WO2017062790A1

WO2017062790A1 - Cold shock protein receptors and methods of use

Info

Publication number: WO2017062790A1
Application number: PCT/US2016/056029
Authority: WO
Inventors: Isabel Marie-Luise SAUR; Nicholas John HOLTON; John P. RATHJEN; Cyril Zipfel
Original assignee: Two Blades Foundation
Priority date: 2015-10-09
Filing date: 2016-10-07
Publication date: 2017-04-13

Abstract

Methods are provided for enhancing the resistance of plants to plant pathogens. The methods involve transforming a plant with a nucleic acid construct comprising a nucleotide sequence that encodes a cold shock protein receptor for a cold shock protein. Further provided are nucleic acid molecules, transformed plants, plant cells, and seeds and methods of using the transformed plants and seeds in agriculture.

Description

COLD SHOCK PROTEIN RECEPTORS AND METHODS OF USE

CROSS-REFERENCE TO RELATED APPLICATION

This application claims the benefit of U. S. Provisional Patent Application

No. 62/239,403, filed October 9, 2015, which is hereby incorporated herein in its entirety by reference.

REFERENCE TO A SEQUENCE LISTING SUBMITTED AS A TEXT FILE

The official copy of the sequence listing is submitted electronically via EFS-Web as an ASCII formatted sequence listing with a file named 070294-0088SEQLST, created on October 5, 2015, and having a size of 176 kilobytes, and is filed concurrently with the specification. The sequence listing contained in this ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety.

FIELD OF THE INVENTION

The present invention relates to the fields of plant molecular biology, particularly to plant mechanisms for the perception of, and resistance to, plant pathogens.

BACKGROUND OF THE INVENTION

Plants and animals sense microbes by detecting a range of their constituent molecules, so-called pathogen-associated molecular patterns (PAMPs). PAMPs are recognised directly by pattern recognition receptors (PRRs) located on the cell surface. In plants, PRRs usually belong to the receptor kinase (RK) or receptor-like protein (RLP) classes, and often contain leucine-rich repeats (LRR) or extracellular carbohydrate-binding LysM domains (Cao et al. (2014) eLife 3:e03766). Perhaps the best studied PRR is the LRR-RK FLAGELLIN

SENSING 2 (FLS2) that recognizes the bacterial protein flagellin or its peptide derivative flg22 (Chinchilla et al. (2006) Plant Cell 18(2):465-476; Gomez-Gomez and Boiler (2000) Mol. Cell 5(6): 1003-1011; Sun et al. (2013) Science 342(6158): 624-628). FLS2 and several other LRR-type PRRs require the LRR-RK BRI1 -ASSOCIATED KINASE 1 (BAKl) for signal transduction. BAKl (also called SERK3) is part of the SOMATIC

EMBRYOGENESIS RECEPTOR KINASE (SERK) family in .4. thaliana. BAKl is sometimes functionally redundant with SERK4/B AK1 -LIKE 1 (BKK1) (Roux M et al. (2011) Plant Cell 23(6):2440-2455). In most cases, BAKl interacts with PRRs in a ligand- induced manner (Sun et al. (2013) Science 342(6158):624-628; Roux M et al. (2011) Plant Cell 23(6):2440-2455; Chinchilla et al. (2007) Adv. Exp. Med. Biol. 598:358-371; Heese et al. (2007) PNAS 104(29): 12217-12222; Schulze et al. (2010) J. Biol. Chem. 285(13):9444- 9451; Krol et al. (2010) J. Biol. Chem. 285(18): 13471-13479; Chinchilla et al. (2007) Nature 448(7152):497-500). FLS2 binds BAKl within seconds of flg22 treatment, and flg22 seems to act as 'molecular glue' between the FLS2 and BAKl ectodomains (Sun et al. (2013) Science 342(6158): 624-628). The BAKl -INTERACTING RLKs 1 and 2 (BIRl and BIR2) negatively regulate BAKl (Chinchilla et al. (2007) Nature 448(7152):497-500; Gao et al. (2009) Cell Host Microbe 6(l):34-44). BIR2 is released from the BAK1-FLS2 complex during flg22 perception, whereas BIRl negatively regulates BAKl -mediated cell death prior to complex activation. The birl-1 cell death phenotype is rescued by a mutation in

SUPPRESSOR OF BIRl -1 (SOBIR1), sobirl-1. SOBIR1 is a LRR-RK that interacts constitutively with certain LRR-RLPs from A. thaliana and tomato, and is required for ligand-induced signaling (Liebrand et al. (2013) PNAS 110(24): 10010-10015; Jehle et al. (2013) Plant Signal. Behav. 8(12): e27408; Zhang et al. (2013) Plant Cell 25(10):4227-4241; Zhang et al. (2014) Plant Physiol. 164(l):352-364). SOBIR1 may function as a signal transducer for those PRRs that lack a cytoplasmic kinase domain (Gust and Felix (2014) Curr. Opin. Plant Biol. 21C: 104-111). N. benthamiana contains two SOBIR1 homologs, NbSOBIRl and NbSOBIRl -like (Liebrand et al. (2013) PNAS 110(24): 10010-10015).

Activation of PRRs by ligand binding and subsequent stimulation of the immune system causes PAMP -triggered immunity (PTI) (Monaghan and Zipfel (2012) Curr. Opin. Plant Biol. 15(4):349-357). PTI is associated with numerous cellular phenomena such as extracellular alkalinization, influx of Ca²⁺ from the apoplast, production of reactive oxygen species (ROS), activation of mitogen activated protein kinase (MAPK) cascades, and massive reprogramming of host gene expression (Macho and Zipfel (2014) Mol. Cell 54(2):263-272). Importantly, adapted bacterial pathogens have evolved to evade PTI by altering PAMPs to avoid recognition, or by the secretion of virulence effector proteins into the host cytoplasm. Effectors can inhibit essential PTI signaling components (Jones and Dangl (2006) Nature 444(7117):323-329). Reduced PTI is usually associated with plant disease (Jones and Dangl (2006) Nature 444(7117):323-329), but is also essential for Agrobacterium-m diated plant transformation and establishment of nitrogen fixing nodules in roots by symbiotic bacteria, as both Agrobacterium ssp. and Rhizobium ssp. have divergent flagellin sequences that are not recognized by plants (Felix et al. (1999) Plant J. 18(3):265-276). Bacteria that are not recognized by FLS2 still elicit PTI through the perception of alternative PAMPs, and while flagellin perception by FLS2 seems to be conserved in vascular plants, several PAMPs are recognized only by certain plant families (Boiler and Felix (2009) Ann. Rev. Plant Biol. 60:379-406). A. thaliana recognizes the bacterial PAMP elongation factor-Tu through the LRR-RK elongation factor-Tu Receptor (EFR) (Zipfel et al. (2006) Cell 125(4):749-760).

EFR recruits B AK1 after perception of the EF-Tu-derived peptides elf 18 or elf26, illustrating the capacity of BAK1 to interact with different receptors (Schulze et al. (2010) J. Biol. Chem. 285(13):9444-9451). Likewise, the cold shock protein (CSP) was identified from the bacterium Staphylococcus aureus as a PAMP that is perceived specifically by members of the plant family Solanaceae (Felix and Boiler (2003) J. Biol. Chem. 278(8): 6201-6208). CSP contains a conserved cold-shock domain (CSD) and the N-terminal 22 amino acid (aa) sequence of the CSP consensus sequence, known as csp22, elicits typical immune responses in a BAK1 -dependent manner (Heese et al. (2007) PNAS 104(29): 12217-12222; Felix and Boiler (2003) J. Biol. Chem. 278(8): 6201-6208). Although CSP was identified over 10 years ago, the identity of the receptor for CSP (CSPR) has not yet been reported. Given the expected role of CSPR in mediating plant resistance responses to bacterial plant pathogens, it is believe that the identification of CSPR will lead to the development of new strategies for making crop plants with enhanced resistance to plant diseases cause by plant pathogens. BRIEF SUMMARY OF THE INVENTION

Methods are provided for enhancing the resistance of plants to plant pathogens. The methods involve introducing into a plant cell a nucleic acid construct comprising a nucleotide sequence encoding a cold shock protein receptor (CSPR). The nucleic construct can further comprise an operably linked promoter that is capable of driving the expression of the nucleotide sequence encoding a CSPR in a plant cell. The methods can further involve regenerating the plant cell into a transformed plant comprising in its genome the nucleic acid construct. Transformed plants produced by such methods display enhanced resistance to at least one plant pathogen, particularly at least one plant pathogen.

Methods for limiting plant disease caused by a plant pathogen in agricultural crop production are provided. The methods involve planting a seed, seedling, or plant part and growing the plant resulting therefrom under conditions favorable for the growth and development of the plant. The seed, seedling, or plant part comprises a nucleic acid construct which comprises a nucleotide sequence encoding a CSPR and a plant resulting therefrom comprise enhanced resistance to the plant disease caused by the plant pathogen. The method can further comprise harvesting a product produced by the plant such as, for example, a fruit, a tuber, a leaf, a root, a stem, a bud, and a seed.

Methods for increasing the transformation efficiency of a solanaceous plant in Agrobacterium -mediated transformation and methods for the transformation of a solanaceous plant with a gene of interest are further provided. The methods for increasing the transformation efficiency of a solanaceous plant involve decreasing the expression level and/or activity of CSPR in the solanaceous plant, whereby transformation efficiency is increased when the solanaceous plant is subjected to Agrobacterium -mediated

transformation. The methods for the transformation of a solanaceous plant with a gene of interest comprise contacting a modified solanaceous plant cell with an Agrobacterium strain comprising the gene of interest contained in a Ti plasmid, whereby the gene of interest is transferred to the at least one cell. The modified solanaceous plant cell comprises a decreased expression level and/or activity of CSPR, relative to the expression level and/or activity of CSPR in a control solanaceous plant cell.

Additionally provided are transformed plants, plant parts, seeds, plant cells, and other host cells that are produced by the methods of the present invention, nucleic acid molecules and expression cassettes comprising nucleotide sequences encoding a CSPR of the present invention, and transformed plants, plant parts, seeds, plant cells, and other host cells comprising such nucleic acid molecules and expression cassettes. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows that csp22 induces immune responses in Nicotiana benthamiana in an age-dependent manner. Comparison of responses induced by 100 nM csp22 in four- and six- week-old N. benthamiana plants: ROS production (FIGS. 1A, IB); cytoplasmic influx of calcium ions (FIGS. 1C, ID); MAPK activation (FIG. IE); and up-regulation of PIG (FIG. IF). Graphed data are ± SEM, * P < 0.05, ** P < 0.01, *** P < 0.001 (pairwise student's t- test comparing six-week old plants to four-week old plants, n=8 for ROS, calcium ion influx, n=6 for qRT-PCR). All experiments were performed at least three times and representative results are shown.

FIG. 2 shows that flg22 -induced immune responses in Nicotiana benthamiana do not increase with plant age. Comparison of responses induced by 100 nM flg22 in four- and six- week-old N. benthamiana plants: ROS production (FIGS. 2A, 2B); cytoplasmic influx of calcium ions (FIGS. 2C, 2D); MAPK activation (FIG. 2E); and up-regulation of PIG (FIG. 2F). Graphed data are ± SEM, * P < 0.05, ** P < 0.01, *** P < 0.001 (pairwise student's t- test comparing six-week-old plants to four- week-old plants, n=8 for ROS, calcium ion influx, n=6 for qRT-PCR). All experiments were performed at least three times and representative results are shown.

FIG. 3 depicts the identification of the Nicotiana benthamiana csp22 receptor (NbCSPR) using NbBAKl as molecular bait. FIG. 3A shows the strategy to identify NbCSPR. Nicotiana benthamiana leaves were transiently transformed with 35S:NbBAKl- GFP or 35S:NbBAKl-5-GFP (1). Leaves were treated with csp22 (2) leading to complex formation between NbBAKl and the hypothetical NbCSPR protein (3). The complex was isolated using anti-GFP conjugated beads (4), and co-purifying proteins identified by mass- spectrometry. FIG. 3B lists selected receptor proteins identified by MS after NbBAKl immunoprecipitation. The table indicates each identified protein and the number of peptides identified (pooled for all four experiments). RC stands receptor candidate for cold shock protein. FIG. 3C shows that NbRC2 binds NbBAKl in a csp22-dependent manner. N.

benthamiana leaves were co-transformed transiently with 35S:NbBAKl-3HAF or empty vector (EV), and one of pAtFLS2:AtFLS2-3Myc, 35S:NbRCl-5Myc or 35S:NbRC2-5Myc. Three days post infiltration, infiltrated leaves were treated with sterile water (MOCK) or 100 nM csp22 for 15 min before harvesting the leaf tissue. NbBAKl -3HAF was recovered by anti-FLAG pull down, and the immunoprecipitates probed with anti-Myc and anti-HA western blots after gel electrophoresis. The left panel shows a western blot of the input fractions, and the right the proteins recovered by immunoprecipitation. IP:

Immunoprecipitated fraction.

FIG. 4 shows that the interaction of NbBAKl with RC2 is ligand-specific and that interaction of FLS2 and NbRC2 with NbBAKl -5 is ligand-independent. FIG. 4A: N.

benthamiana leaves were co-transformed transiently with 35S:NbBAKl-3HAF or EV, and one of pAtFLS2:AtFLS2-3Myc, 35S:NbRCl-5Myc, or 35S:NbRC2-5Myc. Two days post- infiltration the leaves were treated with sterile water (mock) or flg22 for 15 min, before harvesting the tissue. FIG. 4B: N. benthamiana leaves were co-transformed transiently with 35S:NbBAKl-5-3HAF or EV, and one of pAtFLS2:AtFLS2-3Myc, 35S:NbRCl-5Myc or 35S:NbRC2-5Myc. Two days post infiltration, the leaves were treated with sterile water (MOCK), csp22 or flg22 as indicated for 15 min before harvesting the tissue. NbBAKl - 3HAF and NbBAKl -5-3HAF were recovered by anti-FLAG pull down, and the

immunoprecipitates probed with anti-Myc and anti-HA western blots after gel

electrophoresis. IP: Immunoprecipitated fraction.

FIG. 5 shows the amino sequence of the NbCSPR protein. Protein domains: signal peptide amino acids 1-22 (Signal P v4.1); 28 LRR domains (bold), amino acids 111 - 885 (Bej. et al. (2014) Comput Biol. Med. 53: 164-170); and transmembrane domain, amino acids 969 - 988 (tmhmm server v. 2.0). Peptides identified for NbCSPR by mass-spectrometry are underlined.

FIGS. 6A-6H is an alignment of the NbCSPR and NtCSPR nucleotide sequences. The

NbCSPR nucleotide sequence was obtained from the Sol genomics network (available on the World Wide Web at: solgenomics.net) by tBLASTn search using the NbCSPR protein sequence identified by mass-spectrometry. The NtCSPR nucleotide sequence was obtained by BLAST searching the NbCSPR nucleotide sequence against the NCBI Nicotiana tabacum whole-genome shotgun contigs database (NCBI BLAST). Nucleotide sequences used for the TRV -based, virus-induced gene silencing (VIGS) constructs are indicated in bold for TRV.NbCSPRa and underlined for TRV.NbCSPRb.

FIG. 7 shows that NbCSPR binds csp22 in vitro and is required for csp22-dependent PTI responses in N. benthamiana. FIG. 7A: Recombinant csp22-GST was expressed in and purified from Escherichia coli BL21 cells. csp22-GST was added with or without unlabelled csp22 peptide to NbCSPR-3HAF bound to anti-FLAG beads. The presence of receptor- peptide complexes was determined by anti-HA and anti-GST western blots after gel electrophoresis. IP: Immunoprecipitated fractions. NbCSPR is required for csp22-dependent responses as determined by VIGS of N. benthamiana plants, firstly measuring ROS production (FIG. 7B), activation of MAPKs (FIG. 7C), and up-regulation of PIG expression (FIG. 7D). Graphed data are ± SEM, * P <0.05, ** P < 0.01, *** P < 0.001 (pairwise student's /-test comparing TRV.NbCSPR to TRV. GFP plants, n=8 for ROS, n=6 for qRT- PCR). All experiments were performed at least three times and representative results are shown.

FIG. 8 shows that NbCSPR is not required for flg22-dependent responses in Nicotiana benthamiana. NbCSPR or GFP was silenced by VIGS in N. benthamiana, and plants were treated with 100 nM flg22 to assay ROS production (FIG. 8 A), activation of MAPKs (FIG. 8B), and up-regulation of PIG expression (FIG. 8C). Successful silencing was confirmed by qRT-PCR (FIG. 8D) and a lack of NbCSPR-3HAF protein in silenced plants transiently transformed with 35S:NbCSPR-3HAF (FIG. 8E), as determined by anti-HA western blots. Graphed data are ± SEM, ** P < 0.01 *** P < 0.001, (pairwise student's /-test comparing TRV.NbCSPR to TRV. GFP plants, n=8 for ROS, n=6 for qRT-PCR). All experiments were performed at least three times and representative results are shown.

FIG. 9 shows that NbCSPR can bind NbSOBIRl but is independent of NbSOBIRl or NbSOBIRl -like for csp22-dependent responses. N. benthamiana leaves were co-transformed transiently with 35S:NbSOBIRl-3HAF or EV, and one of 35S:NbCSPR-5Myc or

pAtFLS2:AtFLS2-3Myc. Two days post infiltration the tissue was treated with sterile water (MOCK), csp22 or flg22 for 15 min as indicated, before harvesting the leaf tissue.

NbSOBIRl -3HAF was recovered by anti-FLAG pull down, and the immunoprecipitates probed with anti-Myc and anti-HA western blots after gel electrophoresis. IP:

Immunoprecipitated fraction. FIG. 9A: Overexpressed NbSOBIRl interacts with NbCSPR with or without csp22 treatment. FIG. 9B: AtFLS2 does not interact with NbSOBIRl with or without flg22 treatment. NbSOBIRl and NbSOBIRl -like is not required for csp22- or flg22- dependent MAPK activation (FIG. 9C), or ROS production (FIG. 9D). Up-regulation of PIG by csp22 or flg22 treatment is not impaired in plants silenced for NbSOBIRl and NbSOBIRl - like (FIGS. 9E, 9F). Effective silencing of both NbSOBIRl and NbSOBIRl -like

(TRV NbSOBIRl (-like)) by VIGS as measured by qRT-PCR (FIG. 9G) or a functional assay for the Avr4/Cf4 HR. N. benthamiana plants silenced for NbCSPR (left) or NbSOBIRl (-like) (right) were transformed transiently with 35S:Cf4-GFP, 35S:Avr4 and EV as indicated (FIG. 9H). Leaves were harvested four days post transformation and cell death (dark grey) was detected by trypan blue staining. Graphed data are ± SEM, * P < 0.05, ** P < 0.01, ***P<0.001 (pairwise student's r-test comparing TRV:NbSOBIRl(-like) to TRV. GFP plants, n=8 for ROS, n=6 for qRT-PCR). All experiments were performed at least twice and representative results are shown.

FIG. 10 shows that NbCSPR confers recognition of csp22 in Arabidopsis thaliana. Overexpression of NbCSPR in stable transgenic A. thaliana Col-0 plants (IS-01) leads to csp22-dependent responses, including production of ROS (FIGS. 10A, 10B), MAPK activation (FIG. IOC), and seedling growth inhibition (SGI) (FIG. 10D). Graphed data are ± SEM, ** P < 0.01, *** P < 0.001 (pairwise student's r-test comparing IS-01 to IS-00 plants, n=8). All experiments were performed at least twice and representative results shown.

FIG. 11 shows that NbCSPR confers recognition of csp22 in Arabidopsis thaliana protoplasts. FIG. 11 A: Transformation of Col-0 protoplasts with 35S:NbCSPR-3HA (left) or EV (right). Protoplasts were treated with csp22 16 hours post transfection and MAPK activation measured by anti-pMAPK western blot at the times shown. FIG. 11B: Col-0, bakl- 5 bkkl-1 and sobirl-12 protoplasts were transformed with 35S:NbCSPR-3HA. MAPK assay was as for FIG. 11 A.

FIG. 12 shows that NbCSPR contributes to anti -bacterial immunity. N. benthamiana plants were silenced for GFP, NbFLS2 or NbCSPR before infection by dipping into P.

syringae suspensions. Silenced plants were infected with the adapted strain P. syringae pv. tabaci (Pta) 6605 (FIG.12 A), the non-pathogenic strain Pta 6605 hrc (FIG.12B), a mutant strain lacking flagellin, Pta 6605 fli (FIG.12C) (Shimizu et al. (2003) Mol. Genet.

Genomics 269(l):21-30) and the non-adapted pathogen P. syringae pv. phaseolicola 1448A (Pph) (FIG.12D) (Arnold et al. (2011) Mol. Plant Pathol. 12(7):617-627). Graphed data are ± SEM, * PO.05, ** P < 0.01 (pairwise student's t-test comparing TRV:NbFLS2 or

TRV: NbCSPR to TRV. GFP plants, n=6). FIG.12E shows that NbCSPR contributes to bacterial resistance when transferred into A. thaliana. Stable transgenic Col-0 plants transformed with 35S:EV-5Myc (IS-00) or 35S:NbCSPR-5Myc (IS-01) were spray-infected with adapted P. syringae pv. tomato DC3000 bacteria. For all infection assays, plants were infected using a bacterial suspension of 5 x 10⁷ cfu/ml. Samples for bacterial counts were taken after 3 days. FIG.12F shows that transformation of six-week-old N. benthamiana plants is restricted by NbCSPR. N. benthamiana plants were silenced for GFP, NbFLS2 or NbCSPR before infiltration with Agrobacterium tumefaciens GV3101 pMp90 carrying a 35S:intron- GUS construct (Zipfel et al. (2006) Cell 125(4):749-760). Leaves were harvested two days post-infiltration and GUS activity(dark grey) detected by GUS staining; chlorophyll was removed using 70% ethanol. Blue colour indicated transformation of the GUS gene. All experiments were performed at least twice and representative results are shown.

FIG. 13 shows that NbCSPR restricts growth of P. syringae pathovar tabaci 6605 fliC and A. tumefaciens in six-week- but not four- week-old plants. Four- week-old N. benthamiana plants silenced for GFP, NbFLS2 or NbCSPR were used for bacterial assays as indicated (FIG. 13 A) Growth of Pta 6605 fliC. Plants were infected by dipping and bacterial counts estimated from leaf samples collected 3 days post-infection. FIG. 13B: Transformation of NbCSPR silenced four- week-old plants by A. tumefaciens GV3101 pMp90 carrying a 35S:intron-GC/S' construct (Zipfel et al. (2006) Cell 125(4): 749-760). GUS activity (dark grey) was detected by GUS staining; chlorophyll was removed using 70% ethanol. Blue colour indicated transformation of the GUS gene. Transformation of silenced six-week-old plants (FIG. 13C) and four-week-old plants (FIG. 13D) with^. tumefaciens GV3101 pMp90 carrying a binary construct for 35S:N2-3HAF expression. N2-3HAF protein was detected by anti-HA western blot. FIG. 13E: Upregulation of NbCSPR but not NbFLS2 in six-week-old plants. Gene expression was measured by qRT-PCR in extracts from four- and six-week old plants using specific primers. Graphed data are means ± SEM, *** P < 0.001 (pairwise student's /-test comparing six- week-old plants to four- week-old plants, n=6). All experiments were performed at least twice and representative results are shown. FIG. 13F: Conservation of the cspl5 and csp22 motif (Felix and Boiler (2003) J. Biol. Chem. 278(8):6201-6208) in the cold shock proteins of P. syringae and A. tumefaciens. Residues critical for extracellular alkalinisation of tobacco suspension cultures as described in Felix and Boiler (2003) J. Biol. Chem. 278(8):6201-6208 are underlined.

