the combination of miRNAs with the lowest V-value. This panel consisted of miR-130b-3p and miR-342-3p and had a V-value of 0.20. Since this panel corresponds with the Normfinder results, the inventors consider it a sufficient reference panel. Adding more candidate miRNAs did not improve the results. Platelets

The inventors included miRNAs associated with isolated platelets. 13 miRNAs met the selection criteria of the in silico analysis in all four included experiments. Since these were sufficient candidates for further analysis, the inventors did not select any additional miRNAs that met the selection criteria in three arrays. The inventors could perform PCR on nine out of 13 candidate normalization miRNAs. The nine candidate normalization miRNAs did not show significant differential expression between patients and controls in the test cohort suggesting stable expression independent of disease.

Normfinder selected miR-148b-3p as the most stable reference miRNA with a stability value of 0.086. MiR-148b-3p and miR-18a-5p were selected as the best combination of genes with a stability value of 0.064. GeNorm analysis revealed that miR-374b was the least stable reference miRNA, whereas miR- 151a-3p was most stable (supplementary figure 1). For a combination of 6 miRNAs (miR-151a-3p, miR-28-5p, miR-331-3p, miR-29c-3p, miR-148b-3p and miR-18a-5p) the lowest V value was calculated. This included the miRNAs selected by Normfinder. However, a combination of only two reference miRNAs (miR-151a-3p and miR-28-5p) already reached a V value below 0.15, and could therefore be used as a reliable normalization panel. Nonetheless, this panel did not include the reference miRNAs selected by Normfinder. Therefore, the inventors chose the combination of the six miRNAs as normalization panel. Serum

The inventors included miRNAs associated with serum samples. In silico analysis revealed that one miRNA (miR-197) met the selection criteria for candidate miRNAs in all three array experiments. Additionally, 9 candidate miRNAs met the inclusion criteria in two out of three arrays, resulting in a total of 10 candidate normalisation miRNAs. The inventors were able to perform PCR of 8 out of 10 candidate miRNAs. The candidate miRNAs did not show significant differential expression between patients and controls in the test cohort, suggesting stable expression independent of disease state. MiR-1280 was selected by Normfinder as the most stable candidate miRNA, with a stability value of 0.121. The best combination of candidate miRNAs consisted of miR-1280 and miR- 1260a and had a stability value of 0.089. Subsequently, geNorm showed that miR-1238 was the least stable candidate miRNA, whereas miR-1260a was the most stable candidate miRNA. A combination of 4 candidate miRNAs reached a V-value<0.15. This panel consisted of miR- 1260a, miR-1280, miR-718 and miR- 484, and corresponded with the combination of candidate miRNAs selected by Normfinder.

Panel validation phase

The performance of the whole blood normalization panel was analysed as a proof of principle by assessing the precision in a second run of a qRT-PCR experiment. Precision of the normalization panel was tested for the most highly expressed miR-494 of an independent sample. Using qPCR, the inventors showed a significant correlation between the first and the second run of miR-494 after normalization for the whole blood panel (r 0.68, p<0.001) (figure 2A). Normalization for miR-16 also showed a significant correlation albeit with a poor correlation coefficient (r 0.27, p=0.01) (figure 2B). The precision of normalising with RNU6B could not be analysed, since amplification of RNU6B failed in approximately half of the samples. From these analyses the inventors concluded that the precision of the identified whole blood normalization panel was superior to normalization by miR-16 or RNU6B.

The performance of the platelet normalization panel was analysed as a proof of principle by assessing the precision and accuracy.

The precision of the normalization panel was tested for miR-A. Using qPCR, the inventors showed a significant correlation between the first and the second run of miR-A after normalization for the platelet panel (p=0.91, P<0.001) (data not shown). Normalization for miR-16 showed poor nonsignificant correlation (p=-0.29, p=0.28) (data not shown). The precision of normalising with RNU6B could not be analysed, since amplification of RNU6B failed in approximately half of the samples.

From these analyses the inventors concluded that the precision of the identified platelet normalization panel was superior to normalization by miR-16 or RNU6B.

The accuracy was assessed by comparing the PCR results of the expression of miR-A with the array results, according to the different normalisation methods, either the platelet normalisation panel, RNU6B or miR-16. These data showed, that if the data was normalised for the platelet normalisation panel, the data better resembled the outcome as observed by the array, as compared to the

normalisation with miR-16 or RNU6B.

The importance of normalization for a suitable reference panel was underlined by the precision and accuracy validation experiments that the inventors performed for the platelet normalization panel. The inventors showed that the precision and accuracy of the platelet normalization panel was superior to the precision and accuracy of normalization by miR-16 and RNU6B. Since normalization of miRNA qPCR data is a necessity, concerning the technical difficulties resulting in inequality between samples, the inventors conclude that the platelet normalization panel is more reliable than currently used normalization methods. By extension, the inventors conclude that the standardized selection method to construct a reliable normalization panel is very suitable to select normalization panels in various different sample types.

Claims

1. A method of quantifying the amount of a target microRNA (miRNA) in a biological sample, the method comprising:

(a) determining the amount of the target miRNA in the biological sample;

(b) determining the amount of at least a first reference miRNA selected from the group consisting of miR-130b-3p, miR-342-3p, miR-1280, miR-1260a, miR-718, miR-151a-3p, miR-331- 3p, miR-29c-3p, miR-148b-3p and miR-18a-5p, in the biological sample; and,

(c) normalizing the target miRNA measurement based on the amount of at least said first reference miRNA.

wherein said target miRNA and said first reference miRNA are not the same

2. The method according to claim 1 , comprising further measuring a second reference miRNA from said group in the biological sample and normalizing the target miRNA levels to the first miRNA and the second reference miRNA, wherein said target miRNA and said second reference miRNA are not the same.

3. The method according to claim 1 or 2, wherein said group consists of miR-130b-3p and miR-342-3p and wherein said biological sample comprises whole blood.

4. The method according to claim 1 or 2, wherein said group consists of miR-1280, miR- 1260a, and miR-718, and wherein said biological sample is a serum sample.

5. The method according to claim 4, wherein said group consists of miR-1280 and miR- 1260a.

6. The method according to claim 1 or 2, wherein said group consists of miR-151a-3p, miR-331-3p, miR-29c-3p, miR-148b-3p and miR-18a-5p, and wherein said biological sample comprises isolated platelets.

7. The method according to claim 6, wherein said group consists of MiR-148b-3p and miR-18a-5p.

8. The method according to any one of claims 1-7, further comprising amplifying the target miRNA and the at least one reference miRNA in a reaction volume.

9. The method according to any one of claims 1-8, wherein the amplification includes real-time polymerase chain reaction amplification.

10. A kit for quantifying the amount of a target miRNA in a biological sample comprising an amplification primer set, comprising at least one primer comprising a sequence that is complementary to a portion of said first reference miRNA as defined in any of the previous claims.

11. The kit according to claim 10, wherein said amplification primer set further comprises a sequence that is complementary to a portion of said second reference miRNA as defined in any of the previous claims.

12. The kit according to claim 10 or 10, further comprising a second amplification primer set, wherein at least one primer comprises a sequence that is complementary to a portion of a target miRNA.

13. The kit according to any one of claims 10-12, further comprising a first probe comprising a sequence that is complementary to a portion of the target miRNA and a second probe comprising a sequence that is complementary to a portion of the reference miRNA, wherein the first and second probes are distinguishably detectable.