FIG. 14 shows that flg22 perception potentiates NbCSPR expression and csp22 responsiveness in four-week old N. benthamiana plants. Increase in csp22-dependent ROS production (FIG.14A), expression of PIG (FIG.14B) and MAPK activation (FIG.14C) in N. benthamiana leaves after flg22 pretreatment. FIG.14C: Pre-treatment of non-flowering four- week-old plants with flg22. N. benthamiana leaves were treated with the PAMPs as shown, and induction of the NbCSPR gene measured by qRT-PCR with respect to the mock-treated controls. Graphed data are ± SEM, * P < 0.05, ** P < 0.01, *** P < 0.001 (pairwise student's /-test comparing flg22 or csp22 pretreated plants to mock pretreated plants, n=8 for ROS, n=6 for qRT-PCR). All experiments were performed at least twice and representative results shown. FIG. 15 shows that csp22 does not potentiate NbFLS2 expression, that csp22 and elf 18 perception does not potentiate fig22 responsiveness, and that flg22 perception potentiates elf 18 responsiveness. Four-week-old N. benthamiana plants were pre-treated with csp22 two-and-a-half hour prior to treatment with flg22 and detection of P AMP responses: ROS production after csp22 pre-treatment (FIG. 15 A), induction of PIG (FIG. 15B), and activation of MAPKs (FIG. 15C). Pre-treatment of non-flowering four-week-old plants with csp22. N. benthamiana leaves were treated with the PAMPs as shown, and induction of the NbFLS2 gene measured by qRT-PCR with respect to the mock-treated controls. A. thaliana plants were pre-treated with elf 18 or flg22 two-and-a-half hour prior to treatment with elf 18 (FIG. 15E) or flg22 (FIG. 15F) as indicated and ROS production was measured. Graphed data are ± SEM, ** P < 0.01, *** P < 0.001 (pairwise student's /-test comparing flg22 or csp22 pretreated plants to MOCK pretreated plants, n=8 for ROS, n=6 for qRT-PCR). All experiments were performed at least three times and representative results are shown. SEQUENCE LISTING

The nucleotide and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three-letter code for amino acids. The nucleotide sequences follow the standard convention of beginning at the 5' end of the sequence and proceeding forward (i.e. , from left to right in each line) to the 3' end. Only one strand of each nucleotide sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand. The amino acid sequences follow the standard convention of beginning at the amino terminus of the sequence and proceeding forward (i.e., from left to right in each line) to the carboxy terminus.

SEQ ID NO: 1 sets forth the nucleotide sequence of NbCSPR. The coding region is nucleotides 394-3399.

SEQ ID NO: 2 sets forth the amino acid sequence of the NbCSPR protein.

SEQ ID NO: 3 sets forth the nucleotide sequence of the coding region of the NbCSPR cDNA. If desired, a stop codon (e.g. TAA, TAG, TGA) can be operably linked to the 3' end of nucleic acid molecule comprising SEQ ID NO: 3.

SEQ ID NO: 4 sets forth the nucleotide sequence of NtCSPR. The coding region is nucleotides 2047-5052.

SEQ ID NO: 5 sets forth the amino acid sequence of the NtCSPR protein. SEQ ID NO: 6 sets forth the nucleotide sequence of the coding region of the NtCSPR cDNA. If desired, a stop codon (e.g. TAA, TAG, TGA) can be operably linked to the 3' end of nucleic acid molecule comprising SEQ ID NO: 6.

SEQ ID NOS: 7-13 are the amino acid sequences in FIG. 13F for the motifs labeled as cspl5, csp22, consensus, Pta (P. syringae pv. tabaci 6605), Php (P. syringae pv. Phaseolicola 1440a), Pto (P. syringae pv. tomato DC3000), and Atu (Agrobacterium tumefaciens), respectively. Conserved residues are indicated by underlining.

SEQ ID NO: 14 sets forth the nucleotide sequence of the coding region of the cDNA of a CSPR gene from Solanum tuberosum that is referred to herein as StCSPR cDNA. If desired, a stop codon (e.g. TAA, TAG, TGA) can be operably linked to the 3' end of nucleic acid molecule comprising SEQ ID NO: 14.

SEQ ID NO: 15 sets forth the amino acid sequence of the StCSPR protein encoded by SEQ ID NO: 14.

SEQ ID NO: 16 sets forth the nucleotide sequence of the coding region of the cDNA of a CSPR gene from Petunia x hybrida that is referred to herein as PhCSPR. If desired, a stop codon (e.g. TAA, TAG, TGA) can be operably linked to the 3' end of nucleic acid molecule comprising SEQ ID NO: 16.

SEQ ID NO: 17 sets forth the amino acid sequence of the PhCSPR protein encoded by SEQ ID NO: 16.

SEQ ID NO: 18 sets forth the nucleotide sequence of the coding region of the cDNA of a CSPR gene from Physalis peruviana that is referred to herein as PpCSPR. If desired, a stop codon (e.g. TAA, TAG, TGA) can be operably linked to the 3' end of nucleic acid molecule comprising SEQ ID NO: 18.

SEQ ID NO: 19 sets forth the amino acid sequence of the PpCSPR protein encoded by SEQ ID NO: 18.

SEQ ID NO: 20 sets forth the nucleotide sequence of the coding region of the cDNA of a CSPR gene from Withania somnifera that is referred to herein as WsCSPR. If desired, a stop codon (e.g. TAA, TAG, TGA) can be operably linked to the 3' end of nucleic acid molecule comprising SEQ ID NO: 20.

SEQ ID NO: 21 sets forth the amino acid sequence of the WsCSPR protein encoded by SEQ ID NO: 20.

SEQ ID NO: 22 sets forth the nucleotide sequence of the coding region of the cDNA of a CSPR gene from Nicotiana sylvestris that is referred to herein as NsCSPR. If desired, a stop codon (e.g. TAA, TAG, TGA) can be operably linked to the 3' end of nucleic acid molecule comprising SEQ ID NO: 22.

SEQ ID NO: 23 sets forth the amino acid sequence of the NsCSPR protein encoded by SEQ ID NO: 22.

SEQ ID NO: 24 sets forth the nucleotide sequence of the coding region of the cDNA of a CSPR gene from Nicotiana tomentosiformis that is referred to herein as NtomCSPR. If desired, a stop codon (e.g. TAA, TAG, TGA) can be operably linked to the 3' end of nucleic acid molecule comprising SEQ ID NO: 24.

SEQ ID NO: 25 sets forth the amino acid sequence of the NtomCSPR protein encoded by SEQ ID NO: 24.

DETAILED DESCRIPTION OF THE INVENTION

The present inventions now will be described more fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the inventions are shown. Indeed, these inventions may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Like numbers refer to like elements throughout.

Many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which these inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

The present invention is based in part on the identification in Nicotiana benthamiana of a receptor for the cold shock protein (CSP) produced by the bacterial plant pathogen, Staphylococcus aureus. This cold shock protein, which is referred to as csp22, is a PAMP that is perceived by members of the plant family Solanaceae but is not known to be perceived by members of other plant families (Felix and Boiler (2003) J. Biol. Chem. 278(8): 6201- 6208). Similar to other PAMPs, csp22 elicits typical immune responses in LRR-RK BRI1- associated kinase 1 (BAKl)-dependent manner (Heese et al. (2007) PNAS 104(29): 12217- 12222; Felix and Boiler (2003) J. Biol. Chem. 278(8): 6201-6208). As disclosed hereinbelow, the Nicotiana benthamiana CSPR (NbCSPR) was identified through the use of a novel proteomics method for the identification of new pattern-recognition receptors (PRRs) which involves employing BAK1 as a molecular bait. As described below, when NbCSPR was expressed in non-solanaceous plants which do not display CSP-induced immune responses, the NbCSPR-expressing plants displayed CSP-induced immune responses. Thus, the present invention finds use in enhancing the resistance of plants to pathogens that produce CSP.

In particular, the methods and compositions of the present invention find use in agriculture, particularly in the development of crop plants with enhanced resistance to plant diseases. Such crop plants include resistant and susceptible plant varieties. Such resistant plant varieties may, for example, comprise one or more R genes that are introduced into the plant varieties by conventional plant breeding methods and/or via transformation involving recombinant DNA.

The present invention provides methods for enhancing the resistance of plants to plant disease caused by at least one plant pathogen that find use in the development of improved plant varieties. Such plant varieties will display enhanced resistance to one or more pathogens, thereby reducing the need for the application of potentially harmful chemical pesticides when compared to similar plant varieties that have not been enhanced by the methods disclosed herein.

The methods for enhancing the resistance of plants to plant disease caused by at least one plant pathogen of the present invention involve introducing a nucleic acid construct comprising a nucleotide sequence encoding a CSPR into at least one plant cell of the plant and optionally regenerating a transformed plant from the at least one plant cell, wherein the transformed plant comprises in its genome the nucleic acid construct. The nucleic acid construct can be introduced into the at least one plant cell using methods disclosed hereinbelow such as, for example, Agrobacterium-m diated transformation or biolistic transformation or any other methods known in the art for the stable or transient

transformation of plants. In embodiments of the invention involving stable transformation, the nucleic acid construct is stably incorporated into the genome of the plant cell, and in embodiments of the invention involving transient transformation the nucleic acid construct is not stably incorporated into the genome of the plant cell.

Transformed plants produced by the methods of the present invention comprise enhanced resistance to plant disease caused by at least one plant pathogen plant pathogen. In preferred embodiments, the plants of the invention comprise enhanced resistance to plant diseases caused by at least two, three, four, five or more plant pathogens. In other preferred embodiments, the plants of the invention comprise enhanced resistance to plant disease caused by at least one bacterial plant pathogen. In yet some other preferred embodiments, the plants of the invention comprise enhanced resistance to plant diseases caused by at least two, three, four, five or more bacterial plant pathogens.

The methods of the present invention comprising introducing a nucleic acid construct comprising a nucleotide sequence encoding a CSPR. The CSPR of the present invention are preferably CSPR derived from solanaceous plants and variants thereof that are capable of inducing an immune response in a plant when the plant is exposed to CSP or a functional fragment thereof such as, for example, csp22 or cspl5. csp22 (SEQ ID NO 8) is a peptide consisting of the N-terminal 22 amino acid sequence of the CSP consensus sequence is known to elicit in plant exposed to it the typical CSP-type immune responses in a BAK1- dependent manner (Heese et al. (2007) PNAS 104(29): 12217-12222; Felix and Boiler (2003) J. Biol. Chem. 278(8):6201-6208). Similarly, cspl5 (SEQ ID NO: 7) is peptide consisting of amino acids 8-22 of csp22 (Felix and Boiler (2003) J. Biol. Chem. 278(8): 6201-6208) that is capable of eliciting typical immune responses in tomato leaves exposed to cspl5. In preferred embodiments, the CSPR of the present invention is NbCSPR or Nicotiana tabacum CSPR (NtCSPR). Amino acid sequences for NbCSPR and NtCSPR are set forth in SEQ ID NOS: 2 and 5, respectively. Nucleotide sequences encoding NbCSPR are provided in SEQ ID NOS: 1 and 4, and nucleotide sequences encoding NtCSPR are provided in SEQ ID NOS: 4 and 6. Homologs and variant CSPR polypeptides and polynucleotides of the present invention are described below.

Amino acid sequences for homologs of NbCSPR and NtCSPR from Solarium tuberosum, Petunia x hybrida, Physalis peruviana, Withania somnifera, Nicotiana sylvestris, and Nicotiana tomentosiformis are set forth in SEQ ID NOS: 15, 17, 19, 21, 23, and 25, respectively. Nucleotide sequences encoding the homologs of NbCSPR and NtCSPR from Solanum tuberosum, Petunia x hybrida, Physalis peruviana, Withania somnifera, Nicotiana sylvestris, and Nicotiana tomentosiformis are provided in SEQ ID NOS: 14, 16, 18, 20, 22, and 24, respectively. Variant CSPR polypeptides and polynucleotides of the present invention are described below.

In certain embodiments, the nucleic acid construct comprises a CSPR gene with its native promoter such as, for example, the NbCSPR gene comprising SEQ ID NO: 1 and the NtCSPR gene comprising SEQ ID NO: 4. In other embodiments, the nucleic acid construct can further comprise a promoter that is operably linked to the nucleotide sequence encoding a CSPR of the present invention, wherein the promoter is capable of driving expression of the operably nucleotide sequence a plant or at least one part or cell thereof. Any promoter that is capable of driving the expression of the operably linked nucleotide sequence encoding a CSPR can be used in the methods of the present invention. Preferred promoters include, for example, pathogen-inducible, constitutive, tissue-preferred, wound-inducible, and chemical- regulated promoters. Examples of such promoters are described below.

In some embodiments of the methods for enhancing the resistance of plants to plant disease caused by at least one bacterial plant pathogen, the at least one plant cell can additionally comprise a heterologous polynucleotide comprising a nucleotide sequence encoding an additional PRR. Thus, a plant cell or plant produced by methods of the present method can comprise both the introduced nucleic acid construct comprising a nucleotide sequence encoding an CSPR and heterologous polynucleotide comprising a nucleotide sequence encoding an additional PRR such as, for example, a bacterial EF-Tu receptor (EFR). See WO 2010/062751, herein incorporated by reference. Such a heterologous polynucleotide can be introduced into the at least one plant cell before, at the same time as, or after the nucleic acid construct is introduced into the at least one plant cell using the any of the stable or transient transformation methods that can be used for the nucleic acid construct. In embodiments in which both the nucleic acid construct comprising a nucleotide sequence encoding an CSPR and the heterologous polynucleotide comprising a nucleotide sequence encoding an additional PRR are introduced into the at least one plant cell at the same time, the nucleic acid construct and the polynucleotide can be either contained in the same nucleic acid molecule (i.e. "linked") or in at least two separate nucleic acid molecules (i.e.

"unlinked"). In some embodiments, the plant cell or plant can comprise, in addition to the introduced nucleic acid construct comprising a nucleotide sequence encoding CSPR, two, three, or more heterologous polynucleotides each comprising a nucleotide sequence encoding a different PRR. Such PRRs include, for example: BAK1/SERK3 (Heese et al. (2007) PNAS 104(29): 12217-12222); SERK1 or SERK2 from wheat or rice; FLS2 (Gomez-Gomez and Boiler (2000) Mol. Cell 5(6): 1003-1011); CERKl (Miya e/ a/. (2007) PNAS 104(49): 19613-8 and Wan et al. (2008) Plant Cell. 20(2):471-8; Xa21 (Song et al. (1995) Science

270(5243): 1804-6); REMAX (Jehle et al. (2013) Plant Cell 25(6):2330-40); Lys M receptor proteins, LYM1-3 (Gust et al. (2012) Trends Plant Sci. 17(8):495-502.); LysM-RK proteins, LYK1-5, (Shinya e/ a/. (2015) Curr. Opin. Plant Biol. 26:64-71.) The methods for enhancing the resistance of plants to plant disease caused by at least one plant pathogen can be used with any plant species to enhance the resistance of the plant to at least one plant pathogen. Plants of the invention include, for example, monocot and dicot plants, particularly non-solanaceous plants or any plant species that is not known to comprise CSPR. Preferred plants of the invention are crop plants, particularly non- solanaceous crop plants or other crop plants that are not known to comprise CSPR. Examples of crop plants include, but are not limited, grain plants (e.g. maize, wheat, rice, oat, barley, rye, millet) oil and oilseed plants (e.g. oil palm, coconut, olive, soybean, canola, sunflower, safflower, cotton, peanut, sesame, flax), forage plants (e.g. alfalfa), fiber plants (e.g. cotton, flax), fruit trees (e.g. apple, pear, peach, plum, cherry, orange, grapefruit, lemon, lime, avocado), nut trees (e.g. almond, cashew, English walnut, pecan, pistachio, hazelnut), berries (e.g. strawberry, raspberry, blueberry, cranberry, lingonberry), sugarcane, sugar beets, and vegetable plants (e.g. lettuce, potato, tomato, pepper, eggplant, sweet potato, cassava, squash, pumpkin, onion, carrot, celery, cabbage, cauliflower, broccoli, and garden beet). Such non- solanaceous crop plants include, but are not limited to, cotton, soybean, maize, wheat, rice, oat, barley, sorghum, cabbage, cauliflower, broccoli, sweet potato, lettuce, apple, citrus, strawberry, banana, sugarcane, and palm.

The present invention provides transformed plants comprising stably incorporated in their respective genomes a heterologous nucleic acid construct comprising a nucleotide sequence that encodes a CSPR. Preferably, such transformed plants comprise enhanced resistance to at least one plant pathogen. More preferably, such transformed plants comprise enhanced resistance to two, three, four, five, or more plant pathogens.

The plants disclosed herein find use in methods for limiting plant disease caused by at least one plant pathogen in agricultural crop production, particularly in regions where the plant disease is prevalent and is known to negatively impact, or at least has the potential to negatively impact, agricultural yield. The methods of the invention comprise planting a plant (e.g. a seedling), tuber, or seed of the present invention, wherein the plant, tuber, or seed comprises a nucleic acid construct of the present invention comprising a nucleotide sequence encoding a CSPR and optionally comprises a heterologous polynucleotide of the present invention comprising a nucleotide sequence encoding an additional PRR. The methods further comprise growing the plant that is derived from the seedling, tuber, or seed under conditions favorable for the growth and development of the plant, and optionally harvesting at least one product produced by the plant selected from the group consisting of a fruit, a tuber, a leaf, a root, a stem, a bud, and a seed.

Additionally, the present invention provides transformed plants, seeds, and plant cells produced by the methods of present invention and/or comprising a nucleic acid construct of the present invention. Also provided are progeny plants and seeds thereof comprising a nucleic acid construct of the present invention. The invention additionally provides fruits, seeds, tubers, leaves, and other plant parts produced by the transformed plants and/or progeny plants of the invention as well as food products and other agricultural products produced from such plant parts that are intended to be consumed or used by humans and other animals including, but not limited to pets (e.g., dogs and cats) and livestock (e.g., pigs, cows, chickens, turkeys, and ducks).

The present invention further provides methods for increasing the transformation efficiency of a solanaceous plant in Agrobacterium-mediated transformation. A solanaceous plant produced by such methods comprises increased transformation efficiency for the transformation with a gene of interest relative to a control plant. Transformation efficiency is a relative measure of the efficiency of transformation of a plant or part thereof with a gene of interest. Transformation efficiency can be determined by any calculation method commonly used by those skilled in the art for a particular plant transformation method and is applicable to both stable and transient transformation methods. For example, transformation efficiency can be determined s the ratio of the number of transformed plants recovered to the number of explants that were inoculated with Agrobacterium harboring a Ti plasmid with the gene of interest, or in the case of floral-dip transformation by the number of transformed plants recovered per dipped plant.

The methods for increasing the transformation efficiency of a solanaceous plant comprise decreasing the expression level and/or activity of CSPR in the solanaceous plant or part thereof. While the present invention is not known to depend on a particular biological mechanism, it is believed that by decreasing the expression level and/or activity of CSPR in the solanaceous plant, transformation efficiency is increased relative to control solanaceous plant because the typical immune responses that occur upon contacting the solanaceous plant with a plant pathogen, particularly a bacterial plant pathogen are reduced. Such a control solanaceous plant is a solanaceous plant comprising a normal or wild-type expression level and/or activity of CSPR. In the present invention, "increasing transformation efficiency in plants" is intended to mean that the transformation efficiency is increased using the methods of the present invention in which the expression level and/or activity of CSPR has been decreased in a solanaceous plant or part thereof when compared to the same Agrobacterium-mediated transformation method using a control solanaceous plant or part thereof in which the expression level and/or activity of CSPR has not been decreased. For the method of the present invention, transformation efficiency is increased preferably by at least 10%, 15% or 25%, more preferably by at least 50%, 75%, or 100%, most preferably by at least 150%, 200%, or more%.

The methods for increasing the transformation efficiency of a solanaceous plant for

Agrobacterium-mediated transformation of the present invention comprise decreasing the expression level and/or activity of CSPR in the solanaceous plant or part thereof. While the present invention is not known to depend on a particular biological mechanism, it is believed that by decreasing the expression level and/or activity of CSPR in the solanaceous plant or part thereof, transformation efficiency is increased relative to the transformation efficiency of the control solanaceous plant because the typical immune responses that occur upon contacting the solanaceous plant with a plant pathogen, particularly a bacterial plant pathogen, are reduced. Such a control solanaceous plant is a solanaceous plant comprising a normal or wild-type expression level and/or activity of CSPR.

The methods of the present invention for increasing the transformation efficiency of a solanaceous plant for Agrobacterium -mediated transformation do not depend on a particular method for decreasing the expression level and/or activity of CSPR in the host plant or part thereof. Any method or methods of decreasing the expression level and/or activity of a protein in a plant or plant cell that are known in the art or otherwise disclosed herein can be used in the methods of the present invention. Such methods include, for example, gene disruption, targeted mutagenesis, homologous recombination, mutation breeding, transgenic expression of a gene silencing element, and post-transcriptional gene silencing.

In certain embodiments of the invention, decreasing the expression level and/or activity of CSPR in a plant or part thereof comprises introducing into at least one plant cell a disruption of the CSPR gene. Such a disruption decreases the expression level and/or activity of CSPR in the plant cell as compared to a corresponding control plant cell lacking the disruption of the CSPR gene. As used herein, by "disrupt", "disrupted" or "disruption" is meant any disruption of a gene such that the disrupted gene is incapable of directing the efficient expression of a full-length fully functional gene product. The term "disrupt", "disrupted" or "disruption" also encompasses that the disrupted gene or one of its products can be functionally inhibited or inactivated such that a gene is either not expressed or is incapable of efficiently expressing a full-length and/or fully functional gene product.

Functional inhibition or inactivation can result from a structural disruption and/or interruption of expression at either the level of transcription or translation. Disruption can be achieved, for example, by at least one mutation or structural alteration, genomic disruptions (e.g. DNA insertion, DNA deletion, transposons, tilling, homologous recombination, etc.), gene silencing elements, RNA interference, RNA silencing elements or antisense constructs. The decrease of expression and/or activity can be measured by determining the presence and/or amount of transcript (e.g. by Northern blotting or RT-PCR techniques), by determining the presence and/or amount of full-length or truncated polypeptide encoded by the disrupted gene (e.g. by ELISA or Western blotting), or by determining the presence and/or amount of CSPR activity (e.g. by kinase activity assay or by determining oomycete pathogenicity) in the plant or part thereof with the disrupted CSPR gene as compared to a control plant lacking the disrupted CSPR gene. As used herein, it is also to be understood that "disruption" also encompasses a disruption which is effective only in a part of a plant, in a particular cell type or tissue. A disruption may be achieved by interacting with or affecting within a coding region, within a non-coding region, and/or within a regulatory region, for example, a promoter region.

In specific embodiments, the CSPR gene that is disrupted comprises the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 4 or encodes the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 5. In other embodiments, the CSPR gene comprising that is disrupted comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, or higher sequence identity to the nucleotide sequence set forth in SEQ ID NO: 1 and/ or SEQ ID NO: 4.

In one embodiment the disruption of CSPR comprises a DNA insertion of at least one base pair. In some cases, the DNA insertion can be in the CSPR gene. The DNA insertion can comprise insertion of any size DNA fragment into the genome. The inserted DNA can be 1 nucleotide (nt) in length, 1-5 nt in length, 5-10 nt in length, 10-15 nt in length, 15-20 nt in length, 20-30 nt in length, 30-50 nt in length, 50-100 nt in length, 100-200 nt in length, 200- 300 nt in length, 300-400 nt in length, 400-500 nt in length, 500-600 nt in length, 600-700 nt in length, 700-800 nt in length, 800-900 nt in length, 900-1000 nt in length, 1000-1500 nt in length or more such that the inserted DNA decreases the expression level and/or activity of CSPR. The DNA can be inserted within any region of the CSPR gene, including for example, exons, introns, promoter, 3'UTR or 5'UTR as long as the inserted DNA decreases the expression level and/or activity of CSPR. In some embodiments the DNA can be inserted in the 5' UTR of the CSPR gene, in an exon of the CSPR gene or in an intron of the CSPR gene. In specific embodiments, the DNA insertion can be in exon 1 of the CSPR gene, in exon 2 of the CSPR gene, or in intron 2 of the CSPR gene. The DNA to be inserted can be introduced to a plant cell by any method known in the art, for example, by using

Agrobacterium-m diated recombination or biolistics. In a specific embodiment, the DNA insertion comprises a T-DNA insertion. Methods of making T-DNA insertion mutants are well known in the art.

The disruption of the CSPR gene can also comprise a deletion in the CSPR gene. As used herein, a "deletion" is meant the removal of one or more nucleotides or base pairs from the DNA. Provided herein, a deletion in the CSPR gene can be the removal of at least 1 , at least 20, at least 50, at least 100, at least 500, at least 1000, at least 5000 or more base pairs or nucleotides such that the deletion decreases the expression level and/or activity of CSPR. In some cases, the entire gene can be deleted. In one embodiment, a disruption in the CSPR gene comprises deletion of at least one base pair from the CSPR gene. The DNA deletion can be within any region of the CSPR gene, including, for example, exons, introns, promoter, 3' UTR or 5'UTR as long as the deletion decreases the expression level and/or activity of CSPR. The DNA deletion can be by any method known in the art, for example, by genome editing techniques as described elsewhere herein.

In other embodiments, the disruption of the CSPR gene can comprise a substitution in the CSPR gene. As used herein, a "substitution" is meant the replacement of one or more nucleotides or base pairs from the DNA with non-identical nucleotides or base pairs. When the substitution comprises two or more nucleotides, the two or more nucleotides can be contiguous or non-contiguous within the CSPR gene. Provided herein, a substitution in the CSPR gene can be the replacement of at least 1, at least 20, at least 50, at least 100, at least 500, at least 1000, at least 5000 or more base pairs or nucleotides such that the substition decreases the expression level and/or activity of CSPR. In one embodiment, a substitution in the CSPR gene comprises replacement of at least one base pair from the CSPR gene with a non-identical base pair. The DNA substitution can be within any region of the CSPR gene, including, for example, exons, introns, promoter, 3' UTR or 5'UTR as long as the substitution decreases the expression level and/or activity of CSPR. The DNA substitution can be by any method known in the art, for example, by genome editing techniques as described elsewhere herein.

In some cases, the disruption of the CSPR gene is a homozygous disruption. By "homozygous" is meant that the disruption is in both copies of the CSPR gene. In other cases, the disruption of the CSPR gene is heterozygous, that is, the disruption is only in one copy of the CSPR gene.

Any methods known in the art for modifying DNA in the genome of a plant can be used to modify genomic nucleotide sequences in planta, for example, to replace, disrupt, or otherwise modify an endogenous gene or allele thereof, such as, for example, CSPR. Such methods include genome editing techniques, such as, for example, methods involving targeted mutagenesis, homologous recombination, and mutation breeding. Targeted mutagenesis or similar techniques are disclosed in U.S. Patent Nos. 5,565,350; 5,731,181 ; 5,756,325; 5,760,012; 5,795,972 and 5,871,984; all of which are herein incorporated in their entirety by reference. Methods for gene modification or gene replacement involving homologous recombination can involve inducing double breaks in DNA using zinc-finger nucleases (ZFN), TAL (transcription activator-like) effector nucleases (TALEN), Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated nuclease (CRISPR/Cas nuclease), or homing endonucleases that have been engineered endonucleases to make double-strand breaks at specific recognition sequences in the genome of a plant, other organism, or host cell. See, for example, Durai et al , (2005) Nucleic Acids Res 33:5978-90; Mani et al. (2005) Biochem Biophys Res Comm. 335:447-57; U.S. Pat. Nos. 7,163,824, 7,001,768, and 6,453,242; Arnould et al. (2006) J Mol Biol 355:443-58; Ashworth et al , (2006) Nature 441 :656-9; Doyon et al. (2006) J Am Chem Soc 128:2477-84; Rosen et al , (2006) Nucleic Acids Res 34:4791-800; and Smith er a/. , (2006) Nucleic Acids Res 34:el49; U.S. Pat.App. Pub. No. 2009/0133152; and U.S. Pat. App. Pub. No. 2007/0117128; all of which are herein incorporated in their entirety by reference.

TAL effector nucleases (TALENs) can be used to make double-strand breaks at specific recognition sequences in the genome of a plant for gene disruption, gene

modification, or gene replacement through homologous recombination. TAL effector nucleases are a class of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequences in the genome of a plant or other organism. TAL effector nucleases are created by fusing a native or engineered transcription activator-like (TAL) effector, or functional part thereof, to the catalytic domain of an endonuclease, such as, for example, Fokl. The unique, modular TAL effector DNA binding domain allows for the design of proteins with potentially any given DNA recognition specificity. Thus, the DNA binding domains of the TAL effector nucleases can be engineered to recognize specific DNA target sites and thus, used to make double-strand breaks at desired target sequences. See, WO 2010/079430; Morbitzer et al. (20\0) PNAS 10.1073/pnas.1013133107; Scholze & Boch (2010) Virulence 1 :428-432; Christian et al. Genetics (2010) 186:757-761 ; Li et al. (2010) Nuc. Acids Res. (2010) doi: 10.1093/nar/gkq704; and Miller et al. (2011) Nature

Biotechnology 29: 143-148; all of which are herein incorporated by reference.

The CRISPR/Cas nuclease system can also be used to make double-strand breaks at specific recognition sequences in the genome of a plant for gene disruption, gene

modification, or gene replacement through homologous recombination. The CRISPR/Cas nuclease is an RNA-guided (simple guide RNA, sgRNA in short) DNA endonuclease system performing sequence-specific double-stranded breaks in a DNA segment homologous to the designed RNA. It is possible to design the specificity of the sequence (Cho S.W. et al., Nat. Biotechnol. 31 :230-232, 2013; Cong L. et al, Science 339:819-823, 2013; Mali P. et al, Science 339:823-826, 2013; Feng Z. et al, Cell Research: 1-4, 2013).

In addition, a ZFN can be used to make double-strand breaks at specific recognition sequences in the genome of a plant for gene disruption, gene modification, or gene replacement through homologous recombination. The Zinc Finger Nuclease (ZFN) is a fusion protein comprising the part of the Fokl restriction endonuclease protein responsible for DNA cleavage and a zinc finger protein which recognizes specific, designed genomic sequences and cleaves the double-stranded DNA at those sequences, thereby producing free DNA ends (Urnov F.D. et al, Nat Rev Genet. 11 :636-46, 2010; Carroll D., Genetics. 188:773-82, 2011).

Breaking DNA using site specific nucleases, such as, for example, those described herein above, can increase the rate of homologous recombination in the region of the breakage. Thus, coupling of such effectors as described above with nucleases enables the generation of targeted changes in genomes which include additions, deletions and other modifications.

Mutation breeding can also be used in the methods and compositions provided herein.

Mutation breeding methods can involve, for example, exposing the plants or seeds to a mutagen, particularly a chemical mutagen such as, for example, ethyl methanesulfonate (EMS) and selecting for plants that possess a desired modification in the CSPR gene. However, other mutagens can be used in the methods disclosed herein including, but not limited to, radiation, such as X-rays, Gamma rays (e.g., cobalt 60 or cesium 137), neutrons, (e.g. , product of nuclear fission by uranium 235 in an atomic reactor), Beta radiation (e.g. , emitted from radioisotopes such as phosphorus 32 or carbon 14), and ultraviolet radiation (preferably from 2500 to 2900 nm), and chemical mutagens such as base analogues (e.g., 5- bromo-uracil), related compounds (e.g., 8-ethoxy caffeine), antibiotics (e.g., streptonigrin), alkylating agents (e.g., sulfur mustards, nitrogen mustards, epoxides, ethylenamines, sulfates, sulfonates, sulfones, lactones), azide, hydroxylamine, nitrous acid, or acridines. Further details of mutation breeding can be found in "Principals of Cultivar Development" Fehr, 1993 Macmillan Publishing Company the disclosure of which is incorporated herein by reference.

In some embodiments of the methods for increasing the transformation efficiency of a solanaceous plant, decreasing the expression level and/or activity of CSPR in a plant or part thereof can comprise altering the coding sequence of the CSPR protein, whereby the altered coding sequence encodes an amino acid sequence that comprises at least one amino acid substitution when compared to the amino acid sequence of the unmodified CSPR protein. The coding sequence can be altered, for example, by making a targeted change in one or more nucleotides in the coding sequence (i. e. , site directed mutagenesis) or by random mutagenesis. If desired, the altered coding sequences can then be used in assays for determining if the alteration increases the transformation efficiency of a solanaceous plant or cell thereof, when compared to a control, solanaceous plant or cell thereof.

The methods of the present invention can comprise decreasing the expression level and/or activity of an endogenous or native CSPR gene in a plant or cell thereof using any method disclosed herein or otherwise known in the art. Such methods of decreasing the expression level and/or activity of a gene include, for example, in vivo targeted mutagenesis, homologous recombination, and mutation breeding. In one embodiment of the methods of the present invention, the expression of an endogenous or native CSPR gene is eliminated in a plant by the replacement of the endogenous or native CSPR gene or part thereof with a polynucleotide encoding a modified CSPR protein or part thereof through a method involving homologous recombination as described elsewhere herein. In such an embodiment, the methods can further comprise selfing a heterozygous plant comprising one copy of the polynucleotide and one copy of the endogenous or native CSPR gene and selecting for a progeny plant that is homozygous for the polynucleotide. The methods of the present invention involve decreasing the expression level and/or activity of CSPR in a plant or part thereof. As used herein, by "decreasing" or " decreased" is meant a decrease in expression level and/or activity of CSPR of at least about 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% or more relative to a corresponding control plant, plant part, or cell which did not have a disruption in the CSPR gene or a polynucleotide construct of the invention introduced. Generally, the control plant will be identical or nearly identical to the subject plant (i.e., the plant according one of the methods or compositions disclosed herein) and exposed to the same environmental conditions and pathogen(s) expect that the control plant will not be subjected to the method of the invention. For example, in embodiments of the invention comprising producing a subject plant that is stably transformed with a polynucleotide construct of the invention, a control plant is preferably of the same species and typically genetically identical to the subject plant except that the control plant lacks the polynucleotide construct of the invention or contains a control construct that is designed to be non-functional with respect to decreasing the expression level and/or activity of CSPR. Such a control construct might lack a promoter and/or a transcribed region or comprise a transcribed region that is unrelated to CSPR.

The expression level of CSPR in the plant or part thereof may be determined using standard assays known in the art, for example, by assaying for the expression level or activity of CSPR in the plant. Methods for determining the level of CSPR include, for example, immunological methods including Western blot assays or histochemical techniques. The activity of CSPR can be determined by various assays known in the art, for example, by binding assays that are disclosed herein below or otherwise known in the art.

The present invention further provides methods of producing solanaceous plants that are capable of displaying increased transformation efficiency in Agrobacterium-mediated transformation relative to a control solanaceous plant. In one embodiment, the methods comprise disrupting in a solanaceous plant cell a CSPR gene, wherein the disruption in the CSPR gene decreases the expression level and/or activity of CSPR in the solanaceous plant cell when compared to a corresponding solanaceous plant cell lacking the disruption of the CSPR gene. In another embodiment, the methods comprise stably incorporating in the genome of at least one solanaceous plant cell a polynucleotide construct of the invention as described above comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell. The transcribed region can encode a modified CSPR protein, or the transcribed region can be designed to produce a transcript for post- transcriptional gene silencing or antisense mediated gene silencing of CSPR. Solanaceous plants produced by such methods display increased transformation efficiency in

Agrobacterium-mediated transformation relative to a control solanaceous plant for which the expression level and/or activity of CSPR has not been decreased. Thus, the present invention further provides solanaceous plant and plants cells comprising one or more such disruptions in a CSPR gene.

In preferred embodiments of the invention, the methods for increasing the

transformation efficiency of a solanaceous plant for Agrobacterium-mediated transformation comrprise disrupting the expression of an endogenous CSPR gene in a solanaceous plant involving genome editing. Any genome editing methodology can be used in the methods of the present invention, such as, for example, the CRISPR/Cas nuclease system, ZFNs, TALENs, and homing endonucleases described above.

In some embodiments, the methods for increasing transformation efficiency comprise introducing a nucleic acid construct into at least one plant cell of the solanaceous plant. The nucleic acid construct can comprise a promoter that is expressible in a plant cell operably linked to a transcribed region that is designed to produce a transcript for post-transcriptional gene silencing or antisense-mediated gene silencing of CSPR. In preferred embodiments involving gene silencing, the transcript for post-transcriptional gene silencing comprises an miRNA, an siRNA, an hpRNA or a dsRNA. In certain embodiments, the nucleic acid construct is stably incorporated in the genome of the plant cell and if desired, the plant cell can be regenerated into a plant comprising in its genome the nucleic acid construct. In other embodiments, the nucleic acid constructed is introduced transiently into the plant cell, whereby the nucleic acid construct is not stably incorporated in the genome of the plant cell.

In certain embodiments of the invention decreasing the expression level or activity of

CSPR in a plant or part thereof comprises introducing a polynucleotide construct into at least one plant cell. The polynucleotide construct can comprise a promoter expressible in a plant cell operably linked to a transcribed region. The transcribed region comprises a nucleotide sequence that is designed to produce a transcript for the post-transcriptional gene silencing or antisense mediated gene silencing of CSPR, when the transcribed region is expressed in a plant cell. Such a transcribed region for the post-transcriptional gene silencing or antisense mediated gene silencing of CSPR is designed using any of the methods known in the art or described herein below. In general, the transcribed region will be sufficiently identical to all or to one or more fragments of the transcript of CSPR and/or to the complement of the transcript produced in the plant or plant cell. While it is recognized that the degree of identity between the transcribed region and the CSPR transcript or a fragment or fragments of the CSPR transcript will vary depending on a number of factors such as, for example, the particular post-transcriptional gene silencing method utilized, the base composition of the nucleotide sequence of the CSPR construct, and the length (i.e., number of nucleotides) of the transcribed region, a transcribed region that is sufficiently identical to all or to one or more fragments of the CSPR transcript and/or complement(s) thereof will have at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to all or to one or more fragments of the CSPR transcript and/or complement(s) thereof.

Post-transcriptional gene silencing is the silencing or suppression of the expression of a gene that results from the mRNA of a particular gene being degraded or blocked. The degradation of the mRNA prevents translation to form an active gene product, typically a protein. The blocking of the gene occurs through the activity of silencers, which bind to repressor regions. Any method for the post-transcriptional gene silencing that is known in the art can be used in the methods of the present invention to decrease the level of CSPR in a plant or part thereof. Some methods of post-transcriptional gene silencing are further described herein below including, for example, antisense suppression, sense suppression (also known as cosuppression), double-stranded RNA (dsRNA) interference, hairpin RNA

(hpRNA) interference or intron-containing hairpin RNA (ihpRNA) interference, micro RNA (miRNA) interference, small interfering RNA (siRNA) interference. In specific

embodiments, the method for post-transcriptional gene silencing comprises an miRNA, an siRNA, an hpRNA or a dsRNA.

In certain embodiments of the invention, a full-length CSPR transcript is used for antisense and sense suppression. In other embodiments, the specificity of silencing can be achieved by designing antisense constructs based on non-conserved sequence regions of a CSPR nucleotide sequence. Alternatively, longer antisense constructs can be used that would preferentially form an RNA duplex with the closest endogenous RNA.

In some embodiments of the invention, a decrease in the expression of a CSPR may be obtained by double-stranded RNA (dsRNA) interference. For dsRNA interference, a sense RNA molecule like that described above for cosuppression and an antisense RNA molecule that is fully or partially complementary to the sense RNA molecule are expressed in the same cell, resulting in a decrease in the expression of the corresponding endogenous messenger RNA.

Expression of the sense and antisense molecules can be accomplished by designing the expression cassette to comprise both a sense sequence and an antisense sequence.

Alternatively, separate expression cassettes may be used for the sense and antisense sequences. Multiple plant lines transformed with the dsRNA interference expression cassette or expression cassettes are then screened to identify plant lines that show the greatest decrease in CSPR expression. Methods for using dsRNA interference to decrease the expression of endogenous plant genes are described in Waterhouse et al. (1998) Proc. Natl. Acad. Sci. USA 95: 13959-13964, Uu et al. (2002) Plant Physiol. 129: 1732-1743, and WO 99/49029, WO 99/53050, WO 99/61631, and WO 00/49035; each of which is herein incorporated by reference.

In some embodiments of the invention, a decrease in the expression of CSPR may be obtained by hairpin RNA (hpRNA) interference or intron-containing hairpin RNA (ihpRNA) interference. These methods are highly efficient at inhibiting the expression of endogenous genes. See, Waterhouse and Helliwell (2003) Nat. Rev. Genet. 4:29-38 and the references cited therein.

For hpRNA interference, the expression cassette is designed to express an RNA molecule that hybridizes with itself to form a hairpin structure that comprises a single- stranded loop region and a base-paired stem. The base-paired stem region comprises a sense sequence corresponding to all or part of the endogenous messenger RNA encoding the gene whose expression is to be inhibited, and an antisense sequence that is fully or partially complementary to the sense sequence. Thus, the base-paired stem region of the molecule generally determines the specificity of the RNA interference. hpRNA molecules are highly efficient at inhibiting the expression of endogenous genes, and the RNA interference they induce is inherited by subsequent generations of plants. See, for example, Chuang and Meyerowitz (2000) Proc. Natl. Acad. Sci. USA 97:4985-4990; Stoutjesdijk et al. (2002) Plant Physiol. 129: 1723-1731 ; and Waterhouse and Helliwell (2003) Nat. Rev. Genet. 4:29-38. Methods for using hpRNA interference to inhibit or silence the expression of genes are described, for example, in Chuang and Meyerowitz (2000) Proc. Natl. Acad. Sci. USA 97:4985-4990; Stoutjesdijk et al. (2002) Plant Physiol. 129: 1723-1731 ; Waterhouse and Helliwell (2003) Nat. Rev. Genet. 4:29-38; Pandolfini et al. BMC Biotechnology 3:7, and U.S. Patent Publication No. 20030175965; each of which is herein incorporated by reference. A transient assay for the efficiency of hpRNA constructs to silence gene expression in vivo has been described by Panstruga et al. (2003) Mol. Biol. Rep. 30: 135-140, herein

incorporated by reference.

For ihpRNA, the interfering molecules have the same general structure as for hpRNA, but the RNA molecule additionally comprises an intron that is capable of being spliced in the cell in which the ihpRNA is expressed. The use of an intron minimizes the size of the loop in the hairpin RNA molecule following splicing, and this increases the efficiency of

interference. See, for example, Smith et al. (2000) Nature 407:319-320. In fact, Smith et al. show 100% suppression of endogenous gene expression using ihpRNA-mediated

interference. Methods for using ihpRNA interference to decrease the expression of endogenous plant genes are described, for example, in Smith et al. (2000) Nature 407:319- 320; Wesley et al. (2001) Plant J. 27:581 -590; Wang and Waterhouse (2001) Curr. Opin. Plant Biol. 5 : 146-150; Waterhouse and Helliwell (2003) Nat. Rev. Genet. 4:29-38; Helliwell and Waterhouse (2003) Methods 30:289-295, and U. S. Patent Publication No. 20030180945, each of which is herein incorporated by reference.

The expression cassette for hpRNA interference may also be designed such that the sense sequence and the antisense sequence do not correspond to an endogenous RNA. In this embodiment, the sense and antisense sequence flank a loop sequence that comprises a nucleotide sequence corresponding to all or part of the endogenous messenger RNA of the target gene. Thus, it is the loop region that determines the specificity of the RNA

interference. See, for example, WO 02/00904, herein incorporated by reference.

Transcriptional gene silencing (TGS) may be accomplished through use of hpRNA constructs wherein the inverted repeat of the hairpin shares sequence identity with the promoter region of a gene to be silenced. Processing of the hpRNA into short RNAs which can interact with the homologous promoter region may trigger degradation or methylation to result in silencing (Aufsatz et al. (2002) PNAS 99 (Suppl. 4): 16499-16506; Mette et al.

(2000) EMBO J 19(19):5194-5201).

Amplicon expression cassettes comprise a plant virus-derived sequence that contains all or part of the target gene but generally not all of the genes of the native virus. The viral sequences present in the transcription product of the expression cassette allow the transcription product to direct its own replication. The transcripts produced by the amplicon may be either sense or antisense relative to the target sequence (i.e., the messenger RNA for a CSPR). Methods of using amplicons to inhibit the expression of endogenous plant genes are described, for example, in Angell and Baulcombe (1997) EMBO J. 16:3675-3684, Angell and Baulcombe (1999) Plant J. 20:357-362, and U.S. Patent No. 6,646,805, each of which is herein incorporated by reference.

In some embodiments, the polynucleotide expressed by the expression cassette of the invention is catalytic RNA or has ribozyme activity specific for the messenger RNA of a CSPR. Thus, the polynucleotide causes the degradation of the endogenous messenger RNA, resulting in reduced expression of the CSPR. This method is described, for example, in U.S. Patent No. 4,987,071, herein incorporated by reference.

In some embodiments of the invention, a decrease in the expression of CSPR may be obtained by RNA interference by expression of a gene encoding a micro RNA (miRNA). miRNAs are regulatory agents consisting of about 22 ribonucleotides. miRNA are highly efficient at decreasing the expression of endogenous genes. See, for example Javier et al. (2003) Nature 425: 257-263, herein incorporated by reference.

For miRNA interference, the expression cassette is designed to express an RNA molecule that is modeled on an endogenous miRNA gene. The miRNA gene encodes an RNA that forms a hairpin structure containing a 22-nucleotide sequence that is

complementary to another endogenous gene (target sequence). For suppression of CSPR expression, the 22-nucleotide sequence is selected from a CSPR transcript sequence and contains 22 nucleotides of said sequence in sense orientation and 21 nucleotides of a corresponding antisense sequence that is complementary to the sense sequence. miRNA molecules are highly efficient at decreasing the expression of endogenous genes, and the RNA interference they induce is inherited by subsequent generations of plants.

In certain embodiments of the invention, a decrease in the expression level and/or activity of CSPR is achieved using virus-induced gene silencing (VIGS) which is a transient RNA silencing method. VIGS comprises the use of viral vectors to introduce gene fragments homologous to a gene of interest into a plant host. See Lu et al. (2003) Methods 30:296-303; Burch-Smith et al. (2004) Plant J. 39:734-746; and Robertson (2004) Annu. Rev. Plant. Biol. 55:495-519. Endogenous RNA silencing machinery then acts to eliminate viral RNA sequences and inadvertently also targets the mRNA of the gene of interest (e.g. CSPR) for removal. In this way, the gene of interest is silenced, through the removal of its mRNA.

The methods of the present invention for increasing the transformation efficiency of a solanaceous plant can be used with any solanaceous plant. Solanaceous plants include, but are not limited to, potato, tomato, tomatillo, eggplant, pepper {Capsicum spp.), tobacco, Cape gooseberry, and petunia. In some preferred embodiments, the solanaceous plant is Nicotiana benthamiana and the CSPR is NbCSPR. In other preferred embodiments, the solanaceous plant is Nicotiana tabacum the CSPR is NtCSPR.

The solanaceous plants produced by the methods for increasing the transformation efficiency of the present invention find use in improved methods for the Agrobacterium- mediated transformation of solanaceous plants with a gene of interest including, for example, both stable and transient transformation methods. Thus, the present invention further provides methods for the transformation of solanaceous plants with a gene of interest. Such methods comprise contacting a modified solanaceous plant cell with an Agrobacterium strain comprising the gene of interest contained in a Ti plasmid, whereby the gene of interest is transferred to the at least one cell. The modified solanaceous plant cell is from a solanaceous plant of that has been modified as described herein to comprise a decreased expression level and/or activity of CSPR, relative to the expression level and/or activity of CSPR in a control solanaceous plant cell. The methods of the present invention do not depend on use of a particular Agrobacterium species or strain thereof. Any strain of Agrobacterium that is suitable for use in the transformation of solanaceous plants can be used in the methods of the present invention including, for example, strains of Agrobacterium tumefaciens and strains of Agrobacterium rhizogenes. The methods for the transformation of the present invention can be used with any solanaceous plant including, but not limited to potato, tomato, tomatillo, eggplant, pepper (Capsicum spp.), tobacco, Cape gooseberry, and petunia.

The methods of the present invention find use in agriculture, particularly in the development of crop plants with enhanced resistance to plant diseases. Such crop plants include resistant and susceptible plant varieties. Such resistant plant varieties may, for example, comprise one or more R genes that are introduced into the plant varieties by conventional plant breeding methods and/or via transformation involving recombinant DNA. Such R genes typically encode proteins containing leucine-rich repeats (LRRs). Such R proteins can contain transmembrane domains, or can be localized intracellularly. In addition, many R proteins contain nucleotide-binding (NB) domains (also referred to as P-loops), Toll- interleukin-1 receptor (TIR) domains, or protein kinase domains in various combinations. R genes have been isolated from a wide range of plant species, including Arabidopsis, flax, maize, rice, wheat, soybean, tomato, potato, and others (reviewed in, for example: Ellis et al. (2000) Curr. Opin. Plant Biol. 3:278-84; Jones and Dangl (2006) Nature 444:323-29; Bent and Mackey (2007) Annu. Rev. Phytopathol. 45:399-436; Tameling and Takken (2008) Eur. J. Plant Pathol. 121 : 243-255.

The methods of the present invention find use in enhancing the resistance of a plant to one or more pathogens. Such plant pathogens include, for example, eukaryotic and/or prokaryotic plant pathogens. In certain embodiments, the methods of the present invention enhance the resistance of a plant to one or more prokaryotic plant pathogens, particularly to one or more bacterial plant pathogens, more particularly to one or more eubacterial plant pathogens. It is recognized that term "bacteria" encompasses "eubacteria", which are also known as "true bacteria", and archaebacteria.

In some embodiments, the methods of the present invention enhance the resistance of a plant to two, three, four, five, or more plant pathogens, particularly bacterial plant pathogens, more particularly eubacterial plant pathogens. Preferably, the methods of the present invention enhance the resistance of a plant to all bacterial plant pathogens that can cause disease symptoms on a like plant that has not been enhanced by the methods disclosed herein. Such a "like plant" is the same species as the plant of the invention that has been enhanced for disease resistance by the methods disclosed herein. Preferably, such a "like plant" is the same variety or cultivar as the enhanced plant of the invention but lacks the introduced nucleic acid construct or any other polynucleotide introduced by in the methods of the present invention for enhancing the resistance of a plant to one or more pathogens.

The present invention further provides transformed plants comprising a nucleic acid constructs and/or polynucleotides of the present invention. In some embodiments, the nucleic acid constructs and/or polynucleotides of the present invention are stably incorporated into the genome of the plant, and in other embodiments, the plant is transformed by a transient transformation method and the nucleic acid constructs and/or polynucleotides is not stably incorporated into the genome of the plant. Methods for both the stable and transient transformation of plants are disclosed elsewhere herein or otherwise known in the art.

Depending on the desired outcome, the nucleic acids, nucleic acid constructs and other polynucleotides of the present invention can be stably incorporated into the genome of the plant cell or not stably incorporated into genome of the plant cell. If, for example, the desired outcome is to produce a stably transformed plant with enhanced resistance to a plant disease caused by at least one plant pathogen, then the polynucleotide construct can be, for example, fused into a plant transformation vector suitable for the stable incorporation of the polynucleotide construct into the genome of the plant cell. Typically, the stably transformed plant cell will be regenerated into a transformed plant that comprises in its genome the polynucleotide construct. Such a stably transformed plant is capable of transmitting the polynucleotide construct to progeny plants in subsequent generations via sexual and/or asexual reproduction. Plant transformation vectors, methods for stably transforming plants with an introduced polynucleotide construct and methods for plant regeneration from transformed plant cells and tissues are generally known in the art for both monocotyledonous and dicotyledonous plants or described elsewhere herein.

In other embodiments of the invention in which it is not desired to stably incorporate the polynucleotide construct in the genome of the plant, transient transformation methods can be utilized to introduce the polynucleotide construct into one or more plant cells of a plant. Such transient transformation methods include, for example, viral-based methods which involve the use of viral particles or at least viral nucleic acids. Generally, such viral-based methods involve constructing a modified viral nucleic acid comprising the a polynucleotide construct of the invention operably linked to the viral nucleic acid and then contacting the plant either with a modified virus comprising the modified viral nucleic acid or with the viral nucleic acid or with the modified viral nucleic acid itself.

The present invention provides nucleic acid constructs comprising nucleic acid sequences encoding CSPR. Preferably, such nucleic acid constructs are capable of conferring upon a host plant, particularly a non-solanaceous host plant enhanced resistance to a plant disease caused by at least one plant pathogen. Thus, nucleic acid constructs find use in limiting a plant disease caused by at least one plant pathogen, particularly a bacterial plant pathogen, in agricultural production. The nucleic acid constructs of the present invention comprise at least one nucleotide sequence encoding CSPR including, but are not limited to, the nucleotide sequences encoding CSPR disclosed herein but also include orthologs and other variants that are capable of conferring to a plant resistance to a plant disease caused by at least one plant pathogen. Methods are known in the art or otherwise disclosed herein for determining resistance of a plant to a plant disease caused by one plant pathogen, including, for example, the methods described by Zipfel et. al. ((2004) Nature 428:764-767) and Balmuth & Rathjen ((2007) Plant J. 51(6): 978-990).

The methods of the present invention find use in producing plants with enhanced resistance to a plant disease caused by at least one plant pathogen. Typically, the methods of the present invention will enhance or increase the resistance of the subject plant to the plant disease by at least 25%, 50%, 75%, 100%, 150%, 200%, 250%, 500% or more when compared to the resistance of a control plant to the same plant pathogen. Unless stated otherwise or apparent from the context of a use, a control plant for the present invention is a plant that does not comprise the nucleic acid construct of the present invention. Preferably, the control plant is essentially identical (e.g. same species, subspecies, and variety) to the plant comprising the nucleic acid construct of the present invention except the control does not comprise the nucleic acid construct. In some embodiments, the control plant will comprise a nucleic acid construct but not comprise at least one nucleotide sequence encoding CSPR that is in a nucleic acid construct of the present invention.

Additionally, the present invention provides transformed plants, seeds, and plant cells produced by the methods of present invention and/or comprising a polynucleotide construct of the present invention. Also provided are progeny plants and seeds thereof comprising a polynucleotide construct of the present invention. The present invention also provides fruits, seeds, tubers, leaves, and other plant parts produced by the transformed plants and/or progeny plants of the invention as well as food products and other agricultural products produced from such plant parts that are intended to be consumed or used by humans and other animals including, but not limited to pets (e.g., dogs and cats) and livestock (e.g., pigs, cows, chickens, turkeys, and ducks).

Unless expressly stated or apparent from the context of usage, the methods and compositions of the present invention can be used with any plant species. Examples of plant species of interest include, but are not limited to, com (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgar e), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solarium tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), strawberry (e.g. Fragaria x ananassa, Fragaria vesca, Fragaria moschata, Fragaria virginiana, Fragaria chiloensis), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), oil palm (e.g. Elaeis guineensis , Elaeis oleifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), oats, barley, vegetables, ornamentals, and conifers. In specific embodiments, plants of the present invention are crop plants (e.g. maize, sorghum, wheat, millet, rice, barley, oats, sugarcane, alfalfa, soybean, peanut, sunflower, cotton, safflower, Brassica spp., lettuce, strawberry, apple, and citrus etc.).

Vegetables include, but are not limited to, tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo). Ornamentals include, for example, azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum.

The methods of the present invention can be used with any citrus species that is susceptible to at least one pathogen. Citrus species of interest are those citrus species that are grown commercially. Such citrus species include, but are not limited to, cultivated citrus species, such as, for example, orange, lemon, Meyer lemon, Persian lime, key lime, Australian limes, grapefruit, mandarin orange, Clementine, tangelo, tangerine, kumquat, pomelo, ugli, blood orange, citron, Buddha's hand, and bitter orange.

As used herein, the term "solanaceous plant" refers to a plant that is a member of the Solanaceae family. Also as used herein, the term "non-solanaceous plant" refers to a plant that is a member of plant family other than the Solanaceae family.

For embodiments of the invention that comprise decreasing the expression level and/or activity of CSPR, solanaceous plants are the preferred plants. Solanaceous plants include, for example, domesticated and non-domesticated members of Solanaceae family. Solanaceous plants of the present invention include, but are not limited to, potato (Solanum tuberosum), eggplant (Solanum melongena), petunia (Petunia spp., e.g., Petunia x hybrida or Petunia hybrida), tomatillo (Physalis philadelphica), Cape gooseberry (Physalis peruviana), Physalis sp., woody nightshade (Solanum dulcamara), garden huckleberry (Solanum scabrum), gboma eggplant (Solanum macrocarpon), pepper (Capsicum spp.; e.g., Capsicum annuum, C. baccatum, C. chinense, C. frutescens, C. pubescens, and the like), tomato (Solanum lycopersicum or Lycopersicon esculentum), tobacco (Nicotiana spp., e.g. N.

tabacum, N. benthamiana), Solanum americanum, Solanum demissum, Solanum

stoloniferum, Solanum papita, Solanum bulbocastanum, Solanum edinense, Solanum schenckii, Solanum hjertingii, Solanum venturi, Solanum mochiquense, Solanum chacoense, and Solanum pimpinelli folium. Preferred solanaceous plants are solanaceous plants grown in agriculture including, but not limited to, potato, tomato, tomatillo, eggplant, pepper, tobacco, Cape gooseberry, and petunia.

The term "plant" is intended to encompass plants at any stage of maturity or development, as well as any cells, tissues or organs (plant parts) taken or derived from any such plant unless otherwise clearly indicated by context. Plant parts include, but are not limited to, fruits, stems, tubers, roots, flowers, ovules, stamens, leaves, embryos, meristematic regions, callus tissue, anther cultures, gametophytes, sporophytes, pollen, microspores, protoplasts, and the like. The present invention also includes seeds produced by the plants of the present invention.

The present invention encompasses fertile transformed plants and transformed seeds thereof, as well as the subsequent progeny and products derived therefrom. It is recognized that the terms "transformed plant" and "transgenic plant" are equivalent terms that are used herein interchangeable unless expressed stated or otherwise apparent from the context of usage. As used herein, the terms "transformed plant" and "transgenic plant" refer to a plant that has incorporated nucleic acid sequences, including but not limited to genes,

polynucleotides, DNA, RNA, etc., and/or alterations thereto (e.g. mutations, point mutations or the like), which have been introduced into a plant compared to a non-introduced plant. As used herein, the term "non-transgenic" refers to a plant that does not contain foreign or exogenous nucleic acid sequences incorporated into its genome by recombinant DNA methods.

By transformation is intended the genetic manipulation of the plant, cell, cell line, callus, tissue, plant part, and the like. That is, such cell, cell line, callus, tissue, plant part, or plant which has been altered by the presence of recombinant DNA wherein said DNA is introduced into the genetic material within the cell, either chromosomally, or extra- chromosomally. Recombinant DNA includes foreign DNA, heterologous DNA, exogenous DNA, and chimeric DNA.

The transformed plants of the invention can be produced by genetic engineering. Alternatively, transformed parent plants can be produced by genetic engineering and used to transfer the heterologous polynucleotides, nucleic acid constructs, and/or nucleic acids into subsequent generations by sexual or asexual reproduction. The first generation progeny of the transformed parent plants and any descendants of the transformed parent plants irrespective of the subsequent generation which comprise a heterologous polynucleotide and/or a nucleic acid construct of the present invention are also transformed plants of the present invention.

In an embodiment of the invention, the nucleotide sequences encoding CSPR have at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the entire nucleotide sequence set forth in at least one of SEQ ID NOS: 1 , 3, 4, 6, 14, 16, 18, 20, 22, and 24 or to a fragment thereof. In another embodiment of the invention, the nucleotide sequences encoding CSPR comprise an amino acid sequence having at least about 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the entire amino acid sequence set forth in at least one of SEQ ID NOS: 2, 5, 15, 17, 19, 21 , 23, and 25 or to a fragment thereof.

The present invention encompasses isolated or substantially purified polynucleotide (also referred to herein as "nucleic acid molecule", "nucleic acid" and the like) or protein (also referred to herein as "polypeptide") compositions. An "isolated" or "purified" polynucleotide or protein, or biologically active portion thereof, is substantially or essentially free from components that normally accompany or interact with the polynucleotide or protein as found in its naturally occurring environment. Thus, an isolated or purified polynucleotide or protein is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. Optimally, an "isolated" polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived. For example, in various embodiments, the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived. A protein that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%, 5%, or 1 % (by dry weight) of contaminating protein. When the protein of the invention or biologically active portion thereof is recombinantly produced, optimally culture medium represents less than about 30%, 20%, 10%, 5%, or 1 % (by dry weight) of chemical precursors or non- protein-of-interest chemicals.

Fragments and variants of the disclosed polynucleotides and proteins encoded thereby are also encompassed by the present invention. By "fragment" is intended a portion of the polynucleotide or a portion of the amino acid sequence and hence protein encoded thereby. Fragments of polynucleotides comprising coding sequences may encode protein fragments that retain biological activity of the full-length or native protein. Alternatively, fragments of a polynucleotide that are useful as hybridization probes generally do not encode proteins that retain biological activity or do not retain promoter activity. Thus, fragments of a nucleotide sequence may range from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, and up to the full-length polynucleotide of the invention.

Polynucleotides that are fragments of a native CSPR polynucleotide comprise at least 16, 20, 50, 75, 100, 125, 150, 175, 200, 250, 300, 400, 500, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, or 8000 contiguous nucleotides, or up to the number of nucleotides present in a full-length CSPR polynucleotide disclosed herein (for example, 4413, 3006, 8031 , 3006, 2304, 2985, 2997, 3009, 3006, and 2997 nucleotides for of SEQ ID NOS: 1 , 3, 4, 6, 14, 16, 18, 20, 22, and 24, respectively).

"Variants" is intended to mean substantially similar sequences. For polynucleotides, a variant comprises a polynucleotide having deletions (i.e., truncations) at the 5' and/or 3' end; deletion and/or addition of one or more nucleotides at one or more internal sites in the native polynucleotide; and/or substitution of one or more nucleotides at one or more sites in the native polynucleotide. As used herein, a "native" polynucleotide or polypeptide comprises a naturally occurring nucleotide sequence or amino acid sequence, respectively. For polynucleotides, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of one of the CSPR proteins of the invention. Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques as outlined below. Variant polynucleotides also include synthetically derived polynucleotides, such as those generated, for example, by using site-directed mutagenesis but which still encode a CSPR protein of the invention. Generally, variants of a particular polynucleotide of the invention will have at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to that particular polynucleotide as determined by sequence alignment programs and parameters as described elsewhere herein.

Variants of a particular polynucleotide of the invention (i.e., the reference polynucleotide) can also be evaluated by comparison of the percent sequence identity between the polypeptide encoded by a variant polynucleotide and the polypeptide encoded by the reference polynucleotide. Thus, for example, a polynucleotide that encodes a polypeptide with a given percent sequence identity to the polypeptide of SEQ ID NO: 2, 5, 15, 17, 19, 21, 23, or 25 are disclosed. Percent sequence identity between any two polypeptides can be calculated using sequence alignment programs and parameters described elsewhere herein. Where any given pair of polynucleotides of the invention is evaluated by comparison of the percent sequence identity shared by the two polypeptides they encode, the percent sequence identity between the two encoded polypeptides is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.

"Variant" protein is intended to mean a protein derived from the native protein by deletion (so-called truncation) of one or more amino acids at the N-terminal and/or C- terminal end of the native protein; deletion and/or addition of one or more amino acids at one or more internal sites in the native protein; or substitution of one or more amino acids at one or more sites in the native protein. Such variants may result from, for example, genetic polymorphism or from human manipulation. Biologically active variants of a CSPR protein will have at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence for the native protein (e.g. the amino acid sequence set forth in SEQ ID NO: 2, 5, 15, 17, 19, 21, 23, or 25) as determined by sequence alignment programs and parameters described elsewhere herein. A biologically active variant of a protein of the invention may differ from that protein by as few as 1-15 amino acid residues, as few as 1-10, such as 6-10, as few as 5, as few as 4, 3, 2, or even 1 amino acid residue.

The proteins of the invention may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. Methods for mutagenesis and polynucleotide alterations are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382; U.S. Patent No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Guidance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), herein incorporated by reference. Conservative

substitutions, such as exchanging one amino acid with another having similar properties, may be optimal. Thus, the genes and polynucleotides of the invention include both the naturally occurring sequences as well as mutant and other variant forms. Likewise, the CSPR proteins of the invention encompass naturally occurring proteins as well as variations and modified forms thereof. More preferably, such variants confer to a plant or part thereof comprising the variant enhanced resistance to a plant disease caused by at least one plant pathogen. In some embodiments, the mutations that will be made in the DNA encoding the variant will not place the sequence out of reading frame. Optimally, the mutations will not create complementary regions that could produce secondary mRNA structure. See, EP Patent Application

Publication No. 75,444.

The deletions, insertions, and substitutions of the protein sequences encompassed herein are not expected to produce radical changes in the characteristics of the protein.

However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays. That is, the activity can be evaluated by binding assays that are disclosed herein below or otherwise known in the art.

A CSPR is a plant receptor that binds or recognizes a CSP such as, for example, the CSP from Staphylococcus aureus. When trigged by CSP or a functional fragment thereof such as, for example, csp22 and cspl5, CSPR can induce in a plant one or more PAMP responses such as, for example, enhanced binding of ethylene and induction of an oxidative burst in the plant CSPR. For the present invention, a polypeptide comprises CSPR activity when the polypeptide is capable of inducing one or more plant PAMP responses when the CSPR is expressed in the plant and exposed to CSP or a functional fragment thereof such as, for example, csp22 and cspl5. In certain embodiments, a CSPR of the present invention will specifically bind to or recognize at least one bacterial CSP. In some preferred embodiments, a CSPR of the present invention will specifically bind to or recognize one or more of: CSP from Staphylococcus aureus, csp22, and cspl5.

Variant polynucleotides and proteins also encompass sequences and proteins derived from a mutagenic and recombinogenic procedure such as DNA shuffling. Strategies for such DNA shuffling are known in the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci. USA 91 : 10747-10751; Stemmer (1994) Nature 370:389-391 ; Crameri et al. (1997) Nature Biotech. 15:436-438; Moore et al. (1997) J. Mol.

Biol. 272:336-347; Zhang et al. (1997) PNAS 94:4504-4509; Crameri et al. (1998) Nature 391 :288-291 ; and U.S. Patent Nos. 5,605,793 and 5,837,458. The polynucleotides of the invention can be used to isolate corresponding sequences from other organisms, particularly other plants. In this manner, methods such as PCR, hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences isolated based on their sequence identity to the entire sequences set forth herein or to variants and fragments thereof are encompassed by the present invention. Such sequences include sequences that are orthologs of the disclosed sequences. "Orthologs" is intended to mean genes derived from a common ancestral gene and which are found in different species as a result of speciation. Genes found in different species are considered orthologs when their nucleotide sequences and/or their encoded protein sequences share at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity. Functions of orthologs are often highly conserved among species. Thus, isolated nucleic acid molecules that encode CSPR and which hybridize under stringent conditions to at least one of the CSPR proteins disclosed herein or otherwise known in the art, or to variants or fragments thereof, are encompassed by the present invention.

In one embodiment, the orthologs of the present invention have coding sequences comprising at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater nucleotide sequence identity to a nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NO: 1, 3, 4, 6, 14, 16, 18, 20, 22, and 24 and/or encode proteins comprising least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater amino acid sequence identity to an amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NO: 2, 5, 15, 17, 19, 21, 23, and 25.

In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any plant of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York). See also Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially-mismatched primers, and the like.

In hybridization techniques, all or part of a known polynucleotide is used as a probe that selectively hybridizes to other corresponding polynucleotides present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as ³²P, or any other detectable marker. Thus, for example, probes for

hybridization can be made by labeling synthetic oligonucleotides based on the

polynucleotides of the invention. Methods for preparation of probes for hybridization and for construction of cDNA and genomic libraries are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York).

For example, an entire polynucleotide disclosed herein, or one or more portions thereof, may be used as a probe capable of specifically hybridizing to corresponding polynucleotide and messenger RNAs. To achieve specific hybridization under a variety of conditions, such probes include sequences that are unique among the sequence of the gene or cDNA of interest sequences and are optimally at least about 10 nucleotides in length, and most optimally at least about 20 nucleotides in length. Such probes may be used to amplify corresponding polynucleotides for the particular gene of interest from a chosen plant by PCR. This technique may be used to isolate additional coding sequences from a desired plant or as a diagnostic assay to determine the presence of coding sequences in a plant. Hybridization techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, for example, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York). An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Acid Probes , Part I, Chapter 2 (Elsevier, New York); and Ausubel et al. , eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York).

It is recognized that the CSPR coding sequences of the present invention encompass polynucleotide molecules comprising a nucleotide sequence that is sufficiently identical to the nucleotide sequence of any one or more of SEQ ID NOS: 1, 3, 4, 6, 14, 16, 18, 20, 22, and 24. The term "sufficiently identical" is used herein to refer to a first amino acid or nucleotide sequence that contains a sufficient or minimum number of identical or equivalent (e.g., with a similar side chain) amino acid residues or nucleotides to a second amino acid or nucleotide sequence such that the first and second amino acid or nucleotide sequences have a common structural domain and/or common functional activity. For example, amino acid or nucleotide sequences that contain a common structural domain having at least about 45%, 55%, or 65% identity, preferably 75% identity, more preferably 85%, 90%, 95%, 96%, 97%, 98% or 99% identity are defined herein as sufficiently identical.

To determine the percent identity of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e. , percent identity = number of identical positions/total number of positions (e.g. , overlapping positions) x 100). In one embodiment, the two sequences are the same length. The percent identity between two sequences can be determined using techniques similar to those described below, with or without allowing gaps. In calculating percent identity, typically exact matches are counted.

The determination of percent identity between two sequences can be accomplished using a mathematical algorithm. A preferred, nonlimiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al. (1990) J. Mol. Biol. 215:403. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12, to obtain nucleotide sequences homologous to the polynucleotide molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3, to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389. Alternatively, PSI- Blast can be used to perform an iterated search that detects distant relationships between molecules. See Altschul et al. (1997) supra. When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. BLAST, Gapped BLAST, and PSI-Blast, XBLAST and NBLAST are available on the World Wide Web at ncbi.nlm.nih.gov. Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller (1988) CABIOS Λ Ι-Π . Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. Alignment may also be performed manually by inspection.

Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using the full-length sequences of the invention and using multiple alignment by mean of the algorithm Clustal W (Nucleic Acid Research, 22(22):4673-4680, 1994) using the program AlignX included in the software package Vector NTI Suite Version 7 (InforMax, Inc., Bethesda, MD, USA) using the default parameters; or any equivalent program thereof. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by CLUSTALW (Version 1.83) using default parameters (available at the European Bioinformatics Institute website on the World Wide Web at ebi.ac.uk/Tools/ clustal w/index).

The use of the terms "polynucleotide" and "nucleic acid" are not intended to limit the present invention to polynucleotides comprising DNA. Those of ordinary skill in the art will recognize that polynucleotides and nucleic acids, can comprise ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues. The polynucleotides and nucleic acids of the invention also encompass all forms of sequences including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem- and-loop structures, and the like.

The nucleic acid constructs comprising CSPR protein coding regions can be provided in expression cassettes for expression in the plant or other organism or non-human host cell of interest. The cassette will include 5' and 3' regulatory sequences operably linked to the CSPR protein coding region. "Operably linked" is intended to mean a functional linkage between two or more elements. For example, an operable linkage between a polynucleotide or gene of interest and a regulatory sequence (i.e., a promoter) is functional link that allows for expression of the polynucleotide of interest. Operably linked elements may be contiguous or non-contiguous. When used to refer to the j oining of two protein coding regions, by operably linked is intended that the coding regions are in the same reading frame. The cassette may additionally contain at least one additional gene (e.g. a polynucleotide encoding an additional PRR) to be cotransformed into the organism. Alternatively, the additional gene(s) can be provided on multiple expression cassettes. Such an expression cassette is provided with a plurality of restriction sites and/or recombination sites for insertion of the CSPR protein coding region to be under the transcriptional regulation of the regulatory regions. The expression cassette may additionally contain selectable marker genes.

The expression cassette will include in the 5'-3' direction of transcription, a transcriptional and translational initiation region (i.e., a promoter), a CSPR protein coding region of the invention, and a transcriptional and translational termination region (i.e., termination region) functional in plants or other organism or non-human host cell. The regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) and/or the CSPR protein coding region or of the invention may be native/analogous to the host cell or to each other. Alternatively, the regulatory regions and/or the CSPR protein coding region of the invention may be heterologous to the host cell or to each other.

As used herein, "heterologous" in reference to a nucleic acid molecule,

polynucleotide, or nucleotide sequence is a nucleic acid molecule, polynucleotide, or nucleotide sequence that originates from a foreign species, or, if from the same species, is modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide was derived, or, if from the same/analogous species, one or both are substantially modified from their original form and/or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide. As used herein, a chimeric gene comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence.

The present invention provides host cells comprising at least of the nucleic acid molecules, expression cassettes, and vectors of the present invention. In preferred embodiments of the invention, a host cells is a plant cell. In other embodiments, a host cell is selected from the group consisting of a bacterium, a fungal cell, and an animal cell. In certain embodiments, a host cell is non-human animal cell. However, in some other embodiments, the host cell is an in-vitro-cultured human cell. While it may be optimal to express the CSPR protein using heterologous promoters, the native promoter of the corresponding CSPR gene may be used.

The termination region may be native with the transcriptional initiation region, may be native with the operably linked CSPR protein coding region of interest, may be native with the plant host, or may be derived from another source (i. e. , foreign or heterologous to the promoter, the CSPR protein of interest, and/or the plant host), or any combination thereof. Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also Guerineau et al. (\99\) Mol. Gen. Genet. 262: 141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon ei a/. (1991) Genes Dev. 5: 141-149; Mogen et al. (1990) Plant Cell 2: 1261-1272; Munroe et al. (1990) Gene 91 : 151-158; Ballas et al. (1989) Nucleic Acids Res. 17:7891-7903; and Joshi et al. (1987) Nucleic Acids Res. 15:9627-9639.

Where appropriate, the polynucleotides may be optimized for increased expression in the transformed plant. That is, the polynucleotides can be synthesized using plant-preferred codons for improved expression. See, for example, Campbell and Gowri (1990) Plant

Physiol. 92: 1-11 for a discussion of host-preferred codon usage. Methods are available in the art for synthesizing plant-preferred genes. See, for example, U.S. Patent Nos. 5,380,831, and 5,436,391, and Murray et al. (1989) Nucleic Acids Res. 17:477-498, herein incorporated by reference.

Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other such well-characterized sequences that may be deleterious to gene expression. The G-C content of the sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.

The expression cassettes may additionally contain 5' leader sequences. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include: picomavirus leaders, for example, EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein et al. (1989) Proc. Natl. Acad. Sci. USA 86:6126-6130); poty virus leaders, for example, TEV leader (Tobacco Etch Virus) (Gallie et al. (1995) Gene 165(2):233-238), MDMV leader (Maize Dwarf Mosaic Virus) {Virology 154:9-20), and human immunoglobulin heavy-chain binding protein (BiP) (Macejak et al. (1991) Nature 353:90-94); untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4) (Jobling et al. (1987) Nature 325:622-625); tobacco mosaic virus leader (TMV) (Gallie et al. (1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256); and maize chlorotic mottle virus leader (MCMV) (Lommel et al. (1991) Virology

81 :382-385). See also, Della-Cioppa et al. (1987) Plant Physiol. 84:965-968.

In preparing the expression cassette, the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved.

A number of promoters can be used in the practice of the invention. The promoters can be selected based on the desired outcome. The nucleic acids can be combined with constitutive, tissue-preferred, or other promoters for expression in plants. Such constitutive promoters include, for example, the core CaMV 35 S promoter (Odell et al. (1985) Nature 313:810-812); rice actin (McElroy et al. (1990) Plant Cell 2: 163-171); ubiquitin (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and Christensen et al. (1992) Plant Mol. Biol. 18:675-689); pEMU (Last et al. (1991) Theor. Appl. Genet. 81 :581-588); MAS (Velten et al. (1984) EMBO J. 3:2723-2730); ALS promoter (U.S. Patent No. 5,659,026), and the like. Other constitutive promoters include, for example, U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611.

Tissue-preferred promoters can be utilized to target enhanced expression of the CSPR protein coding sequences within a particular plant tissue. Such tissue-preferred promoters include, but are not limited to, leaf-preferred promoters, root-preferred promoters, seed- preferred promoters, and stem-preferred promoters. Tissue-preferred promoters include Yamamoto a/. (1997) Plant J. 12(2):255-265; Kawamata a/. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. {1991) Mol. Gen Genet. 254(3): 337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol. 112(3): 1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2): 525-535; Canevascini et al. (1996) Plant Physiol. 112(2):513-524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Lam (1994) Results Probl. Cell Differ. 20: 181-196; Orozco et al. (1993) Plant Mol Biol. 23(6): 1129- 1138; Matsuoka ei a/. (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590; and Guevara- Garcia et al. (1993) Plant J. 4(3):495-505. Such promoters can be modified, if necessary, for weak expression.

Generally, it will be beneficial to express the gene from an inducible promoter, particularly from a pathogen-inducible promoter. Such promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-l,3-glucanase, chitinase, etc. See, for example, Redolfi et al. (1983) Neth. J. Plant Pathol. 89:245-254; Uknes et al. (1992) Plant Cell 4:645-656; and Van Loon (1985) Plant Mol. Virol. 4: 111-116. See also WO 99/43819, herein incorporated by reference.

Of interest are promoters that are expressed locally at or near the site of pathogen infection. See, for example, Marineau et al. (1987) Plant Mol. Biol. 9:335-342; Matron et al.

(1989) Molecular Plant-Microbe Interactions 2:325-331 ; Somsisch et al. (1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch et al. (1988) Mol. Gen. Genet. 2:93-98; and Yang (1996) Proc. Natl. Acad. Sci. USA 93: 14972-14977. See also, Chen et al. (1996) Plant J. 10:955-966; Zhang et al. (1994) Proc. Natl. Acad. Sci. USA 91 :2507-2511; Warner et al. (1993) Plant J. 3: 191-201 ; Siebertz et al. (1989) Plant Cell 1 :961-968; U.S. Patent No.

5,750,386 (nematode-inducible); and the references cited therein. Of particular interest is the inducible promoter for the maize PRms gene, whose expression is induced by the pathogen Fusarium moniliforme (see, for example, Cordero et al. (1992) Physiol. Mol. Plant Path. 41 : 189-200).

Additionally, as pathogens find entry into plants through wounds or insect damage, a wound-inducible promoter may be used in the polynucleotide constructs of the invention. Such wound-inducible promoters include potato proteinase inhibitor (pin II) gene (Ryan

(1990) Ann. Rev. Phytopath. 28:425-449; Oum et al. (1996) Nature Biotechnology 14:494- 498); wunl and wun2, U.S. Patent No. 5,428,148; winl and win2 (Stanford et al. (1989) Mol.

Gen. Genet. 215:200-208); systemin (McGurl et al. (1992) Science 225: 1570-1573); WIP1 (Rohmeier et al. (1993) Plant Mol. Biol. 22:783-792; Eckelkamp et al. (1993) FEBS Letters 323:73-76); MPI gene (Corderok et al. (1994) Plant J. 6(2): 141-150); and the like, herein incorporated by reference.

Chemical -regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical -inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- l a promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the

glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA

88: 10421 -10425 and McNellis et al. (1998) Plant J. 14(2):247-257) and tetracycline- inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227:229-237, and U. S. Patent Nos. 5,814,618 and 5,789, 156), herein

incorporated by reference.

The expression cassette can also comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or tissues. Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). Additional selectable markers include phenotypic markers such as β-galactosidase and fluorescent proteins such as green fluorescent protein (GFP) (Su et al. (2004) Biotechnol Bioeng #5: 610-9 and Fetter et al. (2004) Plant Cell 7(5:215-28), cyan florescent protein (CYP) (Bolte et al. (2004) J. Cell Science 777:943-54 and Kato et al. (2002) Plant Physiol 729:913-42), and yellow florescent protein (PhiYFP™ from Evrogen, see, Bolte et al. (2004) J. Cell Science 777:943-54). For additional selectable markers, see generally, Yarranton (1992) Curr. Opin. Biotech. 3:506-511 ; Christopherson ^ a/. (1992) Proc. Natl. Acad. Sci. USA 89:6314-6318; Yao et al. (1992) Cell 71 :63-72; Reznikoff ( 1992) Mol. Microbiol. 6:2419-2422; Barkley et al. (1980) in The Operon, pp. 177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987) Cell 49:603-612; Figge et al. (1988) Cell 52:713-722; Deuschle et al. (1989) Proc. Natl. Acad. Act USA 86:5400-5404; Fuerst et al. (1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle et al. (1990) Science 248:480-483; Gossen (1993) Ph.D. Thesis, University of Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA 90: 1917-1921 ; Labow et al. (1990) o/. Cell. Biol. 10:3343-3356;

Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA 89:3952-3956; Bairn et al. (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076; Wyborski et al. (1991) Nucleic Acids Res. 19:4647-4653;

Hillenand-Wissman (1989) Topics Mol. Struc. Biol. 10: 143-162; Degenkolb et al. (1991) Antimicrob. Agents Chemother. 35: 1591-1595; Kleinschnidt et al. (1988) Biochemistry 27: 1094- 1104; Bonin (1993) Ph.D. Thesis, University of Heidelberg; Gossen et al. (1992) Proc. Natl. Acad. Sci. USA 89:5547-5551; Oliva ef al. (1992) Antimicrob. Agents Chemother. 36:913-919; Hlavka ei a/. (1985) Handbook of ^'Experimental Pharmacology, Vol. 78 ( Springer-Verlag, Berlin); Gill et al. (1988) Nature 334:721-724. Such disclosures are herein incorporated by reference.

The above list of selectable marker genes is not intended to be limiting. Any selectable marker gene can be used in the present invention.

Numerous plant transformation vectors and methods for transforming plants are available. See, for example, An, G. et al. (1986) Plant PysioL , 81:301-305; Fry, J., et al.

(1987) Plant Cell Rep. 6:321-325; Block, M. (1988) Theor. Appl Genet .1 '6: '67 '-77 '4; Hinchee, et al. (1990) Stadler. Genet. Symp.203212.203-212; Cousins, et al. (1991) Aust. J. Plant Physiol. 18:481-494; Chee, P. P. and Slightom, J. L. (1992) Gene. l 18:255-260; Christou, et al. (1992) Trends. Biotechnol. 10:239-246; D'Halluin, et al. (1992) Bio/Technol. 10:309-314; Dhir, et al. (1992) Plant Physiol. 99:81-88; Casas et al. (1993) Proc. Nat. Acad Sci. USA

90: 11212-11216; Christou, P. (1993) In Vitro Cell. Dev. Biol.-Plant; 29P: 119-124; Davies, et al. (1993) Plant Cell Rep. 12: 180-183; Dong, J. A. and Mchughen, A. (1993) Plant Sci. 91 : 139-148; Franklin, C. I. and Trieu, T. N. (1993) Plant. Physiol. 102: 167; Golovkin, et al.

(1993) Plant Sci. 90:41-52; Guo Chin Sci. Bull. 38:2072-2078; Asano, et al. (1994) Plant Cell Rep. 13; Ayeres N. M. and Park, W. D. (1994) Crit. Rev. Plant. Sci. 13:219-239;

Barcelo, et al. (1994) Plant. J. 5:583-592; Becker, et al. (1994) Plant. J. 5:299-307;

Borkowska et al. (1994) Acta. Physiol Plant . 16:225-230; Christou, P. (1994) Agro. Food. Ind. Hi Tech. 5: 17-27; Eapen e/ a/. (1994) Plant Cell Rep. 13:582-586; Hartman, et al.

(1994) Bio-Technology 12: 919923; Ritala, et al. (1994) Plant. Mol. Biol. 24:317-325; and Wan, Y. C. and Lemaux, P. G. (1994) Plant Physiol. 104:3748.

The methods of the invention involve introducing a nucleic acid molecule, nucleic acid construct, or other polynucleotide into a plant. By "introducing" is intended presenting to the plant the nucleic acid molecule, nucleic acid construct, or other polynucleotide in such a manner that the construct gains access to the interior of a cell of the plant. The methods of the invention do not depend on a particular method for introducing a polynucleotide construct to a plant, only that the nucleic acid molecule, nucleic acid construct, or other polynucleotide gains access to the interior of at least one cell of the plant. Methods for introducing nucleic acid molecules into plants are known in the art including, but not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.

By "stable transformation" is intended that the polynucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by progeny thereof. By "transient transformation" is intended that a polynucleotide construct introduced into a plant does not integrate into the genome of the plant.

For the transformation of plants and plant cells, the nucleotide sequences of the invention are inserted using standard techniques into any vector known in the art that is suitable for expression of the nucleotide sequences in a plant or plant cell. The selection of the vector depends on the preferred transformation technique and the target plant species to be transformed.

Methodologies for constructing plant expression cassettes and introducing foreign nucleic acids into plants are generally known in the art and have been previously described. For example, foreign DNA can be introduced into plants, using tumor-inducing (Ti) plasmid vectors. Other methods utilized for foreign DNA delivery involve the use of PEG mediated protoplast transformation, electroporation, microinjection whiskers, and biolistics or microproj ectile bombardment for direct DNA uptake. Such methods are known in the art. (U. S. Pat. No. 5,405,765 to Vasil et al.; Bilang et al. (1991) Gene 100: 247-250; Scheid et al, (\ 99\) Mol. Gen. Genet. , 228: 104-1 12; Guerche et al, (1987) Plant Science 52: 1 11 -1 16; Neuhause et al, (1987) Theor. Appl Genet. 75: 30-36; Klein et al, (1987) Nature 327: 70-73; Howell et al, (1980) Science 208: 1265; Horsch et al, (1985) Science 227: 1229-1231 ;

DeBlock et al, (1989) Plant Physiology 91 : 694-701 ; Methods for Plant Molecular Biology (Weissbach and Weissbach, eds.) Academic Press, Inc. (1988) and Methods in Plant

Molecular Biology (Schuler and Zielinski, eds.) Academic Press, Inc. (1989). The method of transformation depends upon the plant cell to be transformed, stability of vectors used, expression level of gene products and other parameters.

Other suitable methods of introducing nucleotide sequences into plant cells and subsequent insertion into the plant genome include microinj ection as Crossway et al. (1986) Biotechniques 4:320-334, electroporation as described by Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606, Agrobacterium-m diated transformation as described by Townsend et al, U. S. Patent No. 5,563,055, Zhao et al, U. S. Patent No. 5,981,840, direct gene transfer as described by Paszkowski et al. (1984) EMBO J. 3 :2717-2722, and ballistic particle acceleration as described in, for example, Sanford et al, U. S. Patent No. 4,945,050; Tomes et al, U.S. Patent No. 5,879,918; Tomes et al, U.S. Patent No. 5,886,244; Bidney et al, U.S. Patent No. 5,932,782; Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment," in Plant Cell, Tissue, and Organ Culture:

Fundamental Methods , ed. Gamborg and Phillips (Springer-Verlag, Berlin); McCabe et al (1988) Biotechnology 6:923-926); and Lecl transformation (WO 00/28058). Also see, Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Science and Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol. 87:671-674 (soybean); McCabe et al. (1988) Bio/Technology 6:923-926 (soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P: 175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet. 96:319-324 (soybean); Datta et al. (1990) Biotechnology 8:736-740 (rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein et al. (1988) Biotechnology 6:559-563 (maize); Tomes, U.S. Patent No. 5,240,855; Buising et al, U.S. Patent Nos.

5,322,783 and 5,324,646; Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg (Springer-Verlag, Berlin) (maize); Klein et al. (1988) Plant Physiol. 91 :440-444 (maize); Fromm et al. (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature (London) 311 :763-764; Bowen et al. , U.S. Patent No.

5,736,369 (cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349

(Liliaceae); De Wet et al. (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566 (whisker- mediated transformation); D'Halluin et al. (1992) Plant Cell 4: 1495-1505 (electroporation); Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and Ford (1995) Annals of Botany 75:407-413 (rice); Osjoda et al. (1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium tumefaciens); all of which are herein incorporated by reference.

The polynucleotides of the invention may be introduced into plants by contacting plants with a virus or viral nucleic acids. Generally, such methods involve incorporating a polynucleotide construct of the invention within a viral DNA or RNA molecule. Further, it is recognized that promoters of the invention also encompass promoters utilized for transcription by viral RNA polymerases. Methods for introducing polynucleotide constructs into plants and expressing a protein encoded therein, involving viral DNA or RNA molecules, are known in the art. See, for example, U.S. Patent Nos. 5,889,191, 5,889,190, 5,866,785, 5,589,367 and 5,316,931 ; herein incorporated by reference. If desired, the modified viruses or modified viral nucleic acids can be prepared in formulations. Such formulations are prepared in a known manner (see e.g. for review US 3,060,084, EP-A 707 445 (for liquid concentrates), Browning, "Agglomeration", Chemical Engineering, Dec. 4, 1967, 147-48, Perry's Chemical Engineer's Handbook, 4th Ed., McGraw-Hill, New York, 1963, pages 8-57 and et seq. WO 91/13546, US 4,172,714, US 4,144,050, US 3,920,442, US 5,180,587, US 5,232,701, US 5,208,030, GB 2,095,558, US 3,299,566, Klingman, Weed Control as a Science, John Wiley and Sons, Inc., New York, 1961, Hance et al. Weed Control Handbook, 8th Ed., Blackwell Scientific Publications, Oxford, 1989 and Mollet, H., Grubemann, A., Formulation technology, Wiley VCH Verlag GmbH, Weinheim (Germany), 2001, 2. D. A. Knowles, Chemistry and Technology of

Agrochemical Formulations, Kluwer Academic Publishers, Dordrecht, 1998 (ISBN 0-7514- 0443-8), for example by extending the active compound with auxiliaries suitable for the formulation of agrochemicals, such as solvents and/or carriers, if desired emulsifiers, surfactants and dispersants, preservatives, antifoaming agents, anti-freezing agents, for seed treatment formulation also optionally colorants and/or binders and/or gelling agents.

In specific embodiments, the polynucleotide constructs and expression cassettes of the invention can be provided to a plant using a variety of transient transformation methods known in the art. Such methods include, for example, microinjection or particle

bombardment. See, for example, Crossway et al. (1986) Mo/ Gen. Genet. 202: 179-185; Nomura e/ a/. (1986) Plant Sci. 44:53-58; Hepler et al. (1994) PNAS Sci. 91 : 2176-2180 and Hush et al. (1994) J. Cell Science 107:775-784, all of which are herein incorporated by reference. Alternatively, the polynucleotide can be transiently transformed into the plant using techniques known in the art. Such techniques include viral vector system and

Agrobacterium tumefaciens -mediated transient expression as described elsewhere herein.

The cells that have been transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting hybrid having constitutive expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure expression of the desired phenotypic characteristic has been achieved. In this manner, the present invention provides transformed seed (also referred to as "transgenic seed") having a polynucleotide construct of the invention, for example, an expression cassette of the invention, stably incorporated into their genome.

The nucleic acid molecules, expression cassettes, vectors, and polynucleotide constructs of the present invention may be used for transformation of any plant species, including, but not limited to, monocots and dicots.

In certain embodiments of the invention, the methods involve the planting of seeds, seedlings, and/or tubers and then growing such seeds, seedlings and/or tubers so as to produce plants derived therefrom and optionally harvesting from the plants a plant part or parts. As used herein, a "seedling" refers to a less than fully mature plant that is typically grown in greenhouse or other controlled- or semi-controlled (e.g. a cold frame)

environmental conditions before planting or replanting outdoors or in a greenhouse for the production a harvestable plant part, such as, for example, a tomato fruit, a potato tuber or a tobacco leaf. As used herein, a "tuber" refers to an entire tuber or part or parts thereof, unless stated otherwise or apparent from the context of use.

In some embodiments of the present invention, a plant cell is transformed with a polynucleotide construct encoding a CSPR protein of the present invention. The term "expression" as used herein refers to the biosynthesis of a gene product, including the transcription and/or translation of said gene product. The "expression" or "production" of a protein or polypeptide from a DNA molecule refers to the transcription and translation of the coding sequence to produce the protein or polypeptide, while the "expression" or

"production" of a protein or polypeptide from an RNA molecule refers to the translation of the RNA coding sequence to produce the protein or polypeptide. Examples of polynucleotide constructs and nucleic acid molecules that encode CSPR proteins are described elsewhere herein.

The use of the terms "DNA" or "RNA" herein is not intended to limit the present invention to polynucleotide molecules comprising DNA or RNA. Those of ordinary skill in the art will recognize that the methods and compositions of the invention encompass polynucleotide molecules comprised of deoxyribonucleotides (i.e., DNA), ribonucleotides (i.e., RNA) or combinations of ribonucleotides and deoxyribonucleotides. Such

deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues including, but not limited to, nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs). The polynucleotide molecules of the invention also encompass all forms of polynucleotide molecules including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures, and the like. Furthermore, it is understood by those of ordinary skill in the art that the nucleotide sequences disclosed herein also encompasses the complement of that exemplified nucleotide sequence.

The invention is drawn to compositions and methods for enhancing the resistance of a plant to plant disease, particularly to compositions and methods for enhancing the resistance of a plant to plant disease caused by at least one bacterial plant pathogen. By "disease resistance" is intended that the plants avoid the disease symptoms that are the outcome of plant-pathogen interactions. That is, pathogens are prevented from causing plant diseases and the associated disease symptoms, or alternatively, the disease symptoms caused by the pathogen is minimized or lessened.

Plant pathogens include, for example, bacteria, insects, nematodes, fungi, oomycetes, and the like. The preferred pathogens of the present invention are bacterial pathogens.

Specific pathogens for the maj or crops include: Soybeans: Phytophthora megasperma fsp. glycinea, Macrophomina phaseolina, Rhizoctonia solani, Sclerotinia sclerotiorum, Fusarium oxysporum, Diaporthe phaseolorum var. sojae (Phomopsis sojae), Diaporthe phaseolorum var. caulivora, Sclerotium rolfsii, Cercospora kikuchii, Cercospora sojina, Peronospora manshurica, Colletotrichum dematium (Colletotichum truncatum), Corynespora cassiicola, Septoria glycines, Phyllosticta sojicola, Alternaria alternata, Pseudomonas syringae p.v. glycinea, Xanthomonas campestris p.v. phaseoli, Microsphaera diffusa, Fusarium semitectum, Phialophora gregata, Soybean mosaic virus, Glomerella glycines, Tobacco Ring spot virus, Tobacco Streak virus, Phakopsora pachyrhizi, Pythium aphanidermatum, Pythium ultimum, Pythium debaryanum, Tomato spotted wilt virus, Heterodera glycines Fusarium solani; Canola: Albugo Candida, Alternaria brassicae, Leptosphaeria maculans, Rhizoctonia solani, Sclerotinia sclerotiorum, Mycosphaerella brassicicola, Pythium ultimum,

Peronospora parasitica, Fusarium roseum, Alternaria alternata; Alfalfa: Clavibacter michiganese subsp. insidiosum, Pythium ultimum, Pythium irregulare, Pythium splendens, Pythium debaryanum, Pythium aphanidermatum, Phytophthora megasperma, Peronospora trifoliorum, Phoma medicaginis var. medicaginis, Cercospora medicaginis, Pseudopeziza medicaginis, Leptotrochila medicaginis, Fusarium oxysporum, Verticillium albo-atrum, Xanthomonas campestris p.v. alfalfae, Aphanomyces euteiches, Stemphylium herbarum, Stemphylium alfalfae, Colletotrichum trifolii, Leptosphaerulina briosiana, Uromyces striatus, Sclerotinia trifoliorum, Stagonospora meliloti, Stemphylium botryosum, Leptotrichila medicaginis; Wheat: Pseudomonas syringae p.v. atrofaciens, Urocystis agropyri,

Xanthomonas campestris p.v. translucens , Pseudomonas syringae p.v. syringae, Alternaria alternata, Cladosporium herbarum, Fusarium graminearum, Fusarium avenaceum,

Fusarium culmorum, Ustilago tritici, Ascochyta tritici, Cephalosporium gramineum, Collotetrichum graminicola, Erysiphe graminis f.sp. tritici, Puccinia graminis f.sp. tritici, Puccinia recondita f.sp. tritici, Puccinia striiformis, Pyrenophora tritici-repentis, Septoria nodorum, Septoria tritici, Septoria avenae, Pseudocercosporella herpotrichoides,

Rhizoctonia solani, Rhizoctonia cerealis, Gaeumannomyces graminis var. tritici, Pythium aphanidermatum, Pythium arrhenomanes , Pythium ultimum, Bipolaris sorokiniana, Barley Yellow Dwarf Virus, Brome Mosaic Virus, Soil Borne Wheat Mosaic Virus, Wheat Streak Mosaic Virus, Wheat Spindle Streak Virus, American Wheat Striate Virus, Claviceps purpurea, Tilletia tritici, Tilletia laevis, Ustilago tritici, Tilletia indica, Rhizoctonia solani, Pythium arrhenomannes, Pythium gramicola, Pythium aphanidermatum, High Plains Virus, European wheat striate virus; Sunflower: Plasmopora halstedii, Sclerotinia sclerotiorum, Aster Yellows, Septoria helianthi, Phomopsis helianthi, Alternaria helianthi, Alternaria zinniae, Botrytis cinerea, Phoma macdonaldii, Macrophomina phaseolina, Erysiphe cichor acearum, Rhizopus oryzae, Rhizopus arrhizus, Rhizopus stolonifer, Puccinia helianthi, Verticillium dahliae, Erwinia carotovorum pv. carotovora, Cephalosporium acremonium, Phytophthora cryptogea, Albugo tragopogonis; Com: Colletotrichum graminicola, Fusarium moniliforme var. subglutinans , Erwinia stewartii, F. verticillioides, Gibberella zeae

(Fusarium graminearum), Stenocarpella maydi (Diplodia maydis), Pythium irregulare,

Pythium debaryanum, Pythium graminicola, Pythium splendens, Pythium ultimum, Pythium aphanidermatum, Aspergillus flavus, Bipolaris maydis O, T (Cochliobolus heterostrophus) , Helminthosporium carbonum I, II & III (Cochliobolus carbonum), Exserohilum turcicum I, II & III, Helminthosporium pedicellatum, Physoderma maydis, Phyllosticta maydis, Kabatiella maydis, Cercospora sorghi, Ustilago maydis, Puccinia sorghi, Puccinia polysora,

Macrophomina phaseolina, Penicillium oxalicum, Nigrospora oryzae, Cladosporium herbarum, Curvularia lunata, Curvularia inaequalis, Curvularia pallescens, Clavibacter michiganense subsp. nebraskense, Trichoderma viride, Maize Dwarf Mosaic Virus A & B, Wheat Streak Mosaic Virus, Maize Chi orotic Dwarf Virus, Claviceps sorghi, Pseudonomas avenae, Erwinia chrysanthemi pv. zea, Erwinia carotovora, Corn stunt spiroplasma, Diplodia macrospora, Sclerophthora macrospora, Peronosclerospora sorghi,

Peronosclerospora philippinensis, Peronosclerospora maydis, Peronosclerospora sacchari, Sphacelotheca reiliana, Physopella zeae, Cephalosporium maydis, Cephalosporium acremonium, Maize Chlorotic Mottle Virus, High Plains Virus, Maize Mosaic Virus, Maize Ray ado Fino Virus, Maize Streak Virus, Maize Stripe Virus, Maize Rough Dwarf Virus; Sorghum: Exserohilum turcicum, C. sublineolum, Cercospora sorghi, Gloeocercospora sorghi, Ascochyta sorghina, Pseudomonas syringae p.v. syringae, Xanthomonas campestris p.v. holcicola, Pseudomonas andropogonis, Puccinia purpurea, Macrophomina phaseolina, Perconia circinata, Fusarium moniliforme, Alternaria alternata, Bipolaris sorghicola, Helminthosporium sorghicola, Curvularia lunata, Phoma insidiosa, Pseudomonas avenae (Pseudomonas alboprecipitans) , Ramulispora sorghi, Ramulispora sorghicola, Phyllachara sacchari, Sporisorium reilianum (Sphacelotheca reiliana), Sphacelotheca cruenta,

Sporisorium sorghi, Sugarcane mosaic H, Maize Dwarf Mosaic Virus A & B, Claviceps sorghi, Rhizoctonia solani, Acremonium strictum, Sclerophthona macrospora,

Peronosclerospora sorghi, Peronosclerospora philippinensis, Sclerospora graminicola, Fusarium graminearum, Fusarium oxysporum, Pythium arrhenomanes, Pythium

graminicola, etc.; Tomato: Corynebacterium michiganense pv. michiganense, Pseudomonas syringae pv. tomato, Ralstonia solanacearum, Xanthomonas vesicatoria, Xanthomonas perforans, Alternaria solani, Alternaria porri, Collectotrichum spp., Fulvia fulva Syn.

Cladosporium fulvum, Fusarium oxysporum f. lycopersici, Leveillula taurica/Oidiopsis taurica, Phytophthora infestans, other Phytophthora spp., Pseudocercospora fuligena Syn. Cercospora fuligena, Sderotium rolfsii, Septoria lycopersici, Meloidogyne spp.; Potato: Ralstonia solanacearum, Pseudomonas solanacearum, Erwinia carotovora subsp.

Atroseptica Erwinia carotovora subsp. Carotovora, Pectobacterium carotovorum subsp. Atrosepticum, Pseudomonas fluorescens, Clavibacter michiganensis subsp. Sepedonicus, Corynebacterium sepedonicum, Streptomyces scabiei, Colletotrichum coccodes, Alternaria alternate, Mycovellosiella concors, Cercospora solani, Macrophomina phaseolina,

Sderotium bataticola, Choanephora cucurbitarum, Puccinia pittieriana, Aecidium cantensis, Alternaria solani, Fusarium spp., Phoma solanicola t foveata, Botrytis cinerea, Botryotinia fuckeliana, Phytophthora infestans, Pythium spp., Phoma andigena var. andina, Pleospora herbarum, Stemphylium herbarum, Erysiphe cichoracearum, Spongospora subterranean Rhizoctonia solani, Thanatephorus cucumeris, Rosellinia sp. Dematophora sp., Septoria lycopersici, Helminthosporium solani, Polyscytalum pustulans, Sclerotium rolfsii, Athelia rolfsii, Angiosorus solani, Ulocladium atrum, Verticillium albo-atrum, V. dahlia,

Synchytrium endobioticum, Sclerotinia sclerotiorum, Candidatus Liberibacter solanacearum; Banana: Colletotrichum musae, Armillaria mellea, Armillaria tabescens, Pseudomonas solanacearum, Phyllachora musicola, Mycosphaerella fljiensis, Rosellinia bunodes,

Pseudomas spp., Pestalotiopsis leprogena, Cercospora hayi, Pseudomonas solanacearum, Ceratocystis paradoxa, Verticillium theobromae, Trachysphaera fructigena, Cladosporium musae, Junghuhnia vincta, Cordana johnstonii, Cordana musae, Fusarium pallidoroseum, Colletotrichum musae, Verticillium theobromae, Fusarium spp., Acremonium spp.,

Cylindrocladium spp., Deightoniella torulosa, Nattrassia mangiferae, Dreschslera gigantean, Guignardia musae, Botryosphaeria ribis, Fusarium solani, Nectria haematococca, Fusarium oxysporum, Rhizoctonia spp., Colletotrichum musae, Uredo musae, Uromyces musae, Acrodontium simplex, Curvularia eragrostidis, Drechslera musae-sapientum, Leptosphaeria musarum, Pestalotiopsis disseminate, Ceratocystis paradoxa, Haplobasidion musae,

Marasmiellus inoderma, Pseudomonas solanacearum, Radopholus similis, Lasiodiplodia theobromae, Fusarium pallidoroseum, Verticillium theobromae, Pestalotiopsis palmarum, Phaeoseptoria musae, Pyricularia grisea, Fusarium moniliforme, Gibberella fujikuroi, Erwinia carotovora, Erwinia chrysanthemi, Cylindrocarpon musae, Meloidogyne arenaria, Meloidogyne incognita, Meloidogyne javanica, Pratylenchus coffeae, Pratylenchus goodeyi, Pratylenchus brachyurus, Pratylenchus reniformia, Sclerotinia sclerotiorum, Nectria foliicola, Mycosphaerella musicola, Pseudocercospora musae, Limacinula tenuis,

Mycosphaerella musae, Helicotylenchus multicinctus, Helicotylenchus dihystera, Nigrospora sphaerica, Trachysphaera frutigena, Ramichloridium musae, Verticillium theobromae

Preferred bacterial plant pathogens are Pseudomonas syringae pathovars,

Pseudomonas cannabina pathovars, Ralstonia solanacearum, Agrobacterium tumefaciens, Xanthomonas oryzae pv. oryzae, Xanthomonas campestris pathovars, Xanthomonas axonopodis pv. manihotis, Erwinia amylovora, Xylella fastidiosa, Dickeya spp. (e.g D.

dadantii and D. solani), Pectobacterium carotovorum, P. atrosepticum, Candidatus

Liberibacter asiaticus,qnd Candidatus Liberibacter solanacearum.

Non-limiting examples of the compositions and methods of the present invention are as follows: 1. A method for enhancing the resistance of a plant to plant disease caused by at least one plant pathogen, the method comprising introducing a nucleic acid construct into at least one plant cell of the plant, wherein the nucleic acid construct comprises a nucleotide sequence encoding a cold shock protein receptor (CSPR).

2. The method of embodiment 1, wherein the nucleic acid construct is stably

incorporated into the genome of the plant cell.

3. The method of embodiment 1 or 2, further comprising regenerating the plant cell into a transformed plant comprising in its genome the nucleic acid construct.

4. The method of embodiment 3, wherein the transformed plant has enhanced resistance to at least one plant pathogen.

5. The method of embodiment 4, wherein the at least one plant pathogen is a bacterial plant pathogen.

6. The method of any one of embodiments 1-5, wherein the nucleotide sequence encodes aNicotiana CSPR.

7. The method of any one of embodiments 1-6, wherein the nucleotide sequence encodes aNicotiana benthamiana CSPR (NbCSPR) or aNicotiana tabacum CSPR (NtCSPR)

8. The method of any one of embodiments 1-7, wherein the nucleotide sequence is selected from the group consisting of:

(a) the nucleotide sequence set forth in SEQ ID NO: 1 or 4;

(b) the nucleotide sequence set forth in SEQ ID NO: 3, 6, 14, 16, 18, 20, 22, or 24;

(c) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 2, 5, 15, 17, 19, 21, 23, or 25;

(d) a nucleotide sequence having at least 85% identity to at least one full-length nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOS: 1 and 4, wherein the nucleotide sequence encodes a polypeptide comprising CSPR activity;

(e) a nucleotide sequence having at least 85% identity to at least one full-length nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOS: 3, 6, 14, 16, 18, 20, 22, and 24, wherein the nucleotide sequence encodes a polypeptide comprising CSPR activity; and (f) a nucleotide sequence encoding an amino acid sequence having at least 85% identity to at least one full-length amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NOS: 2, 5, 15, 17, 19, 21, 23, and 25, wherein the nucleotide sequence encodes a polypeptide comprising CSPR activity.

9. The method of embodiment 8, wherein the nucleic acid construct further comprises a promoter that is operably linked to the nucleotide sequence and wherein the promoter is capable of driving expression of the nucleotide sequence in the plant.

10. The method of embodiment 9, wherein the promoter is the NbCSPR promoter or the NtCSPR promoter.

1 1. The method of embodiment 9, wherein the promoter is selected from the group consisting of pathogen-inducible, constitutive, tissue-preferred, wound-inducible, and chemical-regulated promoters.

12. The method of any one of embodiments 1-11 , wherein the at least one plant cell comprises a heterologous polynucleotide comprising a nucleotide sequence encoding an additional partem recognition receptor (PRR).

13. The method of embodiment 12, wherein the additional PRR is a bacterial EF-Tu receptor (EFR).

14. The method of embodiment 12 or 13, wherein the heterologous polynucleotide is stably incorporated in the genome of the plant cell.

15. The method of any of embodiments 12-14, wherein the heterologous polynucleotide is introduced into the at least one plant cell at the same time as the nucleic acid construct is introduced into the at least one plant cell.

16. The method of embodiment 15, wherein the nucleic acid construct comprises the heterologous polynucleotide.

17. The method of any one of embodiments 12-14, wherein the heterologous

polynucleotide is introduced into the plant cell before or after the nucleic acid construct is introduced into the plant cell.

18. The method of any one of embodiments 1-17, wherein the plant cell comprises a resistance (R) gene.

19. The method of embodiment 18, wherein the R gene comprises recombinant DNA.

20. The method of any one of embodiments 1-19, wherein the plant is a dicot. 21. The method of embodiment 20, wherein the dicot is selected from the group consisting of soybean, alfalfa, cotton, Brassica spp., sunflower, safflower, lettuce, strawberry, apple, and citrus.

22. The method of any one of embodiments 1-20, wherein the plant is a non-solanaceous plant.

23. The method of any one of embodiments 1-22, wherein the plant is a non-Brassicaceae plant.

24. The method of any one of embodiments 1-19, wherein the plant is a monocot.

25. The method of embodiment 24, wherein the monocot is selected from the group consisting of maize, rice, wheat, barley, sorghum, sugarcane, coconut, oil palm, and banana.

26. A transformed plant or plant cell produced by the method of any one of embodiments 1-25.

27. A transformed plant comprising stably incorporated in its genome a heterologous nucleic acid construct comprising a nucleotide sequence that encodes a CSPR, wherein the transformed plant, wherein the transformed plant has enhanced resistance to at least one plant pathogen.

28. The transformed plant of embodiment 27, wherein the nucleotide sequence encodes a Nicotiana CSPR.

29. The transformed plant of embodiment 27 or 28, wherein the nucleotide sequence encodes a Nicotiana benthamiana CSPR (NbCSPR) or a Nicotiana tabacum CSPR (NtCSPR)

30. The transformed plant of any one of embodiments 27-29, wherein the nucleotide sequence is selected from the group consisting of:

(a) the nucleotide sequence set forth in SEQ ID NO: 1 or 4;

(e) a nucleotide sequence having at least 85% identity to at least one full-length nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOS: 3, 6, 14, 16, 18, 20, 22, and 24, wherein the nucleotide sequence encodes a polypeptide comprising CSPR activity; and (f) a nucleotide sequence encoding an amino acid sequence having at least 85% identity to at least one full-length amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NOS: 2, 5, 15, 17,

19, 21, 23, and 25, wherein the nucleotide sequence encodes a polypeptide comprising CSPR activity.

31. The transformed plant of embodiment 30, wherein the nucleic acid construct further comprises a promoter that is operably linked to the nucleotide sequence and wherein the promoter is capable of driving expression of the nucleotide sequence in the plant.

32. The transformed plant of embodiment 31 , wherein the promoter is the NbCSPR promoter or the NtCSPR promoter.

33. The transformed plant of embodiment 31, wherein the promoter is selected from the group consisting of pathogen-inducible, constitutive, tissue-preferred, wound-inducible, and chemical-regulated promoters.

34. The transformed plant of any one of embodiments 27-33, wherein the transformed plant further comprises stably incorporated in its genome a heterologous polynucleotide comprising a nucleotide sequence encoding an additional PRR.

35. The transformed plant of embodiment 34, wherein the PRR is a bacterial EFR.

36. The transformed plant of embodiment 34 or 35, wherein the nucleic acid construct comprises the heterologous polynucleotide.

37. The transformed plant of any one of embodiments 27-36, wherein the plant further comprises stably incorporated in its genome a resistance (R) gene.

38. The transformed plant of embodiment 37, wherein the R gene comprises recombinant DNA.

39. The transformed plant of any one of embodiments 27-38, wherein the plant is a dicot.

40. The transformed plant of embodiment 39, wherein the dicot is selected from the group consisting of soybean, alfalfa, cotton, Brassica spp., sunflower, safflower, lettuce, strawberry, apple, and citrus.

41. The transformed plant of any one of embodiments 27-39, wherein the plant is a non- solanaceous plant.

42. The transformed plant of any one of embodiments 27-41, wherein the plant is a non-

Brassicaceae plant. 43. The transformed plant of any one of embodiments 27-38, wherein the plant is a monocot.

44. The transformed plant of embodiment 43, wherein the monocot is selected from the group consisting of maize, rice, wheat, barley, sorghum, sugarcane, coconut, oil palm, and banana.

45. The transformed plant of any one of embodiments 27-44, wherein the transformed plant has enhanced resistance to at least one bacterial plant pathogen.

46. A seed or plant cell of the transformed plant of any one of embodiments 27-45, wherein the seed or the plant cell comprises the nucleic acid construct, and optionally the heterologous polynucleotide.

47. A method for limiting a plant disease caused by at least one plant pathogen in agricultural crop production, the method comprising planting a seed, seedling or part of the transformed plant of any one of embodiments 3-46 and growing a progeny plant under conditions favorable for the growth and development of the progeny plant, wherein the seed, seedling or part comprises the nucleic acid construct and optionally the heterologous polynucleotide.

48. The method of embodiment 47, further comprising harvesting an at least one fruit, tuber, leaf and/or seed from the plant.

49. Use of the plant or seed of any one of embodiments 3-46 in agriculture.

50. A human or animal food product produced using the plant or seed of any one of embodiments 3-46.

51. A method for increasing the transformation efficiency of a solanaceous plant in Agrobacterium-mediated transformation, the method comprising decreasing the expression level and/or activity of CSPR in the solanaceous plant, whereby transformation efficiency is increased when the solanaceous plant is subjected to Agrobacterium -mediated transformation relative to a control solanaceous plant for which the expression level and/or activity of CSPR has not been decreased.

52. The method of embodiment 51, wherein decreasing the expression level and/or activity of CSPR in the solanaceous plant comprises introducing a polynucleotide construct into at least one plant cell of the solanaceous plant, the polynucleotide construct comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell, and wherein the transcribed region is designed to produce a transcript for post- transcriptional gene silencing or antisense-mediated gene silencing of CSPR. 53. The method of embodiment 52, wherein the transcript for post-transcriptional gene silencing comprises an miRNA, an siRNA, an hpRNA or a dsRNA.

54. The method of any one of embodiments 51-53, wherein the polynucleotide construct is stably incorporated in the genome of the plant cell.

55. The method of embodiment 53 or 54, wherein the plant cell is regenerated into a plant comprising in its genome the polynucleotide construct.

56. The method of embodiment 53 or 54, wherein the polynucleotide construct is not stably incorporated in the genome of the plant cell.

57. The method of embodiment 51, wherein decreasing the expression level and/or activity of CSPR in the solanaceous plant comprises introducing into at least one solanaceous plant cell a disruption of a CSPR gene, wherein the disruption decreases the expression level or activity of CSPR in said solanaceous plant cell relative to the expression level or activity of CSPR in a corresponding control, solanaceous plant cell lacking the disruption of the CSPR gene.

58. The method of embodiment 57, wherein said disruption of the CSPR gene comprises at least one member selected from the group consisting of a DNA insertion, a DNA deletion, and a DNA substitution of at least one base pair in the CSPR gene.

59. The method of embodiment 57 or 58, wherein introducing into at least one solanaceous plant cell a disruption of the CSPR gene, comprises targeted mutagenesis, homologous recombination, or mutation breeding.

60. The method of embodiment 58 or 59, wherein the DNA insertion comprises

(a) DNA insertion in the 5'UTR of the CSPR gene;

(b) DNA insertion in an exon of the CSPR gene; or

(c) DNA insertion in an intron of the CSPR gene.

61. The method of any one of embodiments 57-60, wherein the disruption of the CSPR gene is a homozygous disruption.

62. The method of any one of embodiments 57-61, wherein the solanaceous plant cell is regenerated into a solanaceous plant comprising in its genome the disrupted CSPR gene.

63. The method of any one of embodiments 51-62, wherein the solanaceous plant is selected from the group consisting of potato, tomato, tomatillo, Cape gooseberry, eggplant, pepper, tobacco, and petunia.

64. The method of any one of embodiments 51-63, wherein the solanaceous plant is Nicotiana benthamiana and the CSPR is NbCSPR. 65. The method of any one of embodiments 51-64, wherein the expression level and/or activity of the CSPR in the solanaceous plant or the part thereof is decreased when compared to the expression level and/or activity of CSPR in a control solanaceous plant or the corresponding part of the control solanaceous plant.

66. A solanaceous plant produced by the method of any one of embodiments 51-65.

67. A method for the transformation of a solanaceous plant with a gene of interest, the method comprising contacting a modified solanaceous plant cell with an Agrobacterium strain comprising the gene of interest contained in a Ti plasmid, wherein the modified solanaceous plant cell comprises a decreased expression level and/or activity of CSPR, relative to the expression level and/or activity of CSPR in a control solanaceous plant cell; whereby the gene of interest is transferred to the at least one cell.

68. The method of embodiment 67, wherein the modified solanaceous plant cell comprises a polynucleotide construct comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell, and wherein the transcribed region is designed to produce a transcript for post-transcriptional gene silencing or antisense- mediated gene silencing of CSPR.

69. The method of embodiment 68, wherein the transcript for post-transcriptional gene silencing comprises an miRNA, an siRNA, an hpRNA or a dsRNA.

70. The method of embodiment 68 or 69, wherein the polynucleotide construct is stably incorporated in the genome of the modified solanaceous plant cell.

71. The method of embodiment 68 or 69, wherein the polynucleotide construct is not stably incorporated in the genome of the modified solanaceous plant cell.

72. The method of any one of embodiments 67-71, wherein the gene of interest is stably incorporated in the genome of the modified solanaceous plant cell.

73. The method of embodiment 67, wherein the modified solanaceous plant cell comprises in its genome a disruption in a CSPR gene, wherein the disruption decreases the expression level or activity of CSPR in said solanaceous plant cell relative to the expression level or activity of CSPR in a corresponding control, solanaceous plant cell lacking the disruption of the CSPR gene.

74. The method of embodiment 73, wherein the disruption of the CSPR gene comprises at least one member selected from the group consisting of a DNA insertion, a DNA deletion, and a DNA substitution of at least one base pair in the CSPR gene.

75. The method of embodiment 74, wherein the DNA insertion comprises (a) a DNA insertion in the 5'UTR of the CSPR gene;

(b) a DNA insertion in an exon of the CSPR gene; or

(c) a DNA insertion in an intron of the CSPR gene.

76. The method of any one of embodiments 73-75, wherein the disruption of the CSPR gene is a homozygous disruption.

77. The method of any one of embodiments 67-76, further comprising regenerating a transformed solanaceous plant from the modified solanaceous plant cell.

78. The method of embodiment 77, wherein the transformed solanaceous plant comprises stably incorporated in its genome the gene of interest.

79. A transformed solanaceous plant produced by the method of any one of embodiments 67-78.

80. An isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

(a) the nucleotide sequence set forth in SEQ ID NO: 14 orl6;

(b) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 15 or 17;

(c) a nucleotide sequence having at least 85% identity to at least one full-length nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOS: 14 and 16, wherein the nucleotide sequence encodes a polypeptide comprising CSPR activity; and

(d) a nucleotide sequence encoding an amino acid sequence having at least 85% identity to at least one full-length amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NOS: 15 and 17, wherein the nucleotide sequence encodes a polypeptide comprising CSPR activity.

81. The isolated nucleic acid molecule of embodiment 80, wherein the isolated nucleic acid molecule is a non-naturally occurring nucleic acid molecule.

82. An expression cassette comprising the nucleic acid molecule of embodiment 80 or 81.

83. The expression cassette of embodiment 82, further comprising a promoter operably linked to the nucleic acid molecule.

84. A transformed plant or plant cell comprising the nucleic acid molecule of embodiment 80 or 81 or the expression cassette of embodiment 82 or 83. 85. The transformed plant or plant cell of embodiment 84, wherein the nucleic acid molecule of embodiment 80 or 81 or the expression cassette of embodiment 82 or 83 is stably incorporated into the genome of the transformed plant or plant cell.

86. A non-human host cell comprising the nucleic acid molecule of embodiment 80 or 81 or the expression cassette of embodiment 82 or 83.

87. The non-human host cell of embodiment 86, wherein the nucleic acid molecule of embodiment 80 or 81 or the expression cassette of embodiment 82 or 83 is stably incorporated into the genome of the non-human host cell.

88. A polypeptide comprising an amino acid sequence selected from the group consisting of:

(a) the amino acid sequence set forth in SEQ ID NO: 15 or 17

(b) the amino acid sequence encoded by the nucleotide sequence set forth in SEQ ID NO: 14 orl6;

(c) an amino acid sequence having at least 85% identity to at least one full-length amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NOS: 15 and 17, wherein the polypeptide comprises CSPR activity; and

(d) an amino acid sequence encoded by a nucleotide sequence having at least 85% identity to at least one full-length nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOS: 14 and 16, wherein the polypeptide comprises CSPR activity.

Additional embodiments of the methods and compositions of the present invention are described elsewhere herein.

The following examples are offered by way of illustration and not by way of limitation.

EXAMPLES

EXAMPLE 1: csp22- Induced Responses Are Age Dependent in N. benthamiana

Four- to five-week-old N. benthamiana plants prior to the onset of flowering are commonly used to measure immunity and for transient Agrobacterium-m diated transformation (Agroinfiltration) (Shamloul et al. (2014) J. Vis. Exp. (86):e51204; Goodin et al. (2008) MPMI 21(8): 1015-1026). Unlike flg22-induced events, csp22-dependent responses are weak and inconsistent in plants of this age. Unexpectedly, we found that csp22-induced responses were higher in flowering N. benthamiana plants. Under the growth conditions used here, the plants were six-week-old when they flowered. We measured PTI responses including ROS production, Ca²⁺ influx, activation of MAPKs, and up-regulation of PAMP- induced genes (PIG) expression. All responses triggered by csp22 were greater in six-week- than four-week-old plants, but this effect was not seen for fig22 (FIGS. 1-2). Therefore, plants at this developmental stage were used to identify a receptor for CSP in N.

benthamiana, and for all subsequent experiments unless otherwise indicated.

EXAMPLE 2: Identification of the CSP Receptor from N. benthamiana

Using NbBAKl as a Molecular Bait We exploited the requirement for NbBAKl in csp22 recognition (Heese et al. (2007)

PNAS 104(29): 12217-12222), which suggested a csp22-triggered complex between the unknown receptor and NbBAKl. For this approach, we expressed NbBAKl b (from here on referred to as NbBAKl) (Chaparro-Garcia et al. (2011) PLoS One 6(l):el6608) from the strong viral 35S promoter, fused translationally to green fluorescent protein (GFP) at its C- terminus (35S:NbBAKl-GFP). Additionally, we created a mutant allele containing the bakl-5 mutation (C508Y) (35S:NbBAKl-5-GFP), as the A. thaliana BAK1-5 protein shows higher affinity to the FLS2 receptor than wildtype (Schwessinger et al. (2011) PLoS Genetics 7(4):el002046) and hence might be a better bait in this scheme (FIG. 3). We transformed 5- week-old N. benthamiana leaves transiently with each construct, and infiltrated them with csp22 3 days later at the onset of flowering to induce complex formation. The putative NbBAKl protein complexes were purified from leaf extracts using an anti-GFP antibody conjugated to beads, washed several times, and removed from the beads by boiling in SDS before separation on one-dimensional polyacrylamide gels. Slices were excised from the gel, and isolated proteins digested into peptides before analysis by liquid chromatography-mass spectrometry (LC-MS/MS). Experiments were performed four times independently and the total number of peptides identified in all experiments is displayed in FIG. 3B. Similar numbers of peptides were identified for NbBAKl and NbBAKl -5 in both mock- and csp22- treated samples (FIG. 3B). We identified a large number of proteins including an N. benthamiana homologue of BIR1, and two BIR2 homologues (FIG. 3B) (Gao et al. (2009) Cell Host Microbe 6(l):34-44; Halter er a/. (2014) Curr. Biol. 24(2): 134-143). At the protein level, the NbBIR2 variants were 63% identical to AtBIR2 (Table SI). One variant was more abundant in NbBAKl pulldowns hence was designated NbBIR2b, and we refer to the other as NbBIR2a (Table SI). NbBIRl, NbBIR2a and NbBIR2b were present in both mock and csp22 treatments. We further identified two RLPs that were enriched in the csp22-treated samples as potential CSPR candidates, which we termed RCl and RC2 (FIG. 3B). We cloned the RCl and RC2 coding regions into binary vectors under control of the 35S promoter and fused translationally to a C-terminal 5Myc epitope tag. We co-expressed each of these in N. benthamiana leaves with 35S.NbBAKl fused C-terminally to 3HA and 1FLAG tags

(35S:NbBAKl-3HAF), and tested their ability to form complexes in the presence of csp22 by co-immunoprecipitation (coIP) experiments. Using anti-FLAG to recover NbBAKl, and probing the immune complexes by anti-HA and anti-Myc western blots, we found that in contrast to the MS results, RCl was constitutively associated with NbBAKl. On the other hand, RC2 co-purified with NbBAKl only after csp22 treatment, and not after treatment with water or flg22 (FIG. 3C, FIG. S3 A). RCl and RC2 bound to NbBAKl -5 independent of csp22 (FIG. 4B). Similar results were observed for the interaction between AtBAKl-5 and AtFLS2 (Schwessinger et al. (2011) PLoS Genetics 7(4): el 002046). We concluded that RC2 is likely a receptor for CSP in N. benthamiana and from here on refer to it as NbCSPR, for N. benthamiana COLD SHOCK PROTEIN RECEPTOR. The predicted NbCSPR protein contains an N-terminal signal peptide, 28 extracellular tandem LRRs and a transmembrane domain followed by a short cytoplasmic tail (FIG. 5). CSP was identified as a PAMP on N. tabacum suspension cultures (Felix and Boiler (2003) J. Biol. Chem. 278(8): 6201-6208), and correspondingly we identified a homolog to NbCSPR in N. tabacum (NtCSPR) with 97% nucleotide sequence and 95% aa identity (FIGS. 6A-6H). Tomato leaves respond to the cspl5 peptide lacking the first seven aa of csp22 (Felix and Boiler (2003) J. Biol. Chem.

278(8): 6201-6208), but despite this, we were unable to identify a strong NbCSPR homologue in tomato by BLAST search of the currently available genome (availabe on the world-wide web at: blast.ncbi.nlm.nih.gov/Blast.cgi and solgenomics.net). Table 1. Percentage identity between the sequences of BAKl -interacting proteins (BIR) from

Arabidopsis thaliana and those from Nicotiana benthamiana

Protein sequences were aligned pairwise using NCBI BLASTp.

Table 2. List of primers used for generation of genetic constructs and qRT-PCR

Gene Forward primers Reverse primers

Primers used for amplification of NbBAKlb from N. benthamiana cDNA for cloning into pT70

5'-taccctcgagccATGATTCCTGCTTGGTATTACAC

NbBAKlb (NbBAKl) 5'- ttctctagaAGAGTCAAGGGGCTGTTCTTT -3'

A-3'

Primers used for generating NbBAKlb-5 from NbBAKlb

NbBAKlb C408Y /5'PHOS/GTGATGTCAAAGCCGCAAATATCTTA /5'PHOS/GATGAATAATCTTAGGATcatAATGATCA (NbBAKl-S) TTGGATG-3 ' TGCAAGT AAGA -3 '

Primers used for amplification of NbCSPR (NbCSPR2) from N. benthamiana cDNA for cloning into pENTER D-TOPO and subcloning into pGWB vectors

5'-caccATGAAAAGTGAGAGATTTTTATTTCTC

NbCSPR (NbRC2) 5'- ACTCCAGAGCACCTTCAATCTGTG -'3

AATATTG -'3

Primers used for amplification of NbCSPR (NbCSPR2) from N. benthamiana cDNA for cloning into pT70

5'-

NbCSPR (NbRC2) ttctcgagccATGAAAAGTGAGAGATTTTTATTTCT 5'- ttctctagaACTCCAGAGCACCTTCAATCTGTG -'3

C AATATTG -'3

Primers used for amplification of NbSOBIRl from N. benthamiana cDNA for cloning into pT70

5 ' - ttctetagaATGCTTGATCTGAGTTAACATAC ACC -

NbSOBIRl 5 ' - ttctegagccATGGC CTTC ACTGCTT- ' 3

'3

Primers used for generating the genetic sequence for csp22 and subsequent cloning into pGex-2TK for GST fusion

/5'Phos/gatecGCCGTGGGCACCGTGAAGTGGTT /5'Phos/aatteGCCGCCGTCGGGGGTGATGAAGCCG csp22 CAACGCCGAGAAGGGCTTCGGCTTCATCACC AAGCCCTTCTCGGCGTTGAACCACTTCACGGTG

CCCGACGGCGGCg - 3" CCCACGGCg -3'

Primers used for generating Virus-induced gene silencing constructs

5'-cgacgacaagaccctCATTACTCCTTCATTGCTTGA 5'-gaggagaagagccctGATAAGCTCAGAAACAATTCA

TRV.-NbCSPRb

ATTG-3 ' GGAAG-3 '

TRV.-NbCSPRa 5 ' -cgacgacaagaccctTGAAAAGTGAGAGATTTTTA 5'-gaggagaagagccctGTTACCTCTCAAATGTTGACTA (TRV.-NbCSPR) TTTC -3' TAG -3'

TRV.-FLS2 5'-cgacgacaagaccctTACCTTTTTCATACCTTTG-3' 5'-gaggagaagagccctGGTGGAATATTTCC-3'

Primers used for qRT-PCR

NbEFl a 5 - AAGGTCCAGTATGCCTGGGTGCTTGAC-3 5 - AAGAATTCACAGGGACAGTTCCAATACCAC-

3^'

Nb WRKY22 5 - AAGGTCCAGCGAAGTCTCTGAGGGTGA-3 ' 5 - AAGAATTCCAATCCTAGCTCTGGCTCCTG- 3' NbACRE31 5 - AAGGTCCCGTCTTCGTCGGATCTTCG -3 5 - AAGAATTCGGCCATCGTGATCTTGGTC-3 NbCYP71D20 5'- AAGGTCCACCGCACCATGTCCTTAGAG -3' 5'- AAGAATTCCTTGCCCCTTGAGTACTTGC-3¹ NbCSPR 5'-GTCTCTTCCCGTTTGCTTTC - 3' 5' - GATGTCAGGCAATGAACCAC -3 ' NbSOBIRl 5' - ATGGCCTTCACTGCTTCACAAATTC-3 ' 5' - ATTCGAAGGCGGAGTAGAGA-3 ' NbFLS2 5' -CTGTGTACAAGGGTAGACTGGAAGATGG- 5' - GGAGAGGTGCAAGGACAAAGCCAATTT-3 '

3' EXAMPLE 3: NbCSPR Binds csp22 and is Required for csp22 Responses

To test if NbCSPR can bind csp22, we expressed it in N. benthamiana leaves fused C- terminally to the 3HAF epitope tag and purified it from leaf extracts by anti-FLAG IP. To test for interaction, we mixed the bead-bound receptor with csp22 expressed as a recombinant fusion with the GST protein (csp22-GST), or csp22-GST mixed with 10 μΜ free csp22 peptide. After washing the beads, we found that csp22-GST was retained on the beads in the absence but not the presence of free csp22 peptide (FIG. 7A). This indicates that NbCSPR binds to csp22, consistent with the idea that NbCSPR is the CSP receptor.

To investigate the requirement for NbCSPR in csp22 responses, we generated gene fragments corresponding to nucleotides 2-299 {TRV.NbCSPRa) and 300-1001

(TRV:NbCSPRb) of the open reading frame, and cloned them into a tobacco rattle virus (TRV) vector for virus-induced gene silencing (VIGS) experiments (Dong et al. (2007) Plant Physiol. 145(4): 1161-1170). Plants silenced tor NbCSPR (TRV.NbCSPRa and

TRVNbCSPRb, FIGS. 6A-6H), but not those silenced for the control gene GFP (TRVGFP), showed reduced csp22 responses commensurate with the level of NbCSPR silencing, including diminished ROS production, activation of MAPKs, and up-regulation of PIG expression (FIG. 7). Silencing of NbCSPR did not affect flg22 responses (FIG. 8). We detected the activation of only one MAPK in silenced plants treated with PAMPs, as reported previously (Segonzac et al. (2011) Plant Physiol. 156(2):687-699). Successful silencing was confirmed by reduced NbCSPR mRNA levels (FIG. 8D) and lack of detectable NbCSPR protein after transient transformation of TR V:Nb CSPRa/b plants with 35S:NbCSPR-3HAF (FIG. 8E). The TRV.NbCSPRa construct was used for all subsequent experiments because of higher silencing efficiency (FIG. 8D), and is referred to as TRVNbCSPR from here on.

EXAMPLE 4: NbCSPR Does Not Require NbSOBIRl for csp22 Responses

The LRR-RK NbSOBIRl may be generally required for signal transduction by RLPs through direct interaction, perhaps by providing an intracellular signalling component to the complex (Gust and Felix (2014) Curr. Opin. Plant Biol. 21C: 104-111). Indeed, we found that when overexpressed in N benthamiana, NbCSPR co-purified with NbSOBIRl in pull-down experiments, but AtFLS2 did not (FIG. 9). Despite this, plants co-silenced tor NbSOBIRl and its close homologue NbSOBIRl-like (TRV: NbSOBIRl +SOBIR-like) (Liebrand et al. (2013) PNAS l 10(24): 10010- 10015) were not impaired in csp22- or flg22-induced production of ROS, activation of MAPKs, or PIG up-regulation (FIG. 9). In fact, in

TRV: NbSOBIRl +SOBIR-like plants, PIG were induced to a higher extent by csp22 or flg22 treatment by comparison to TRV. GFP plants. Successful silencing was confirmed through reduced NbSOBIRl and NbSOBIRl-like mRNA levels and the lack of Avr4/Cf4-mediated cell death in TRV: NbSOBIRl +SOBIR-like plants (Liebrand et al. (2013) PNAS

110(24): 10010-10015). We thus conclude that csp22 -triggered immune signalling is independent of NbSOBIRl and NbSOBIRl -like. EXAMPLE 5: NbCSPR Confers Responsiveness to csp22 in Transgenic thaliana

Plants Dependent on AtBAKl/AtBKKl

If NbCSPR is indeed the CSP receptor, then it should confer csp22 recognition to a previously non-responsive species. To test this, we first transformed A. thaliana Col-0 protoplasts with 35S:NbCSPR-3HA to test for csp22-induced MAPK activation. Wildtype

Col-0 protoplasts were blind to the PAMP, whereas NbCSPR-expressing protoplasts activated MAPKs in a csp22-dependent manner. (FIG. 10E). These data suggests that NbCSPR is indeed the CSP receptor. To further substantiate this, we generated stable transgenic

35S:NbCSPR-5Myc A. thaliana plants using the ecotype Columbia (Col-0). We obtained 5 transgenics, but only one of these, IS-01, expressed NbCSPR-5Myc protein to a detectable level. We measured csp22-dependent responses in this homozygous line, including ROS production, seedling growth inhibition (SGI) and activation of MAPK. IS-01 developed a ROS burst in response to csp22 that was absent in the empty vector line (IS-00). The profile of ROS production was aberrant compared to N. benthamiana leaf discs, suggesting that NbCSPR is not properly regulated in A. thaliana, which might be related to the low frequency of productive transformation. In addition to this observation, we found that IS-01 plants but not IS-00 plants showed progressive activation of MAPK after 5 and 15 min, and a small but significant SGI in response to the elicitor (FIG. 10). Importantly, csp22-dependent MAPK activation was absent in transformed bakl-5 bkkl-1 double mutant cells, but present in sobirl-12 mutant cells (FIG. 11). In contrast, Col-0 and sobirl-12 but not bakl-5 bkkl-1 protoplasts expressing NbCSPR activated MAPKs in response to flg22 in the same experiments. Overall, the data corroborate our findings in N. benthamiana, and support a model in which NbCSPRl recognises csp22 in a complex containing BAK1 (or BKK1) but independent of SOBIR1.

EXAMPLE 6: NbCSPR Confers Age-Related Resistance to Bacterial Pathogens and Restricts Agrobacterium-Mediated Transformation of N. Benthamiana in Flowering

Plants

To test roles for NbCSPR in immunity, we silenced NbCSPR or NbFLS2 in N.

benthamiana using VIGS, and infected four- or six-week old silenced plants with adapted and non-adapted P. syringae strains. Both FLS2- and NbCSPR-sil nced plants supported more than 1 log growth of the adapted pathogen P. syringae pv. tabaci 6605 (Pta) (FIG. 12A) compared to control plants silenced for GFP. This is consistent with NbCSPR playing an important role in anti-bacterial immunity. To test this further, we inoculated silenced plants with a mutant strain deficient in the Type-Ill secretion system (Pta 6605 hrcC) (FIG. 12B). Again, the bacteria grew significantly more on N. benthamiana plants silenced for NbFLS2 or NbCSPR than on plants silenced for NbGFP. Finally, to test the relative contribution of NbFLS2 to bacterial immunity in the absence of flagellin recognition, we inoculated silenced plants with the Pta 6605 fliC mutant lacking the gene encoding flagellin. Accordingly, bacterial growth was not increased on plants silenced for NbFLS2 but showed a small but significant increase in six-week-old plants silenced for NbCSPR (FIG. 12C). This effect was not seen on four-week-old plants (FIG. 13 A). Thus, the effect of NbCSPR on bacterial growth in six-week-old plants is even measurable in the absence of flagellin recognition.

To test a role for NbCSPR against non-adapted pathogens, we inoculated silenced plants with P. syringae pv. phaseolicola 1448a (FIG. 12D). Although this strain grows quite weakly on N. benthamiana, its growth was significantly higher on plants silenced for NbFLS2 or NbCSPR when compared with plants silenced for GFP. We also found that NbCSPR contributed to bacterial resistance when transferred into A. thaliana. The stable transgenic lines IS-00 and IS-01 were spray-infected with adapted P. syringae pv. tomato DC3000 bacteria to measure PTI. Plants overexpressing NbCSPR showed reduced bacterial growth relative to the EV line (FIG. 12E). Taken together, our data show that NbCSPR is an important component of anti-bacterial immunity.

Flowering N. benthamiana plants are recalcitrant to the expression of recombinant protein after Agroinfiltration (Leuzinger et al. (2013) J. Vis. Exp. (77):50521). As A. tumefaciens also contains genes for CSP that are most likely elicitor-active (FIG. 13F), we tested if NbCSPR restricts Agroinfiltration. Four-week-old plants silenced for GFP, NbFLS2, or NbCSPR, were equally transformable by A. tumefaciens as judged by expression of an intron-GUS marker gene (FIG. 13B). Older plants were minimally transformable after silencing for GFP or NbFLS2 (FIG. 4E). Strikingly, N¾CSPi?-silenced plants showed much higher GUS activity comparable to expression in young plants. Similarly, transient expression of an arbitrary gene (35S:N2-3HAF) encoding aa 1-242 of the Solarium lycopersicum Prf protein (Saur et al. (2015) J. Biol. Chem. 290: 11258-11267) in flowering plants revealed greater Ν2 accumulation in plants silenced for NbCSPR relative to those silenced for GFP (FIG. 13C). Ν2 protein levels were unchanged by gene silencing in younger plants (FIG. 13D). Greater resistance of older plants to Agroinfiltration may be related to NbCSPR up-regulation of about two-fold in six-week-old relative to four-week-old plants, an effect which was not seen for NbFLS2 (FIG. 13E). Our data demonstrate a clear role for NbCSPR in restricting genetic transformation by A. tumefaciens.

EXAMPLE 7: Potentiation of csp22 Responses by flg22 Pre-Treatment

Interestingly, we found that prior treatment of N. benthamiana plants with flg22 increased csp22-dependent responses, but this effect was not seen in reverse. Treatment of N. benthamiana leaves with 100 nM csp22 significantly upregulated NbCSPR expression, but this effect was far higher upon treatment with 100 mM flg22 (FIG. 14). Conversely, flg22 treatment upregulated NbFLS2 to only a small extent, whereas its induction by csp22 was negligible. Consistent with these results, we found that prior fig22 treatment caused higher csp22-dependent production of ROS, up-regulation of PIG expression, and increased MAPK activation including activation of a second MAPK (FIGS. 14B-14E). Interestingly, both csp22 -induced ROS and MAPK assays showed decreases after csp22 pretreatment, which may be a similar phenomenon to the refractory period of diminished FLS2-mediated responses after initial flg22 perception (Smith et al. (2014) Plant Physiol . 164(l):440-454). PTI responses induced by flg22 were not increased by prior csp22 treatment (FIG. 15).

Overall, prior flg22 treatment increased csp22 responses but not vice versa, perhaps consistent with the fact that flagellin and CSP are external and internal PAMPs, respectively. Discussion

We disclose herein the identification of a receptor for the bacterial PAMP csp22 using a novel biochemical approach (Schwessinger (2010) "Genetic analysis of signalling components of PAMP -triggered immunity (PTI) in plants," Ph.D. Diss., Univ. of East Anglia). NbCSPR encodes a previously undescribed LRR-RLP that forms a complex with NbBAKl after elicitation and is required for csp22 responses and for immunity to bacterial pathogens, or the PAMP. It is active in six-week-old plants where it restricts the growth of adapted and non-adapted pathogens, and transient transformation by A. tumefacien .

Interestingly, our results suggest a mechanism in which PAMP perception is coordinated temporally as prior flagellin perception potentiates NbCSPR-mediated immunity in four- week-old plants.

We used a new approach to identify PRRs which depends on common complex components such as BAK1 for ligand-induced signal transduction. It is well established that BAK1 is a central regulator of immunity though interaction with LRR-type PRRs after PAMP perception (Heese et al. (2007) PNAS 104(29): 12217-12222; Chinchilla et al. (2007) Nature 448(7152):497-500). We showed previously that csp22-dependent ROS production is NbBAKl dependent, and as such predicted a csp22-induced interaction between NbBAKl and the unknown receptor. Through purifying NbBAKl -GFP (or NbBAKbl-5-GFP) after csp22 treatment, we identifed known interactors of BAK1 including N. benthamiana homologues of AtBIRl and AtBIR2 (Gao et al. (2009) Cell Host Microbe 6(1): 34-44; Halter et al. (2014) Curr. Biol. 24(2): 134-143). Notably, we did not detect a release of either NbBIR2 variant from NbBAKl after csp22 treatment as has been reported for AtBIR2 (Halter et al. (2014) Curr. Biol. 24(2): 134-143). This may reflect a difference between the species, or was perhaps due to the overexpression of NbBAKl. Most importantly, we identified two potential receptor candidates based on their enrichment in csp22 -treated samples. Subsequent coIP analysis confirmed the csp22-dependent interaction of one of the candidates with NbBAKl. Overall, this approach was successful and offers a general strategy to identify novel PRRs.

Genetic tests showed that NbCSPR is required for csp22-dependent responses and anti-bacterial immunity. Plants silenced for NbCSPR were deficient in csp22 -triggered ROS production, MAPK activation and up-regulation of PIG. Consistent with this, the silenced plants were more susceptible to infection by adapted and non-adapted P. syringae pathogens. Silencing of NbCSPR allowed a similar increase in bacterial growth as silencing NbFLS2, which was about 1 log cfu/cm² for adapted Pta 6605. Moreover, plants silenced for NbCSPR were transformed more efficiently by A. tumefaciens than TRV. GFP plants, but this effect was not seen for NbFLS2. This result reflects the fact that A. tumefaciens possesses a conserved CSP protein containing the csp22 motif (FIG. 13F), but its variant flagellin is not recognised (Felix et al. (1999) Plant J. 18(3):265-276). Recognition of A. tumefaciens CSP may suggest why NbCSPR peptides were recovered from NbBAK-GFP preparations prior to csp22 treatment. Restriction of Agrobacterium-mediated transformation by NbCSPR is not completely unexpected because EFR also limits transformation in A. thaliana and transgenic N. benthamiana (Zipfel et al. (2006) Cell 125(4):749-760).

Additional experimental results provide further evidence that NbCSPR is a CSP receptor. Firstly, the non-responsive species A. thaliana initiated csp22-dependent production of ROS, MAPK activation and SGI after transformation with 35S:NbCSPR-5Myc. The transfer of NbCSPR to protoplasts of A. thaliana allowed csp22-dependent MAPK activation in the transformed cells, whereas protoplasts transformed with the empty vector were blind to the PAMP, as are wildtype Col-0 plants. Importantly, signaling by NbCSPR in A. thaliana protoplasts required AtBAKl and/or its close paralog AtBKKl, as bakl-5 bkkl-1 protoplasts transformed with NbCSPR were non-responsive to csp22. Lastly, we showed that NbCSPR expressed in N. benthamiana tissue bound csp22-GST in vitro, and that this interaction was abrogated when excess free csp22 peptide was used in competition for binding. We conclude that NbCSPR is the CSP receptor in N. benthamiana.

NbSOBIRl is required for accumulation and functionality of multiple RLPs, perhaps by stabilising the respective receptor or by providing transmembrane signalling capability (Liebrand et al. (2013) PNAS l 10(24): 10010-10015; Jehle et al. (2013) Plant Signal. Behav. 8(12): e27408; Zhang et al. (2013) Plant Cell 25(10):4227-4241 ; Zhang et al. (2014) Plant Physiol. 164(l):352-364). Although NbCSPR bound NbSOBIRl in directed tests after overexpression of both proteins, neither NbSOBIRl nor its close homologue NbSOBIRl -like were required for csp22-induced responses. We used the TRV:NbSOBIRl+NbSOBIR-like silencing construct that targets both genes (Liebrand et al. (2013) PNAS 110(24): 10010- 10015). Co-silencing of NbSOBIRl and NbSOBIRl -like was confirmed by qRT-PCR and the lack of Avr 4/Cf4-induced hypersensitive response, as shown previously (Liebrand et al.

(2013) PNAS l 10(24): 10010-10015). The same plants exhibited all csp22-induced responses. We further found that SOBIR1 was dispensable for NbCSPR accumulation or function, as A. thaliana sobirl-12 protoplasts transformed with 35S:NbCSPR-3HA were responsive to csp22 and showed comparable NbCSPR accumulation as Col-0 protoplasts. Thus, although NbSOBIRl can interact with NbCSPR, this interaction is dispensable for csp22 recognition.

CSP responses were far greater in plants that were transitioning to flowering than in younger plants. This may be due to an increase in NbCSPR expression, or several other regulatory mechanisms, which were not tested here. The difference is biologically significant because older plants were more resistant to Pta bacteria lacking flagellin, and were recalcitrant to transformation by A. tumefaciens. Both effects were reversed by NbCSPR silencing. Despite the fact that csp22 generally exhibited weaker PTI responses than flg22 (Heese et al. (2007) PNAS 104(29): 12217-12222; Felix et al. (1999) Plant J. 18(3):265-276; Felix and Boiler (2003) J. Biol. Chem. 278(8): 6201 -6208), plants silenced for NbCSPR showed strikingly similar levels of bacterial growth when compared to N& Z^-silenced plants. This was true for adapted and non-adapted P. syringae. However, we cannot exclude differential silencing levels of each receptor gene. The Pta fliC strain which cannot activate FLS2 showed similar growth on N&FZ^-silenced plants to TRV. GFP plants, as expected. Growth of this strain was slightly but significantly higher in N&GSPR-silenced plants, again demonstrating a role for NbCSPR in anti-bacterial immunity. Likewise, the efficiency of Agrobacterium-mediated transformation in plants silenced for GFP or NbFLS2- was similar, whereas N&GSPR-silenced plants showed both strongly enhanced GUS activity and accumulation of the Ν2 protein after transient transformation. Similarly, resistance to Xanthomonas oryzae pv. oryzae mediated by the rice LRR-RKs Xa21 and Xa3/Xa26 are developmentally regulated (Century et al. (1999) Plant J. 20(2):231-236; Cao et al. (2007) Genetics 177(l):523-533).

Our data further show that younger plants can compensate for their deficiency in csp22 perception by upregulating NbCSPR expression in response to flg22. This potentiated all csp22 -induced responses tested here, and may explain why NbCSPR does not restrict the growth of the flagellin-deficient strain Pta 6605 fliC in four-week-old plants. This is an important observation because one potential interpretation is that flagelin and CSP perception occur sequentially. This would accord with the fact that flagellin is an external PAMP that is immediately visible to the infected plant, whereas CSP is internal and must be released prior to host perception. This model is interesting because it implies that FLS2, but not NbCSPR, identifies the invading microbe as bacterial. Consistent with this view, both eukaryotic pathogens and N. benthamiana itself express proteins with conserved CSDs, and a protein with a CSD from Nicotiana sylvestris elicited defense response on N. tabacum cells (Felix and Boiler (2003) J. Biol. Chem. 278(8):6201-6208). Hence, an additional level of regulation may be necessary for appropriate deployment of CSP recognition, perhaps also to avoid an auto-immune response. We further speculate that the importance of developmental regulation of NbCSPR might be related to the difficulty in recovering 35S:NbCSPR A. thaliana transgenics.

In summary, we have devised a new biochemical procedure to purify and identify novel PRRs, and demonstrated its utility by cloning a CSP receptor from N. benthamiana. Transfer of NbCSPR to new species will be immediately useful for conferring resistance to bacterial diseases in agriculture. In addition, knocking out or silencing the expression of the NbCSPR will improve transient Agrobacterium-m diated transformation of N. benthamiana for industrial and experimental uses.

Material and Methods

Plant growth conditions

N. benthamiana wild type or SLJR15 (Segonzac et al. (2011) Plant Physiol. 156(2):687-699) plants were grown on soil at one plant per pot in a controlled environment at 22°C with a 16 h photoperiod. A. thaliana Col-0, bakl-5 bkkl-1 and sobirl-12 plants were grown on 0.8% agar Murashige and Skoog (MS, Sigma) plates or soil at one plant per pot in a controlled environment maintained at 22°C with a l0 h or l6 h photoperiod.

Generation of constructs

NbBAKl, NbBAKl-5, RC2 (NbCSPR) and NbSOBIRl were amplified/rom N. benthamiana cDNA using primers listed in Table 2. RC1 was synthesised by GeneArt (Life Technologies). Constructs were cloned into pT70 vectors carrying 3'-terminal sequences encoding GFP, 5xMyc (5Myc) or 3xHA-lxFLAG (3HAF) epitope tags (Rathjen et al. (1999) EMBO J.

18(12):3232-3240; de Vries et al. (2006) Plant J. 45(l):31-45; Balmuth and Rathjen (2007) Plant J. 51(6): 978-990) and transformed into A. tumefaciens GV3101 pMp90. For protoplast transformation, NbRC2 (NbCSPR) was cloned into pGWB414. csp22-GST was generated by combining respective forward and reverse primers (Table 2) and cloned into pGex-2TK.

A. Agroinfiltration for transient protein expression was performed as described in Mucyn et al. (2006) Plant Cell 18(10):2792-2806.

Virus-induced gene silencing (VI GS) was performed using a TRV vector as described in Liu et al. (2002) Plant J. 30(4):415-429 and Peart et al. (2002) Plant J. 29(5):569-579. TRV.NbCSPR and TRV:NbFLS2 silencing constructs were amplified using the primers listed in Table 2 and cloned into pYY13 as described in Dong et al. (2007) Plant Physiol.

145(4): 1161-1170.

B Floral dip transformation of A. thaliana was performed as described in Bent (2006) Methods Mol. Biol. 343:87-103.

Mesophyll protoplast transfection of A. thaliana

Mesophyll protoplast transfection of A. thaliana was performed using pGWB414- 35S:NbCSPR-3HA as described in Yoo et al. (2007) Nat. Protoc. 2(7): 1565-1572.

Protein extraction and co-immunoprecipitation

Leaf material was ground in liquid nitrogen and thawed in protein extraction buffer (150 mM Tris-HCl pH 7.5, 150 mM sodium chloride, 10 mM EDTA, 10% glycerol, 15 mM DTT, 1 mM NaF, 1 mM NaMo, 0.55 mM aV0_3, 1% (v/v) IGEPAL, 2% (v/v) Plant Protease Inhibitor cocktail (Sigma), 2% (w/v) polyvinylpolypyrrolidone (for N. benthamiana only)). Extracts were centrifuged at 15,000 x g for 10 min at 4°C. Supernatants were sterile filtered and centrifuged again at 15,000 x g for 30 min at 4°C. Antibody-conjugated beads (Anti- FLAG M2, Sigma) were incubated in equilibration buffer (Tris-HCl pH 7.5, 150 mM sodium chloride, 10 mM EDTA, 10% (v/v) glycerol, 1.5% (w/v) BSA) for one hour at 4°C, and subsequently mixed with the filtered protein extracts for 2 h at 4°C with slow but constant rotation. Conjugated beads were washed eight times in 1 ml cold wash buffer (Tris-HCl pH 7.5, 250 mM sodium chloride, 10 mM EDTA, 10% glycerol, 0.5% Plant Protease Inhibitor) at 4°C, before stripping interacting proteins from the beads by boiling in 50 μΐ SDS loading buffer for 5 minutes.

Immunodetection

For immunodetection, samples were separated on 8-12% SDS-PAGE gels, blotted onto PVDF membrane and probed with anti-HA (Roche) or anti-Myc (Santa Cruz), anti-pMAPK (Cell Signaling) primary antibodies, followed by anti-Rat-IgG-HRP (Sigma) or anti-Rabbit- IgG-HRP (Sigma) secondary antibodies as appropriate. Labelled proteins were detected by the HRP activity using a LAS 4000 Luminescence Image Analyser (GE Healthcare). ECL Prime (GE Healthcare) was used as a substrate for MAPK detection or Femto

Chemiluminescent substrate (Pierce) for detection of fusion proteins. De novo identification of NbBAKl-interacting proteins by LC-MS/MS following anti- GFP immunoprecipitation

NbBAKl-GFP was overexpressed in N. benthamiana. Proteins were extracted and coIP performed as described above using Anti-GFP, Chromotek. Gel electrophoresis and LC- MS/MS was performed as described (Kadota et al. (2014) Mol. Cell 54(l):43-55) with the difference that a combined Sol genomics/TGAC N benthamiana predicted protein database was used for protein identification. In vitro peptide-receptor binding assay

csp22 was expressed as a GST fusion in E. coli. The fusion protein was extracted in protein extraction buffer and purified on Glutathi one-conjugated beads (Sigma), and eluted from the affinity matrix using 4 mg/ml Glutahione. N. benthamiana leaves were transformed with an EV control or NbCSPR fused to a 3HAF tag and extracts were incubated with anti-FLAG (Sigma) before washing off unbound proteins. The eluted GST peptide with or without 10 μΜ unlabelled peptide was added to anti-FLAG affinity matrix after incubation in EV or NbCSPR-3HAF leaf extracts, and unbound proteins removed using wash buffer before gel electrophoresis and western blot. Calcium burst assay

The calcium burst assay was performed as described by Segonzac et al. (2011) Plant Physiol. 156(2):687-699.

ROS burst assay

The ROS burst assay was performed as described by Heese et al. (2007) PNAS

104(29): 12217-12222, with the difference that for the ROS burst assay L-012 (Wako chemicals) was used instead of luminol and luminescence was measured on a TEC AN plate reader, Infinite M200 PRO (Tecan). MAPK activation assay

Protoplasts from A. thaliana were kept in the dark and N. benthamiana leaf discs (0.38 cm²) were floated on water overnight before treatment with sterile water or the respective PAMP for 5 or 15 minutes. Proteins were extracted in protein extraction buffer and activated MAPKs detected by anti-pMAPK (Cell Signaling) western blot after gel electrophoresis. qRT-PCR

Fifteen N. benthamiana leaf discs (0.38 cm²; one per well) were floated on water overnight before treatment with sterile water or the respective PAMP for 5 or 15 minutes. Leaf disks were ground in liquid nitrogen. RNA was extracted using the TRI reagent (Life technologies) and cDNA was synthesized using 3 μg of RNA, oligo(dT) and the Superscript III cDNA synthesis kit according to manufacturer's instructions. The PCR reactions were performed in a total volume of 10 containing 1 of RT reaction, 0.2 μΜ of each primer and 5 μΐ.

SYBR green PCR 2x master mix (Life Technologies). Amplifications were performed using an ABI PRISM 384-well clear optical reaction plate with a ViiA™ 7 system PCR analyzer (Life Technologies). Amplification cycles were normalised against the NbEFla by calculating differences between the threshold cycle (CT) of the target gene and the CT of NbEFla. Primers used in this study are listed in Table 2.

Trypan blue staining

Trypan blue staining was performed as described by Mucyn et al. (2006) Plant Cell

18(10):2792-2806.

Bacterial Growth Assays

Bacterial Growth Assays were performed using Pseudomonas syringae pv. tabaci 6605 (wild-type, hrc and fli ) (Shimizu et al. (2003) Mol. Genet. Genomics 269(l):21-30), Pseudomonas syringae pv. phaseolicola 1448a (Arnold et al. (2011) Mol. Plant Pathol. 12(7):617-627) and Pseudomonas syringae pv. tomato DC3000 prepared as described

(Segonzac et al. (2011) Plant Physiol. 156(2):687-699). Plants were infected with bacteria in 10 mM MgCl₂ at a concentration of 5x 10⁷ cfu/ml. Silwet L-77 (0.04%) was added just prior to infection. Two leaves from 3 individual N. benthamiana plants were dipped for 20 seconds in the bacterial suspension. Six individual A. thaliana plants were spray-inoculated with the bacterial suspension. Leaf disc samples were harvested 3 d after infection and bacterial growth assessed as described in Segonzac et al. (2011) Plant Physiol. 156(2):687-699. GUS staining assay

A. tumefaciens GV3101 pMp90 containing the pBIN19-35S:GUS(Intron) (Zipfel et al. (2006) Cell 125(4):749-760) construct was syringe infiltrated at 10⁷ cfu/ml into two leaves from 3 individual N. benthamiana plants. Leaf discs were harvested 2 days post infiltration. GUS staining was performed in 24 well plates, by vacuum infiltrating the GUS staining solution (100 mM sodium phosphate pH 7.0, 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 1 mg/ml X-Gluc, 1.5 μg/ml tetracycline) into the leaf discs with incubation overnight at 37°C. Leaf disks were cleared by several washes with 70% ethanol at 37°C.

The article "a" and "an" are used herein to refer to one or more than one (i.e. , to at least one) of the grammatical object of the article. By way of example, "an element" means one or more element.

Throughout the specification the word "comprising," or variations such as

"comprises" or "comprising," will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

Claims

THAT WHICH IS CLAIMED:

1. A method for enhancing the resistance of a plant to plant disease caused by at least one plant pathogen, the method comprising introducing a nucleic acid construct into at least one plant cell of the plant, wherein the nucleic acid construct comprises a nucleotide sequence encoding a cold shock protein receptor (CSPR).

2. The method of claim 1, further comprising regenerating the plant cell into a transformed plant comprising in its genome the nucleic acid construct.

3. The method of claim 1 or 2, wherein the transformed plant has enhanced resistance to at least one plant pathogen.

4. The method of claim 3, wherein the at least one plant pathogen is a bacterial plant pathogen.

5. The method of any one of claims 1-4, wherein the nucleotide sequence encodes a Nicotiana CSPR.

6. The method of any one of claims 1-5, wherein the nucleotide sequence is selected from the group consisting of:

(a) the nucleotide sequence set forth in SEQ ID NO: 1 or 4;

(d) a nucleotide sequence having at least 85% identity to at least one full- length nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOS: 1 and 4, wherein the nucleotide sequence encodes a polypeptide comprising CSPR activity;

(e) a nucleotide sequence having at least 85% identity to at least one full- length nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOS: 3, 6, 14, 16, 18, 20, 22, and 24, wherein the nucleotide sequence encodes a polypeptide comprising CSPR activity;

(f) a nucleotide sequence encoding an amino acid sequence having at least 85% identity to at least one full-length amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NOS: 2, 5, 15, 17, 19, 21 , 23, and 25, wherein the nucleotide sequence encodes a polypeptide comprising CSPR activity; and

(g) a nucleotide sequence comprising the nucleotide sequence of any one of (a)-(f) operably linked to the nucleotide sequence of a promoter that is capable of driving expression of the nucleotide sequence in the plant.

7. The method of claim 6, wherein the promoter is selected from the group consisting of the NbCSPR promoter, the NtCSPR promoter, a pathogen-inducible promoter, a constitutive promoter, a tissue-preferred promoter, a wound-inducible promoter, and a chemical-regulated promoter.

8. The method of any one of claims 1-7, wherein the at least one plant cell comprises a heterologous polynucleotide comprising a nucleotide sequence encoding an additional partem recognition receptor (PRR).

9. The method of claim 8, wherein the additional PRR is a bacterial EF-Tu receptor (EFR).

10. The method of any one of claims 1-9, wherein the plant cell comprises a resistance (R) gene.

11. The method of any one of claims 1-10, wherein the plant is a dicot or a monocot.

12. The method of claim 1 1, wherein the dicot is selected from the group consisting of soybean, alfalfa, cotton, Brassica spp., sunflower, safflower, lettuce, strawberry, apple, and citrus.

13. The method of any one of claims 1-11, wherein the plant is a non-solanaceous plant.

14. The method of any one of claims 1-13, wherein the plant is a non-

Brassicaceae plant.

15. The method of claim 11, wherein the monocot is selected from the group consisting of maize, rice, wheat, barley, sorghum, sugarcane, coconut, oil palm, and banana.

16. A transformed plant or plant cell produced by the method of any one of claims

1-15.

17. A transformed plant, plant cell, or seed comprising stably incorporated in its genome a heterologous nucleic acid construct comprising a nucleotide sequence that encodes a CSPR, wherein the transformed plant, wherein the transformed plant has enhanced resistance to at least one plant pathogen.

18. The transformed plant, plant cell, or seed of claim 17, wherein the nucleotide sequence encodes a Nicotiana CSPR.

19. The transformed plant, plant cell, or seed of claim 17 or 18, wherein the nucleotide sequence is selected from the group consisting of:

(a) the nucleotide sequence set forth in SEQ ID NO: 1 or 4;

(d) a nucleotide sequence having at least 85% identity to at least one full- length nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOS: 1 and 4, wherein the nucleotide sequence encodes a polypeptide comprising CSPR activity; (e) a nucleotide sequence having at least 85% identity to at least one full- length nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOS: 3, 6, 14, 16, 18, 20, 22, and 24, wherein the nucleotide sequence encodes a polypeptide comprising CSPR activity; and

20. The transformed plant, plant cell, or seed of claim 19, wherein the promoter is selected from the group consisting of the NbCSPR promoter, the NtCSPR promoter, a pathogen-inducible promoter, a constitutive promoter, a tissue-preferred promoter, a wound- inducible promoter, and a chemical-regulated promoter.

21. The transformed plant, plant cell, or seed of any one of claims 17-20, wherein the transformed plant further comprises stably incorporated in its genome a heterologous polynucleotide comprising a nucleotide sequence encoding an additional PRR.

22. The transformed plant, plant cell, or seed of claim 21, wherein the PRR is a bacterial EFR.

23. The transformed plant, plant cell, or seed of claim 21 or 22, wherein the nucleic acid construct comprises the heterologous polynucleotide.

24. The transformed plant, plant cell, or seed of any one of claims 17-23, wherein the plant further comprises stably incorporated in its genome a resistance (R) gene.

25. The transformed plant, plant cell, or seed of any one of claims 17-24, wherein the plant is a dicot or a monocot.

26. The transformed plant, plant cell, or seed of claim 25, wherein the dicot is selected from the group consisting of soybean, alfalfa, cotton, Brassica spp., sunflower, safflower, lettuce, strawberry, apple, and citrus.

27. The transformed plant, plant cell, or seed of any one of claims 17-25, wherein the plant is a non-solanaceous plant.

28. The transformed plant, plant cell, or seed of any one of claims 17-27, wherein the plant is a non-Brassicaceae plant.

29. The transformed plant, plant cell, or seed of claim 25, wherein the monocot is selected from the group consisting of maize, rice, wheat, barley, sorghum, sugarcane, coconut, oil palm, and banana.

30. The transformed plant, plant cell, or seed of any one of claims 17-29, wherein the transformed plant has enhanced resistance to at least one bacterial plant pathogen.

31. A method for limiting a plant disease caused by at least one plant pathogen in agricultural crop production, the method comprising planting a seed, seedling or part of the transformed plant of any one of claims 2-30 and growing a progeny plant under conditions favorable for the growth and development of the progeny plant, wherein the seed, seedling or part comprises the nucleic acid construct and optionally the heterologous polynucleotide.

32. The method of claim 31, further comprising harvesting an at least one fruit, tuber, leaf and/or seed from the plant.

33. Use of the plant or seed of any one of claims 2-30 in agriculture.

34. A human or animal food product produced using the plant or seed of any one of claims 2-30.

35. A method for increasing the transformation efficiency of a solanaceous plant in Agrobacterium-mediated transformation, the method comprising decreasing the expression level and/or activity of CSPR in the solanaceous plant, whereby transformation efficiency is increased when the solanaceous plant is subjected to Agrobacterium -mediated transformation relative to a control solanaceous plant for which the expression level and/or activity of CSPR has not been decreased.

36. The method of claim 35, wherein decreasing the expression level and/or activity of CSPR in the solanaceous plant comprises introducing a polynucleotide construct into at least one plant cell of the solanaceous plant, the polynucleotide construct comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell, and wherein the transcribed region is designed to produce a transcript for post- transcriptional gene silencing or antisense-mediated gene silencing of CSPR.

37. The method of claim 36, wherein the transcript for post-transcriptional gene silencing comprises an miRNA, an siRNA, an hpRNA or a dsRNA.

38. The method of claim 36 or 37, wherein the plant cell is regenerated into a plant comprising in its genome the polynucleotide construct.

39. The method of claim 35, wherein decreasing the expression level and/or activity of CSPR in the solanaceous plant comprises introducing into at least one solanaceous plant cell a disruption of a CSPR gene, wherein the disruption decreases the expression level or activity of CSPR in said solanaceous plant cell relative to the expression level or activity of CSPR in a corresponding control, solanaceous plant cell lacking the disruption of the CSPR gene.

40. The method of claim 39, wherein said disruption of the CSPR gene comprises at least one member selected from the group consisting of a DNA insertion, a DNA deletion, and a DNA substitution of at least one base pair in the CSPR gene.

41. The method of claim 39 or 40, wherein introducing into at least one solanaceous plant cell a disruption of the CSPR gene, comprises targeted mutagenesis, homologous recombination, or mutation breeding.

42. The method of claim 40 or 41, wherein the DNA insertion comprises

(a) a DNA insertion in the 5'UTR of the CSPR gene;

(b) a DNA insertion in an exon of the CSPR gene; or

(c) a DNA insertion in an intron of the CSPR gene.

43. The method of any one of claims 39-42, wherein the disruption of the CSPR gene is a homozygous disruption.

44. The method of any one of claims 39-43, wherein the solanaceous plant cell is regenerated into a solanaceous plant comprising in its genome the disrupted CSPR gene.

45. The method of any one of claims 35-44, wherein the solanaceous plant is selected from the group consisting of potato, tomato, tomatillo, Cape gooseberry, eggplant, pepper, tobacco, and petunia.

46. The method of any one of claims 35-45 wherein the expression level and/or activity of the CSPR in the solanaceous plant or the part thereof is decreased when compared to the expression level and/or activity of CSPR in a control solanaceous plant or the corresponding part of the control solanaceous plant.

47. A method for the transformation of a solanaceous plant with a gene of interest, the method comprising contacting a modified solanaceous plant cell with an Agrobacterium strain comprising the gene of interest contained in a Ti plasmid, wherein the modified solanaceous plant cell comprises a decreased expression level and/or activity of CSPR, relative to the expression level and/or activity of CSPR in a control solanaceous plant cell; whereby the gene of interest is transferred to the at least one cell.

48. The method of claim 47, wherein the modified solanaceous plant cell comprises a polynucleotide construct comprising a promoter operably linked to a transcribed region, wherein the promoter is expressible in a plant cell, and wherein the transcribed region is designed to produce a transcript for post-transcriptional gene silencing or antisense- mediated gene silencing of CSPR.

49. The method of claim 48, wherein the transcript for post-transcriptional gene silencing comprises an miRNA, an siRNA, an hpRNA or a dsRNA.

50. The method of claim 47, wherein the modified solanaceous plant cell comprises in its genome a disruption in a CSPR gene, wherein the disruption decreases the expression level or activity of CSPR in said solanaceous plant cell relative to the expression level or activity of CSPR in a corresponding control, solanaceous plant cell lacking the disruption of the CSPR gene.

51. The method of claim 50, wherein the disruption of the CSPR gene comprises at least one member selected from the group consisting of a DNA insertion, a DNA deletion, and a DNA substitution of at least one base pair in the CSPR gene.

52. The method of claim 51, wherein the DNA insertion comprises

(a) a DNA insertion in the 5'UTR of the CSPR gene;

(b) a DNA insertion in an exon of the CSPR gene; or

(c) a DNA insertion in an intron of the CSPR gene.

53. The method of any one of claims 50-52, wherein the disruption of the CSPR gene is a homozygous disruption.

54. The method of any one of claims 47-53, further comprising regenerating a transformed solanaceous plant from the modified solanaceous plant cell.

55. A transformed solanaceous plant produced by the method of any one of claims

35-54.

56. An isolated nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: (a) the nucleotide sequence set forth in SEQ ID NO: 14 orl6;

(c) a nucleotide sequence having at least 85% identity to at least one full- length nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOS: 14 and 16, wherein the nucleotide sequence encodes a polypeptide comprising CSPR activity; and

57. The isolated nucleic acid molecule of claim 56, wherein the isolated nucleic acid molecule is a non-naturally occurring nucleic acid molecule.

58. An expression cassette comprising a promoter operably linked to the nucleic acid molecule of claim 56 or 57.

59. A transformed plant, plant cell, other non-human host cell, or seed comprising the nucleic acid molecule of claim 55 or 56 or the expression cassette of claim 57.

60. A polypeptide comprising an amino acid sequence selected from the group consisting of:

(a) the amino acid sequence set forth in SEQ ID NO: 15 or 17

(c) an amino acid sequence having at least 85% identity to at least one full-length amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NOS: 15 and 17, wherein the polypeptide comprises CSPR activity; and an amino acid sequence encoded by a nucleotide sequence having at least 85% identity to at least one full-length nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOS: 14 and 16, wherein the polypeptide comprises CSPR activity.